Doublecortin-like kinase and neuronal differentiation Dijkmans, T.F.
19
0
0
Hele tekst
(2) Chapter2. Chapter5 TRANSCRIPTIONAL REGULATIONOFDCLKSHORT INNS1PC12CELLS . DijkmansTF,WoutersKA,PolmanJA,VanderLaanS,KamphorstJT,VanHooijdonk LW,FitzsimonsCP,VreugdenhilE. Division of Medical Pharmacology, Leiden/Amsterdam Center for Drug Research andLeidenUniversityMedicalCenter,TheNetherlands. 117.
(3) 118. Chapter5. ABSTRACT InthepresenceofNerveGrowthFactor(NGF),Ns1PC12cellsundergoneuronal differentiation.Previously,weidentifiedDCLKshortasanNGFinducedgenewitha function in neuritogenesis in these cells. Several other studies indicated that expression of the DCLK gene is regulated by glucocorticoids. However, the molecular mechanisms that underlie expression of DCLKshort are unknown. Therefore, we investigated these mechanisms in Ns1 PC12 cells. Upregulation of DCLKshort was shown to partially depend on signaling by Protein Kinase A and ExtracellularsignalRegulatedKinase1/2.Activationoftheglucocorticoidreceptor was able to suppress NGFmediated upregulation of DCLKshort. Specific increase of cAMP levels by stimulation with Forskolin (FSK) also caused upregulation of DCLKshort. In addition, we report an important role for sequence 51 to 43, relative to the transcription start site, in basal and induced expression of DCLK short.Thissequence,AGACGTCAisactivatedbyFSKandNGFtreatment.Together, thesedataprovidenewinsightinthetranscriptionalregulationofDCLKshort. .
(4) Chapter5. INTRODUCTION How a dividing cell transforms into a finely structured neuron with electrophysiologicalpropertiesisincompletelyunderstood.Sinceitsdiscovery,the PC12 cell line has been a valuable cell model to study this process of neuronal differentiation[1].InthepresenceofNGF,PC12cellsceasetodivideanddevelop morphologicalandbiochemicalcharacteristicsofneurons[2].Avarietyofsignaling pathwaystransducesignalsafterNGFstimulation,inwhichtheMitogenActivated ProteinKinase(MAPK)pathway,thePhosphatidylinositol3Kinase(PI3K)pathway and the Phospholipase C (PLC) pathway play central roles [3]. These pathways project onto a number of transcription factors, which initiate complex transcriptional regulation of no less than a thousand genes [46]. Typically, phosphorylationoftranscriptionfactorslikeElk,AP1andcAMPresponseelement binding protein (CREB) induces their binding to specific sequences of target promoters. Here, they recruit transcription machinery and catalyze mRNA transcription [7]. Previously, we identified DCLKshort as an NGFinduced protein thatregulatesneuritogenesisinNs1PC12cells([5]andsubmitted). DCLKshortisderivedfromtheDCLKgene,whichregulatesneurogenesis, neuronalmigration,apoptosisanddifferentiation[811].TheDCLKgenegivesrise to 8 splice variants through alternative promoter usage and alternative splicing routes [11;12]. These splice variants differ mainly in the presence of 3 conserved protein domains, namely a Doublecortin domain, a serine, threonine and proline (SP)rich domain and a kinase domain. DCLKshort is produced from the most 3' located promoter and encodes the SPrich domain and the kinase domain. The expression of DCLKshort has been reported to be affected by kainate and glucocorticoids [1316]. However, which transcription factors and signaling pathwaysregulateDCLKshortexpressionisunknown. Therefore, we investigated how NGFinduced DCLKshort upregulation occurs in Ns1 PC12 cells. We show that upregulation of DCLKshort involves signalingbyProteinKinaseA(PKA)andExtracellularsignalRegulatedKinase(ERK) 1/2.Activationoftheglucocorticoidreceptor(GR)wasabletosuppressDCLKshort expression, when induced with NGF. In addition, we identified a putative cAMP responseelement(CRE)intheproximalpromoterthatmediatesbasalDCLKshort expression and NGF/FSKinduced upregulation. Together, these data provide insight in the transcriptional regulation of DCLKshort, which in its turn regulates neuritogenesis(Chapter4). MATERIALSANDMETHODS AnalysisofthepromoterregionDCLKshort Relevant sequences were retrieved from rat genome database RGSC v3.4 (http://rgd.mcw.edu/wg/home) and verified by sequencing. Transcription factor predictionsweredoneusingtheTranscriptionElementSearchSystem(TESS;[17]).. 119.
