macrophage cholesterol homeostasis and atherosclerosis
Ye, D.
Citation
Ye, D. (2008, November 4). ABC-transporters and lipid transfer proteins : important players in macrophage cholesterol homeostasis and atherosclerosis. Retrieved from https://hdl.handle.net/1887/13220
Version: Corrected Publisher’s Version
License: Licence agreement concerning inclusion of doctoral thesis in the Institutional Repository of the University of Leiden
Downloaded from: https://hdl.handle.net/1887/13220
Chapter 9
CHOLESTERYL ESTER TRANSFER PROTEIN MODULATES LPS-INDUCED TNF-α PRODUCTION AND FORMS A HOST DEFENSE MECHANISM AGAINST SYSTEMIC INFLAMMATION
Dan Ye1, Reeni B. Hildebrand1, Jimmy F.P. Berbee2, Willeke de Haan2, Menno Hoekstra1, Theo J.C. Van Berkel1, Patrick C.N. Rensen2, Miranda Van Eck1
1Division of Biopharmaceutics, LACDR, Leiden University, The Netherlands
2Department of General Internal Medicine, Endocrinology and Metabolic Diseases, Leiden University Medical Center, Leiden, The Netherlands
ABSTRACT
Lipopolysaccharide (LPS) is one of the most potent endotoxins which stimulate monocytes and macrophages to produce high levels of pro- inflammatory cytokines, leading to cytotoxic effects, organ failure, and eventually death. Cholesteryl ester transfer protein (CETP) belongs to the family of lipid transfer/LPS-binding proteins. Recently, it was demonstrated that CETP can prevent LPS-induced mortality in human CETP transgenic mice. In the current study, we challenged CETP transgenic and wild-type mice with a sublethal dose of LPS and determined the effect of CETP on induction of the pro-inflammatory cytokine TNF-α in the circulation. CETP transgenic mice displayed significantly lower levels of TNF-α in the circulation upon stimulation with LPS, suggesting that these animals are more resistant to LPS. LPS administration resulted in a marked decrease in hepatic CETP mRNA expression (~12-fold low; p<0.01), while a different expression response to LPS was observed in other tissues. As a result, LPS treatment induced a gradual reduction in plasma CETP activity.
Furthermore, injection of fluorescently labelled LPS in CETP transgenic mice and wild-type animals demonstrated a prolonged residence of LPS in serum and delayed hepatic binding of LPS in the presence of CETP. Our data suggest that CETP binds to LPS, thereby preventing the association of LPS with Kupffer cells (macrophages in the liver), at least in part inhibiting overproduction of the pro-inflammatory cytokine TNF-α.
In conclusion, CETP plays a protective role in the resistance of CETP transgenic mice to LPS. We propose that CETP is important for a general host defense mechanism against LPS-induced systemic inflammation.
INTRODUCTION
Lipopolysaccharide (LPS), a major outer membrane constituent of Gram- negative bacteria, is a potent endotoxin that, through the activation of cellular immunity, induces a cytokine-mediated systemic inflammatory response in the host.1 The LPS-induced cytokine response primarily involves Toll-like receptor 4 (TLR4) and plasma membrane CD14, which initiate downstream signaling to NF-κB followed by activation of LPS responsive genes.2,3 Cytokine production is important for the efficient control of growth and eradication of invading pathogens, but high concentrations of these cytokines can lead to cytotoxic effects, organ failure, and eventually death.4-6
Cholesteryl ester transfer protein (CETP) is a 74-kDa hydrophobicplasma glycoprotein that has been studied extensively in relation to high-density lipoprotein (HDL) metabolism. CETP mediates the transfer of cholesteryl esters from antiatherogenic HDL to proatherogenic apoB-containing lipoproteins in exchange for triglycerides.7 Low plasma CETP levels are associated with increased HDL-cholesterol (HDL-C) concentrations, allowing HDL to exert its antiatherogenic properties. CETP has been detected in various human tissues such as liver, adipose tissue, spleen, and tissue macrophages, and the CETP protein is secreted to a variable extent from each of these tissues into plasma.8 Previously, we have shown that bone marrow (BM)-derived CETP is an important contributor to the total serum CETP activity and mass in mice by transplantation of BM from CETP transgenic (Tg) mice into LDL receptor knockout mice, and by reconstitution of CETP Tg mice with BM from wild-type mic.9 Recently, both in humans and in animal models, we found that an enhanced inflammatory status in acute coronary syndromes was associated with reduced leukocyte CETP production.10 Hence, the possible role for CETP in host defense against systemic inflammation is worth exploiting.
CETP belongs to the family of lipid transfer/LPS-binding proteins (LT/LBP), together with phospholipid transfer protein (PLTP), bactericidal permeability increasing protein (BPI), and LPS-binding protein (LBP).11 At the sequence level, the four LT/LBPfamily members share ~20% identity. LBP and BPI play an important role in the innate immune response as they transfer LPS either to lipoprotein particles or to CD14, whereas PLTP mediates the transfer of LPS to lipoproteins (mainly HDL), but not to CD14.12-14 Compared to LBP and BPI, PLTP was recently suggested to be a promising target in preventing endotoxic shock in mice.15 Interestingly, administration of LPS to hamsters with endogenous CETP expression or to Tg mice expressing human CETP induces a rapid decrease in the serum CETP concentration.16-18 This CETP-lowering action might be viewed as an adaptative response during infection and inflammation that helps to maintain an elevated HDL plasma concentration, thereby binding LPS and neutralizing the toxicity of LPS. In addition, CETP with its molecular mimicry to LBP might be able to bind and transport LPS and thus modulate the host response to Gram-negative bacterialinfection. Still, in vivo data on the role of CETP in animal resistance to LPS are largely lacking.