(5) 120. Chapter5. Cellculture,stimulationandtransfection Neuroscreen1PC12cells(Ns1PC12;Cellomics,Pittsburgh,PA,USA)werecultured at37°Cat5%CO2inRPMI1640,supplementedwith5%FoetalBovineSerum,10% Horse Serum, penicillin (20 U/ml) and streptomycin (20 g/ml all Invitrogen, Carlsbad, CA, USA). For cell stimulation, 500 000 Ns1 PC12 cells per well were seededincollagencoated(Roche)6wellplates.Afteradhesion,cellswereplaced onRPMI1640with0.5%strippedFoetalBovineSerum,1.0%strippedHorseSerum, penicillin (20 U/ml) and streptomycin (20 g /ml) and incubated overnight. The nextday,thecellswerestimulatedwith50ng/mlratNerveGrowthFactor(NGF), 106MDexamethasone(DEX),10MForskolin(FSK),50MH89or10MU0126 (SigmaAldrich, St Louis, MO, USA) in recommended solvents. Inhibitors were added15minpriortostimulation.TransfectionofNs1PC12cellswereperformed using the Amaxa Nucleofector (Amaxa Biosystems, Gaithersburg, MD, USA) with transfection kit Cell Line Nucleofector Kit V (Amaxa Biosystems), according to protocol with 1.5 g plasmid per 2 million cells. For stimulation, 1 million transfectedcellswereseededperwellin6wellplates. Western blot was performed as described previously [18], using antibody against phosphoCREB (pCREB Ser133; Cell Signaling Technologies, Danvers, MA, USA), DCLKshort(CPG16/CaMkinaseVI,BDBiosciences,PaloAlto,CA,USA),Actin(C2; SantaCruz,CA,USA)andalphatubulin(CytoskeletonInc.,Denver,CO,USA). TotalRNAisolation,cDNAsynthesisandqPCR Total RNA isolation, cDNA synthesis and qPCR were performed as described previously [5]. Realtime qPCR primer sequences forDCLKshort were5’CTC TGG CTCTTGGCTATTGTC3’and5’TCGTTCTCATCCATTGAGCTGC3’.Normalization wasdonebyusing18sprimersofsequence5’GTTGGTTTTCGGAACTGAGGC3’ and5’GTCGGCATCGTTTATGGTCG3’. Plasmidconstruction GenomicDNAwasisolatedfromNs1PC12cellsusingtheQiaAmpDNABloodMini Kit(Qiagen)accordingtomanufacturer’sprotocol.DCLKshortpromoterfragments of1659basepairswereamplifiedbyPCRusingtheprimers5’CCTGGAATCCAG TCT TTA CC3’ and 5’ACT GAA GCC TCG AGG TTA GGG ATG GCT AAG GC3. The latterencodes,inadditiontounderlinedgenomicsequence,anXhoIrestrictionsite inboldfollowedbystuffernucleotidestofacilitatecloning.Theresultingfragment wasseparatedbyagarosegelelectrophoresisandthenisolatedusingtheQIAquick gelextractionkit(Qiagen,Venlo,TheNetherlands).Subsequently,thePCRproduct was cloned into pGEM T Easy, according to manual instructions (Promega, Madison,WI,USA).PlasmidsweregrownwithJM109CompetentCells(Stratagene La Jolla, CA, USA), after which colony PCR was performed to determine insert containing plasmids. Positive plasmids were isolated using the SV Miniprep Kit (Promega)andtheplasmidyieldandqualitywasdeterminedusingtheNanodrop spectrophotometer(NanoDropTechnology,Wilmington,DE,USA).Insertswerecut.
(6) Chapter5. from the pGEM T Easy plasmids using restriction enzymes Sac1 and Xho1 (both Promega) in buffer A (Promega) overnight at room temperature. The pGL3 basic reporter plasmid (Promega) was linearized likewise. The DNA fragments were separated on agarose gels and relevant fragments were then isolated. Subsequently, fragments were ligated overnight at room temperature, using T4 DNA ligase (Promega) at a ratio of 3:1 insert versus vector. Ligations were transformed into JM109 competent cells (Promega) and effective plasmid construction was verified by sequencing. The insert encoded DCLKshort genomic sequence from base pair 1623 to +39 and was cloned upstream the luciferase construct. Sequencing was performed using BigDye Terminator Cycle Sequencing Kitsonthe3100AvantGeneticAnalyzer(AppliedBiosystems,FosterCity,CA,USA); primer5’ATTGGTTCTCTGATTTCCCTA3’and5’TGGATTCTGCAGTTACCACAG 3’.WenamedthisplasmidpGL3DCLK. InordertoconstructapGL3DCLKplasmidwithamutantputativeCRE,we performed site directed mutagenesis. Primers were designed according to guidelines from the QuickChange SiteDirected Mutagenesis Kit (Stratagene) and hadthefollowingsequences:5’CCCACTGCTGCTGGGAAGATTTCAGCCTTACGC AG3’ and 5’CTG CGT AAG GCT GAA ATC TTC CCA GCA GCA GTG GG3’. The underlining indicates the position of the CRE in the original sequence and is mutated here in bold. Consequently, the original sequence of pGL3DCLK, AGACGTCA was mutated into AGATTTCA. The PCR on pGL3DCLK and digestion with Dpn1 was done using the QuickChange SiteDirected Mutagenesis Kit (Stratagene).Aftertransformation,positiveplasmidswith2pointmutationsinthe putativeCRE,andnotelsewhere,wereconfirmedbysequencing.Thisplasmidwas termedpGL3DCLKCRE. Luciferasereporterassaysanddataanalysis Ns1PC12cellswerewashedwithPBSandlysedwith250lReporterLysisBuffer (Promega)for20minutesatroomtemperaturewhileagitating.Fornormalization of firefly luciferase data, the protein content of each sample was used. NormalizationagainstRenillaluciferaseactivitywasimpossible,asRenillaluciferase activity responded to treatment with various agents. In comparison of the basal fireflyluciferaseactivityofpGL3DCLKandpGL3DCLKCREonly,Renillaluciferase data was used for normalization. Protein content was quantified using the BCA Protein Assay Kit (Pierce Inc., Rockford, Ill, USA) and the FLUOstar Optima platereader (BMG Labtech GmbH, Offenburg, Germany). Luciferase activity was measured on the Lumat LB 9507 (Berthold Technologies, Bad Wildbad, Germany) with reconstituted Luciferase Substrate (Promega) following the manufacturer’s protocol.Eachexperimentalsamplewasmeasuredtwiceusing30llysatefor30 secondsandmeanaveraged. . 121.
(7) 122. Chapter5. A. B -51. -43. tgctgggaAG ACGTCAgcct tacgcaggaa == ====== ======. CREB ATF-1, ATF2, ATF3, c-Jun, EivF, TREB-1. ======= NF-S. C DCLK-short (53 kD) Loading control NO. 24 h. NGF. NGF. Figure 1. DCLK-short promoter region. A). The Transcription Start Site (TSS) of DCLK-short is indicated as position 0, which corresponds to position 144654237 on rat chromosome 2 according to RGSC v 3.4. The transcript coding DCLK gene spans 76 kb further until position 144678222. The DCLK gene has an alternative, upstream promoter which produces additional transcripts and is omitted in this graph. Upstream position 0, a number of transcription factor binding sites are depicted that may play a role in DCLK-short regulation in Ns-1 PC12 cells. These binding sites are non-exhaustive and were predicted using Transcription Element Search System (TESS). B). Sequence -51 to -43 bp is given with all predicted mammalian binding sites (underlined) for indicated transcription factors. C). Representative Western Blot for previously observed DCLK-short induction by 24 hours of NGF (Chapter 4). Actin content served as loading control.. .
(8) Chapter5. . cFos. A 40. 40. *. 30 20 10 0. DCLKshort. Relative expression. Relative expression. B. *. 0. 5. 15. 60. 35 30 25 20 15 10 5 0. 120. 0. 5. Time (NGF). C. D. DCLKshort. 6 4 2 1. 4. 6. Time (NGF). 120. 8. 24. *. 10. Relative expression. Relative expression. 8. 0. 60. DCLKshort. *. 10. 0. 15. Time (NGF). 8 6 4 2 0. 0. 1. 4. 6. 8. 24. Time (FSK). Figure 2. Time series NGF and FSK for endogenous DCLK-short mRNA. A). Relative c-fos expression levels in response to indicated periods of time of NGF stimulation. B). Relative DCLK-short expression levels for the identical samples of A). No significant induction is observable for DCLK-short within this immediate-early time frame. C). Relative expression levels of DCLK-short up to 24 hours. After 24 hours, a significant induction of 7.5±0.5 (p<0.05) is present with NGF stimulation. D). Also with FSK, a signification induction is detected (6.9±0.4; p<0.05). Bars are mean (n=2) ±SEM determined by qPCR.. RESULTS AnalysisofthepromoterregionDCLKshort The 1.6 kilobase sequence upstream of the rat DCLKshort transcription start site was analyzed to identify possible regulatory elements that are known to be activated after NGF stimulation in PC12 cells. In RGSC v3.4, the rat DCLK gene is locatedonchromosome2oftheratgenomeatlocation2q26(NC_005101.2)and spans from base pair 144678222 to 144754237 (76 kilobases). Here, we. 123.
(9) Chapter5. # 8. *. 6. *. 4 2. X. F NG. F. +. DE. NG. X DE. ro. l. 0. nt. Relative expression DCLK-short. investigatedtheDCLKshortpromoterregionas1.6kilobasesequenceupstreamof its TSS, position 144678222. For reference, the first base pair of TSS ATTC is designated position 0. By using the Transcription Element Search System (TESS;[17])weidentifiedatposition51to43,aconservedmotif(AGACGTCA).This. Co. 124. Figure 3. DCLK-short mRNA Expression in Ns-1 PC12 cells in response to DEX, NGF or both. Ns-1 PC12 cells were stimulated -6 with NGF (50 ng/ml), and DEX (10 M) for 24 hours. DCLK-short mRNA levels were determined by qPCR. NGF induced 6.9±0.2-fold (p<0.05), DEX reduced the NGF-induction to 4.8±0.2-fold (~30% reduction) and DEX only had no effect. Bars are expression levels relative to the negative control. Each bar indicates n=6 and error bars indicate SEM. * indicates significant differences (p<0.05) compared to negative control, and # indicates significant differences (p<0.05) between NGF and NGF + DEX.. motif is predicted to facilitate binding of several cAMP responsive transcription factors,includingCREB,Atf1,Atf2,Atf3andEivF[19;20].SeeFig.1foranoverview oftheDCLKshortpromoterregion,togetherwiththecorrespondinganalysis. InductionofendogenousDCLKshortmRNAexpressioninNs1PC12cells Previously,wereportedDCLKshortasaNGFresponsivegene([5]andFig.1C).In ordertodeterminetheinitialupregulationofDCLKshortmRNA,weperformeda timeseriesexperiment.AstheDCLKshortpromoterregionbearsaputativeCRE, westimulatedNs1PC12cellswithboth50ng/mlNGFand10MFSK.FSKisan agent that specifically raises intracellular cAMP levels and thus renders a more specificCREactivationthanNGF[21].Althoughwithin2hourscFosisinducedby NGF (fold change 32.5±2.4; [22]), no obvious DCLKshort induction was observed during this time span (see Fig. 2A and B). Extending the periods of treatment revealedthatafter24hours,aclearandsignificantinductionof7.5±0.5byNGFand 6.9±0.4byFSKwasobserved(Fig.2CandD). RepressionofNGFinducedDCLKshortmRNAbyDEXinNs1PC12cells Previous in vivo observations suggested that activated GR may be able to (trans)repress DCLK expression [16]. Therefore, we verified whether 106 M DEX activated GR was able to inhibit DCLKshort mRNA expression, either in the presence or absence of NGF (Fig. 3). In line with the previous experiment, NGF significantly induced DCLKshort expression 6.9±0.2fold (p<0.05). DEX alone had no significant effect on DCLKshort expression. However, both DEX and NGF.
(10) Chapter5. 2 1 0. 0. 0.5. 5. 25. 50. 100. 250. B. Relative luciferase acitivity. NGF (ng/ml). *#. 2. 1. 0. D EX. *. *. +. 3. 3. N G F. C *. N G F. * *. C on tr ol. 4. Relative luciferase activity. A. Relative luciferase acitivity. resulted in a 4.8±0.2fold induction (p<0.05), meaning that DEXactivated GR significantlyrepressedNGFmediatedinductionwith30%. pGL3DCLKisaffectedbyNGFandFSKandDEXstimulation In order to verify whether pGL3DCLK could be induced by NGF and FSK, like endogenousDCLKshortmRNA,performeddoseresponseexperiments.Fig.4Aand B depict the data from these experiments and show that indeed both stimulants are able to induce pGL3DCLK in a dose dependent manner, although maximal induction occurs at submaximal concentrations. Compared to the endogenous inductionsmeasuredbyqPCR,theamplitudesofpGL3DCLKinductionmeasuredby luciferaseassayswerelower(7.5±0.5versus2.9±0.1by50ng/mlNGFand6.9±0.4 versus 4.0±0.1 by 10 M FSK). Maximal induction of DCLKshort occurred at 100 ng/ml NGF, with a significant fold induction of 3.5±0.2 and at 10 μM FSK, with a significant fold induction of 4.0±0.1 (both p<0.05, versus untreated cells). Also in linewithendogenousDCLKshortmRNAregulation,DEXwasabletosuppressNGF mediatedinductionofpGL3DCLK.Fig.4CshowsthatDEXstimulationreducedthe inductionofpGL3DCLKsignificantlyfrom2.4±0.2to1.9±0.1(p<0.05),indicatinga transrepressionof33%.. 5. * 4. *. *. 3. *. 2 1 0. 0. 1. 10. 50. 100. FSK (PM). Figure 4. Characterization of pGL3-DCLK in Ns-1 PC12 cells. PC12 Ns-1 cells were transfected with pGL3-DCLK and treated with indicated stimuli. After 24 hours, cells were harvested to measure protein content and luciferase activity. * indicates significant changes (p<0.05) relative to negative control. A). NGF stimulation, with a maximum of 3.5±0.2-fold induction. Each bar n2 ±SEM. B). FSK stimulation, with a maximum of 4.0±0.1-fold induction. Each bar n2 ±SEM. C). PC12 Ns-1 cells were transfected with pGL3-DCLK and stimulated with 10-6 M DEX, 20 minutes prior to 24 hours stimulation with 50 ng/ml NGF. DEX significantly reduced NGFinduction from 2.4±0.2 to 1.9±0.1 (66%;p<0.05; #). Each bar n6 ±SEM.. 125.
(11) #*. 2. #*. 1. 6. H. O 12. 89. F G. +. 2. #*. 1 0. G. F. 3. N. N. G. F. U. +. N. on tr o. l. 0. *. 4. FS K +H 89. B. FS K. *. C on tr ol. 3. C. A. Relative luciferase activity. Chapter5. Relative luciferase activity. 126. Figure 5. Induction of DCLK-short is MEK- and PKA-dependent. pGL3-DCLK was transfected in Ns-1 PC12 cells and stimulated for 24 hours with or without preincubated inhibitors. Then, luciferase activities were measured and normalized against control and protein content. n4 per bar. A). Transfected cells were stimulated with NGF alone or with PKA inhibitor H89 or with MEK-inhibitor U0126. NGF produced an induction of 2.4±0.2, which was significantly reduced by H89 to 1.6 ±0.1 and by U0126 to 1.5±0.04. B). Transfected cells were exposed for 24 hours to FSK alone or pre-incubated with PKA inhibitor H89. FSK produced a 3.3±0.3 induction, whereas H89 significantly reduced this to 0.8±0.1. * indicates significant difference versus control, # indicates difference versus “NGF” or “FSK” (p<0.05). Error bars represent SEM, n4.. InductionofDCLKshortisMEKandPKAdependent To determine which pathways are important in mediating the induction of DCLK short,wemadeuseoftheMEKinhibitorU0126andofthePKAinhibitorH89,using pGL3DCLKasareadout.AsNGFisknowntoactivatetheERKpathwayandthePKA pathway, we inhibited each with the respective inhibitors [3]. FSK is a specific cAMPraising agent and was therefore combined with PKA inhibitor H89 only [21;23].AscanbeseeninFig.5A,preincubationwithMEKinhibitorU0126caused theNGFinductiontodecreasesignificantlyfrom2.4±0.2to1.5±0.04(p<0.05).Also coincubation with PKA inhibitor H89 reduced NGFactivated luciferase activity downto1.6±0.1foldinduction(p<0.05).BoththeRasRafMEKERKpathwayand the PKA pathway were important in transducing the NGF signal into DCLKshort mRNA production. Moreover, Fig. 5B shows that the induction of DCLKshort luciferase activity by FSK (3.3±0.3fold induction) is completely abolished by the PKAinhibitorto0.8±0.1(p<0.05). .
(12) Chapter5. DCLKshortexpressionismediatedbythe51to43AGACGTCApromoterelement To assess the relevance of the predicted CRE motif for DCLKshort induction, we mutatedthissiteinpGL3DCLK.AscanbeseeninFig.6A,significantinductionof pGL3DCLK by NGF and FSK occurs at a fold change of 2.4±0.2, and 3.6±0.6. Introduction of 2 point mutations in the 1.6 kb promoter sequence substantially inhibited the inductionsdown to 1.9±0.1 and 1.6±0.1, respectively (21% and 56% reduction).ThisindicatedthatthepredictedCREisanimportantelementinDCLK shortinduction,moreinresponsetoraisedintracellularcAMPlevelsbyFSKthanto NGF. Interestingly, basal DCLKshort expression was also dependent on the predicted CRE as pGL3 DCLKCRE showed intrinsically lower luciferase activity than pGL3DCLK (1.0±0.1 versus 0.2±0.0; as normalized versus Renilla luciferase; p<0.05; Fig. 6B). In line with a role for CREB in basal expression of DCLKshort, detectablelevelsofphosphorylatedCREBweremeasuredinuntreatedNs1PC12 cells (Fig. 6C). As expected, NGF and FSK induced CREB phosphorylation after 1 hour of stimulation, which returned to basal levels after 24 hours, reflecting the cAMPrefractoryperiod[24]. DISCUSSION Given the important roles DCLK proteins perform in processes like neurogenesis, neuronal migration, apoptosis and differentiation [811], knowledge of molecular signalsthatdeterminetheirexpressionisrequired.Werecentlycharacterizedthe splicevariantDCLKshortasaregulatorofneuritogenesisinNGFtreatedNs1PC12 cells (Chapter 4). In the present study, we investigated DCLKshort as an NGF responsive gene in Ns1 PC12 cells. We report that upregulation of DCLKshort occurs through PKA and ERK 1/2dependent pathways. Moreover, we provide evidencethatatposition51to43(relativetotheTSSofDCLKshort;AGACGTCA), amotifispresentthatisimportantforits(cAMPresponsive)expression. AnumberofobservationsindicatedthatDCLKshortwasprimary,acAMP responsivegene.First,inductionofDCLKshortwasshowntobemediatedbyNGF and FSK, which both activate CREB [25]. Although NGF stimulates an array of transcriptionfactors,includingElk1,AP1,SRF,cMycandCREB,FSKisconsidered to be a relatively specific CREB agonist [21;25]. Second, starting at position 51 relativetothetranscriptionstartsiteamotif(AGACGTCA)wasapredictedacAMP responsive element [17;19;20;24]. Although the consensus, palindromic CRE sequence is TGACGTCA, also halfsites of this sequence and the AGACGTCA sequencehavebeenshowntoelicitasubstantialcAMPresponse[19].Likemany CREs, the predicted CRE of DCLKshort is located within 2 kb of the transcription start site, which support likelihood of its functionality [26]. Also, previous Serial Analysis of Chromatin Occupation (SACO) experiments showed that CREB is physicallyabletobindDCLKshortpromoterfragmentscontainingtheCGTCAhalf site([26];http://natural.salk.edu/CREB/).. 127.
(13) 128. Chapter5. A. B *. 4 3. *. 2. *#. *. #. 1 0. Basal. 1.25 1.00 0.75 0.50 0.25 0.00. * DCLK. 'CRE. D. C LK. C on 'C tr ol R E C on tr ol D CL K N G F 'C R E N G F D C LK FS K 'C R E FS K. Relative luciferase activity. 24hour. Relative Firefly/Renilla activity. Additionally,weshowedthatCREBactivatingpathwaysarerelevantforDCLKshort induction. Typically, NGFsignaling entails activation of transcription factor CREB makinguseoftheERKpathwayandthePKApathway[3;26;27].Applicationofthe ERK inhibitor U0126 and PKA inhibitor H89 inhibited DCLKshort induction when stimulatedwithNGF[23;28].ThisoutcomemaybeexpectedwhenCREBregulates DCLKshort expression. Also application of H89 showed that induction of DCLK shortbyFSK,throughtheclonedpromotersequence,isentirelydependentonPKA signaling. Where FSK is a relatively specific CREB activator, its activation is mediated by PKA signaling [23;25]. Apparently, PKA needs to signal in order to allowDCLKshortinductionbyFSK,suggestingaroleforCREB.BothPKAandCREB. C. 1 hour. 24 hour pCREB (42 kD) Tubulin (55 kD). Figure 6. The CRE at -48 of the DCLK-short promoter plays an important role in DCLKshort expression. Ns-1 PC12 cells were transfected with pGL3-DCLK or pGL3DCLKCRE (DCLK or CRE), which differ only in their CRE-sequence. A). Cells were either vehicle- or NGF- or FSK-treated for 24 hours (Control, NGF, FSK). Then, luciferase activity was measured and normalized against protein content. Bars are n6 with SEM. Introduction of 3 point mutations in the 1.6 kb promoter sequence severely inhibited the inductions down to 1.9±0.1 and 1.6±0.1 (38% and 87% reduction; p<0.05). * Indicates a significant difference relative to Control, # indicates significant differences between DCLK and CRE for the NGF-treated and the FSK-tread groups (p<0.05).B). Cells were transfected with the indicated Firefly luciferase and Renilla luciferase constructs. The basal, point-mutated luciferase activity of pGL3-DCLK CRE was significantly lower than the unmutated pGL3-DCLK (0.2±0.0 versus 1.0±0.1). These data revealed that basal DCLK-short expression is largely dependent on the -48 CRE sequence. # indicates significant differences between DCLK and CRE (p<0.05). C). Western Blot analysis on Ns-1 PC12 cells shows that basal levels of phosphorylated CREB are maintained and transiently induced by NGF or FSK treatment. Tubulin served as a loading control..
(14) Chapter5. are known to be endogenously expressed in PC12 cells and would thus allow translationindependentDCLKshortinduction[26]. Luciferase assays further supported a role for cAMP using the predicted CRE.Cloningof1.6kbDCLKshortpromoterregionintopGL3luciferaseconstructs maintained inducibility by NGF and FSK. Although inductions of ~8fold were measuredbyqPCR,luciferaseassaysreportedinductionsofamaximumof~4fold (Fig.2BandDversusFig.4AandB).Possibly,thesedifferencesresultfromdifferent experimentaltechniques.Alternatively,additionalregulatoryregionspresentinthe Ns1PC12genome,whichcontributetoDCLKshortinduction,wereabsentinthe partial genomic sequence of pGL3DCLK. Also, the sterical conformation of the original genome versus the pGL3DCLK plasmid may be different and produce transcriptional differences. However, the isolated sequence in pGL3DCLK, which includedthepredictedCRE,accountedatleastinpartforDCLKshortupregulation, possiblyusingthisCRE. TogainfurtherinsightinDCLKshortregulation[5],weinvestigatedtiming of DCLKshort induction. Both NGF and FSK activated transcription of DCLKshort later than that of a typical immediateearly gene, cFos [22]. Within 2 hours, no significantinductionwasobserved;however,thiswassubstantialafter24hoursof stimulation (Fig. 2A). In general, such a response is considered delayed and suggests a translation dependent upregulation of DCLKshort [7]. To assess translation dependence, cells were incubated with 24 hours of protein synthesis inhibitor cycloheximide and NGF or FSK. However, cycloheximide treatment severely reduced cell viability and excluded reliable measurements (data not shown).BecausebasalexpressionlevelsofDCLKshortexistinthecell(Fig.1Cand Chapter 4), basal transcription machinery must occupy the DCLKshort promoter. Apparently,thisisnotsufficienttoallowarapid,increasedexpressioninresponse toNGF,assubstantialinductionoccurslaterthan8hours(Fig.2). Given the constitutive expression of DCLKshort, the chromosomal configuration is suitable for driving transcription. Therefore, chromosomal remodelingseemsunlikelytoexplainthedelayedinduction,althoughitcannotbe ruled out. Possibly, associating and/or dissociating transcription factors with relativelyslowkineticsprovidebasisfortranslationindependentinductionofDCLK short mRNA. More likely, the delayed induction may require synthesis of transcriptionfactors,whichareadditionaltothosemaintainingbasalexpression. Comparison of pGL3DCLK versus pGL3DCLKCRE remarkably revealed thatthepredictedCREsequenceisimportantforbothmaintenanceofbasalDCLK short levels and the delayed, stimulus dependent upregulation (Fig. 6). Although severaltranscriptionfactorsarepredictedtointeractwiththesequence,CREBwas previously shown to coprecipitate with this promoter sequence and therefore possibly accounts for basal DCLKshort expression [26]. In line with this notion, Western blot analysis indicated that without stimulation low levels of Ser133 phosphorylatedCREBarepresent(Fig.6C).Moreover,thelossofbasalexpression due to mutation of the predicted CRE in pGL3DCLKCRE can be explained by. 129.
(15) 130. Chapter5. reducedCREBaffinityforthissequence.However,increasingphosphorylatedCREB by 1 hour treatment with NGF or FSK leaves endogenous DCLKshort levels unchanged. Only when CREB phosphorylation has almost returned tobasal levels after 24 hour of NGF or FSK treatment, DCLKshort expression is elevated (Fig. 2 andFig.6C).ThissuggeststhatDCLKshortisnotdirectlyinducedbyCREB,butfirst requires synthesis of additional transcription factors. Such factors should be upregulated in response to NGF and/or FSK and be able to interact with the predictedCREoritsbindingcomplextomediatesubsequentDCLKshortinduction. Inprinciple,thesetranscriptionfactorscanbeprimaryorlaterresponsegenes. Inspection of the predicted CRE sequence revealed that NFS, TREB1, c Jun, CREB, Atf1, Atf2, Atf3 and EivF were transcription factors that may interact withthissequence(Fig.1B).NFSexpressionisassociatedwithBcellsandunlikely toplayaroleintranscriptionalregulationtoPC12cell[29].TREB1waspreviously reported to remain inactive after FSK stimulation in PC12 cells and is therefore unlikely to account for increased DCLKshort expression [30]. A role for EivF in PC12 cells so far is unreported. Interestingly, cJun expression is induced by NGF andFSKandmaythereforeplayaroleintranslationdependentinductionofDCLK short[26;31].Also,wepreviouslyreportedthatAtf3isanNGFresponsiveprimary responsegeneandseveralNGFresponsivedelayedresponsegenesareknownAtf3 targets[18].Moreover,Atf3hasbeenshowntobeincreasedbyFSKintheTC1.6 and NIH3T3 cell lines [32]. Potentially, Atf3 plays a role in the increasing the. Figure 7. Proposed model of transcriptional regulation DCLK-short in Ns-1 PC12 cells. A). Basal expression of DCLK-short is maintained by the described AGACGTCA element and may be mediated by pCREB. B). DCLK-short upregulation shows typical delayed kinetics and is therefore likely translation dependent. FSK/NGF-upregulated transcription factors mediate DCLK-short upregulation using the AGACGTCA element, possibly Atf3 and/or c-Jun..
(16) Chapter5. expressionofDCLKshortinatranslationdependentmanner.Inthislight,itshould be noted that CREB is thought not to form heterodimers with cJun or Atf3 [25]. Therefore, when these transcription factors mediate upregulation of DCLKshort expression,theymustdosobereplacingCREB.Thelatterhasbeenmadeplausible for Atf3 [32]. Interestingly, Atf3/cJun heterodimers do occur and have been reportedtoenhanceNGFinducedneuritogenesisinPC12cells[33;34].Collectively, thesedataprovidesupportforDCLKshortisacAMPresponsive,yetnonprimary responsegene(foroverview,seeFig.7). Where NGF was shown to induce DCLKshort expression, the GR was showntoexertrepressiveeffects.BothqPCRandluciferaseexperimentsrevealed that coincubation with DEX resulted in a significant decrease in induction. Given the fact that pGL3DCLK is susceptible to GRmediated inhibition, the responsible promoter sequence must involve the isolated 1.6 kb sequence. In general, activatedGRisabletosuppressexpressionbyeitheranegativeGREorviaprotein protein interactions [35]. Although some GR response elements (GRE) may lie in theDCLKpromoter(Fig.1A),incubationwithDEXaloneshowednoeffectonDCLK shortexpression(Fig.3).Therefore,noindicationsoffunctionalpositiveornegative GREswerefound.ThissuggeststhatinhibitionofDCLKshortexpressionoccursby proteinprotein interactions with or reducing expression of transcription factors that contribute to DCLKshort expression. NGF stimulation activates several transcriptionfactorswhichmaybeinvolvedinregulationofDCLKshortexpression andsubjecttotransrepressionbytheGR.TheseincludeAP1,NF BandCREB[16]. ThepresentstudyshowedthatDCLKshortisacAMPinduciblegeneinNs1PC12 cells.Specifically,theAGACGTCAsequenceat51to43bpplaysasubstantialrole in this response, as well as in maintaining its basal expression in Ns1 PC12 cells. Several cAMP responsive transcription factors, including CREB, are predicted to occupythissequencebeforeoraftercellstimulation.Inlinewithgeneinductionby cAMP in Ns1 PC12 cells, signaling through PKA and ERK 1/2 is important in mediating the transcriptional response of DCLKshort. Because basal expression and delayed induction of DCLKshort both depend on the same sequence, DCLK short constitutes a gene with intriguing transcriptional regulation. Also, the activated GR was shown to be a negative regulator of DCLKshort expression. Together, these data provide new insight in how DCLKshort, important in regulatingneuritogenesis,isregulatedonatranscriptionallevel. ACKNOWLEDGEMENTS TheauthorgratefullyacknowledgesDr.O.Meijerforcriticallyreadingthe manuscript. . 131.
(17) 132. Chapter5. REFERENCES . 1. L.A.GreeneandA.S.Tischler,Establishmentofanoradrenergicclonallineofrat adrenalpheochromocytomacellswhichrespondtonervegrowthfactor,Proc.Natl. Acad.Sci.U.S.A73(1976)24242428.. . 2. K.Fujita,P.Lazarovici,andG.Guroff,RegulationofthedifferentiationofPC12 pheochromocytomacells,Environ.HealthPerspect.80:12742.(1989)127142.. . 3. D.Vaudry,P.J.S.Stork,P.Lazarovici,andL.E.Eiden,SignalingPathwaysforPC12Cell Differentiation:MakingtheRightConnections,Science296(2002)16481649.. . 4. J.M.Angelastro,L.Klimaschewski,S.Tang,O.V.Vitolo,T.A.Weissman,L.T.Donlin, M.L.Shelanski,andL.A.Greene,Identificationofdiversenervegrowthfactor regulatedgenesbyserialanalysisofgeneexpression(SAGE)profiling,Proc.Natl. Acad.Sci.U.S.A97(2000)1042410429.. . 5. T.F.Dijkmans,L.W.vanHooijdonk,T.G.Schouten,J.T.Kamphorst,A.C.Vellinga, J.H.Meerman,C.P.Fitzsimons,E.R.deKloet,andE.Vreugdenhil,Temporaland functionaldynamicsofthetranscriptomeduringnervegrowthfactorinduced differentiation,J.Neurochem.(2008).. . 6. B.Torocsik,J.M.Angelastro,andL.A.Greene,Thebasicregionandleucinezipper transcriptionfactorMafKisanewnervegrowthfactorresponsiveimmediateearly genethatregulatesneuriteoutgrowth,J.Neurosci.22(2002)89718980.. . 7. H.R.Herschman,Primaryresponsegenesinducedbygrowthfactorsandtumor promoters,Annu.Rev.Biochem.60:281319.(1991)281319.. . 8. H.Koizumi,T.Tanaka,andJ.G.Gleeson,Doublecortinlikekinasefunctionswith doublecortintomediatefibertractdecussationandneuronalmigration,Neuron.49 (2006)5566.. . 9. T.Shu,H.C.Tseng,T.Sapir,P.Stern,Y.Zhou,K.Sanada,A.Fischer,F.M.Coquelle, O.Reiner,andL.H.Tsai,Doublecortinlikekinasecontrolsneurogenesisbyregulating mitoticspindlesandMphaseprogression,Neuron.49(2006)2539.. 10. M.A.Silverman,O.Benard,H.Jaaro,A.Rattner,Y.Citri,andR.Seger,CPG16,anovel proteinserine/threoninekinasedownstreamofcAMPdependentproteinkinase,J. Biol.Chem.274(1999)26312636. 11. E.Vreugdenhil,S.M.Kolk,K.Boekhoorn,C.P.Fitzsimons,M.Schaaf,T.Schouten, A.Sarabdjitsingh,R.Sibug,andP.J.Lucassen,Doublecortinlike,amicrotubule associatedproteinexpressedinradialglia,iscrucialforneuronalprecursordivision andradialprocessstability,Eur.J.Neurosci.25(2007)635648..
(18)
(19) . . !" # ! #$ $&$!*&$ !$ -$ =>? @ ! \& $!$ &&#*!^& ! #!`{|}}{ = #?!$$ ^!=@ ?! !! ! ? ^! !>!# # *!#* @ *$@ ! >$&&#*!^&!&!$*$- # \$ *$# ! ^ $&* !^*!^" # #*}|``` { "" " *! #$ !*!* * \&#$!$&&#*!^& -! *$ -! !*$#^- #* @$$|`` =!$# "" ! *!! ! #$ !!$*$ *^?*# !>! !$ &&$ !& $!$ ^# !$## !!*$ $-!$&&#*!^& " # #`|```{} #$ *!! ! ?=!$#$* *$## *#$*#$#*&$# *$#$!$&&#*!^& #&-*#&!^!*#|}}{{} !*&$#^$ !* -$^}} =^!@ !## # *# $" !^&#$>$^#! $ *!$## #$!*$#&# ^^ !$ !- !|}} ` "= $*"# "@"!^#">@! "! $ *$ ! $^!$ #$!*&$#!!*$ !$# -*? &# =?^$" #>^|`{{ } !#>#!*&$# !*$#&# $#*? ? >= # |`` !^#! "=!-##! $&!*$ !$## *-**? . !$ -$^">-** *#$ |`}{ > !! " # ! & *$## * # - #$ !*$#$ &*# &&!-!*$ # !& **`|` >!? ^! ! !! !# !-!# !$###! ! !! $## ## * $# $ #$! &#$ &#&#-!$# -!--$ *$ $## *-**? & $ &#$!|& #^#*!^-!^#$-# # #!^ | `# >=&#*#^#*-$#^!*"#>^|``}. .
(20) 134. Chapter5. 24. B.MayrandM.Montminy,Transcriptionalregulationbythephosphorylation dependentfactorCREB,Nat.Rev.Mol.CellBiol.2(2001)599609. 25. A.J.ShaywitzandM.E.Greenberg,CREB:astimulusinducedtranscriptionfactor activatedbyadiversearrayofextracellularsignals,Annu.Rev.Biochem.68:82161. (1999)821861. 26. S.Impey,S.R.McCorkle,H.ChaMolstad,J.M.Dwyer,G.S.Yochum,J.M.Boss, S.McWeeney,J.J.Dunn,G.Mandel,andR.H.Goodman,DefiningtheCREBregulon:a genomewideanalysisoftranscriptionfactorregulatoryregions,Cell.119(2004) 10411054. 27. J.Xing,J.M.Kornhauser,Z.Xia,E.A.Thiele,andM.E.Greenberg,Nervegrowthfactor activatesextracellularsignalregulatedkinaseandp38mitogenactivatedprotein kinasepathwaystostimulateCREBserine133phosphorylation,Mol.CellBiol.18 (1998)19461955. 28. A.Cuenda,J.Rouse,Y.N.Doza,R.Meier,P.Cohen,T.F.Gallagher,P.R.Young,and J.C.Lee,SB203580isaspecificinhibitorofaMAPkinasehomologuewhichis stimulatedbycellularstressesandinterleukin1,FEBSLett.364(1995)229233. 29. K.B.Marcu,L.Xu,andM.G.Kim,SalphaBP/BSAP/NFSmuB1,amurineandhumanB cellstagespecificnuclearfactorwithDNAbindingspecificityimplyingrolesinswitch recombinationandtranscription,Curr.Top.Microbiol.Immunol.182:16774.(1992) 167174. 30. J.Fujisawa,M.Toita,andM.Yoshida,Auniqueenhancerelementforthetrans activator(p40tax)ofhumanTcellleukemiavirustypeIthatisdistinctfromcyclic AMPand12Otetradecanoylphorbol13acetateresponsiveelements,J.Virol.63 (1989)32343239. 31. B.Y.Wu,E.J.Fodor,R.H.Edwards,andW.J.Rutter,Nervegrowthfactorinducesthe protooncogenecjuninPC12cells,J.Biol.Chem.264(1989)90009003. 32. J.F.Wang,Y.F.Cao,andD.F.Steiner,Regulationofproglucagontranscriptionby activatedtranscriptionfactor(ATF)3andanovelisoform,ATF3b,throughthecAMP responseelement/ATFsiteoftheproglucagongenepromoter. 33. B.M.Hagmeyer,M.C.Duyndam,P.Angel,R.P.deGroot,M.Verlaan,P.Elfferich,E.A.van der,andA.Zantema,AlteredAP1/ATFcomplexesinadenovirusE1transformedcells duetoEIAdependentinductionofATF3,Oncogene.12(1996)10251032. 34. A.G.Pearson,C.W.Gray,J.F.Pearson,J.M.Greenwood,M.J.During,andM.Dragunow, ATF3enhancescJunmediatedneuritesprouting,BrainRes.Mol.BrainRes.120 (2003)3845. 35. E.R.deKloet,M.Joels,andF.Holsboer,Stressandthebrain:fromadaptationto disease,Nat.Rev.Neurosci.6(2005)463475..
(21)
GERELATEERDE DOCUMENTEN
In Chapter 5, the regulation of DCLKshort expression in Ns1 PC12 cells
van deze opleiding heeft hij een onderzoeksstage gelopen bij de vakgroep. Gistgenetica van de Universiteit Leiden (Dr. Y. Steensma) en bij
cal microscopy. Control treatment retained the n D produced actin aggregates after disruption row heads, DCLK-short and F-actin colocalize wth cones in control treatments, whereas
License: Licence agreement concerning inclusion of doctoral thesis in the Institutional Repository of the University of Leiden. Downloaded
In addition, two transgenic mouse lines were generated with over- expression of CARP and a line with over-expression of a constitutively active form of DCLK-short in the brain
The studies described in the thesis have been performed at the Division of Medical Pharmacology, Leiden/Amsterdam Center for Drug Research (LACDR) and Leiden University Medical
A second type of transcript that is, like the DCLK-long variants, derived from the first transcription start site of the DCLK gene, contains the highly conserved DCX domains, but
a correlation between CARP mRNA expression and ADX-induced apoptosis in DG granule cells and specific expression of CARP in these apoptotic neurons.. Moreover,