Recently, Cazita et al showed a remarkable beneficial effect of CETP on animal survival after LPS administration.19 In the current study, we
investigated the role of CETP in the response to a sublethal dose of LPS using CETP Tg and wild-type mice. Under these conditions, the induction of TNF-α in the circulation, and the possible effects of LPS on CETP expression were assessed. Furthermore, the effects of CETP on the metabolism of LPS were studied by injecting fluorescently labeled LPS into CETP Tg and wild-type mice. Finally, we also investigated the direct role of CETP production by bone marrow-derived cells in the mouse response to LPS.
MATERIALS AND METHODS
Animals
Male total-body CETP transgenic mice (CETP Tg; strain 5203; C57BL/6J N10), expressing human CETP under the control of its own promoter and other major regulatory elements,20 obtained from The Jackson Laboratory (Bar Harbor, ME, USA) were maintained on regular chow diet, containing 4.3% (w/w) fat and no added cholesterol (RM3, Special Diet Services, Witham, UK). CETP Tg mice and wild-type littermates were given unlimited access to food and water. Animal experiments were performed at the Gorlaeus Laboratory of the Leiden/Amsterdam Center for Drug Research in accordance with the National Laws. All experimental protocols were approved by the Ethics Committee for Animal Experiments of Leiden University.
TNF-α Response
50 µg/kg LPS from Salmonella minnesota R595 (List Biological Laboratories Inc) in phosphate-buffered saline was intravenously injected via the tail vein into conscious male CETP Tg mice and wild-type littermates (n=6 per group). After 30, 60, 90, 120, and 180 min, blood samples were taken and serum TNF-α levels were determined using the mouse TNF-α specific OptEIATM ELISA (BD Biosciences Pharmingen) according to the manufacturer’s instructions.
CETP Activity
CETP activity in plasma was measured as the transfer/exchange of radiolabeled 14C-cholesterol oleate (Amersham Biosciences, Piscataway, NJ) between exogenously added human LDL and HDL as described.21 Radioactivity in HDL as a measure of transfer activity was determined by liquid scintillation counting. Activity is expressed in µmol cholesteryl ester transferred/h/ml.
Serum Cholesterol Analyses
On regular chow diet, ≈100 µL of blood was drawn from each mouse bytail bleeding. The concentrations of total cholesterol in serum were determined using enzymatic colorimetric assays, with 0.025 U/ml cholesterol oxidase (Sigma) and 0.065 U/ml peroxidase and 15 µg/ml cholesteryl esterase (Roche Diagnostics, Mannheim, Germany) in reaction buffer (1.0 KPi buffer, pH=7.7 containing 0.01 M phenol, 1 mM 4-amino-antipyrine, 1%
polyoxyethylene-9-laurylether, and 7.5% methanol). Precipath I (Roche
Diagnostics) was usedas an internal standard. Absorbance was read at 490 nm. The distribution of cholesterol over the different lipoproteins in serum was determined by fractionation of 30 µl serum of each mouse using a Superose 6 column (3.2x300mm, Smart-system, Pharmacia, Uppsala, Sweden). Cholesterol content of the effluent wasdetermined as described above.
Isolation of Tissues, Blood-derived Leukocytes, and Splenocytes After 180 min post LPS injection (50 µg/kg), animals were sacrificed. Blood samples were collected, and various tissues (e.g., the liver, spleen, adipose tissue, lung, skeletal muscle, and small intestine) were harvested for further analysis.
Peripheral leukocytes were isolated from 2 ml pooled EDTA blood samples, using lympholite-M (Cedarlane Laboratories Limited, Ontario, Canada), as recommended by the manufacturer.
In addition, splenocytes was harvested by flushing two-third part of the spleens of CETP Tg mice and wild-type littermates with phosphate-buffered saline. Single-cell suspensions were prepared by passing the cells through a 30-µm nylon gauze. Various types of splenocytes were harvested using magnetic nanoparticles conjugated with anti-mouse CD4, CD8a, CD45R/B220, or CD11b monoclonal antibodies (BD Biosciences), as recommended by the manufacturer.
Gene Expression
To assess CETP mRNA expression before and after LPS challenge, quantitative RT-PCR was performed. In brief, guanidium thiocyanate-phenol was used to extract total RNA from the isolated tissues and blood-derived leukocytes. cDNA was generated using RevertAid M-MuLV reverse transcriptase (Fermentas, Burlington, Canada) according to manufacturer’s protocol. Quantitative gene expression analysis was performed using the SYBR-Green method on a 7500 fast Real-time PCR machine (Applied Biosystems, Foster City, CA). PCR primers (Table 1) were designed using Primer Express Software according to the manufacturer’s default settings.
Hypoxanthine Guanine Phosphoribosyl Transferase (HPRT), β-actin, and acidic ribosomal phosphoprotein PO (36B4) were used as the standard housekeeping genes. Relative gene expression was calculated by subtracting the threshold cycle number (Ct) of the target gene from the average Ct of housekeeping genes and raising two to the power of this difference, in order to exclude the possibility that changes in the relative expression were caused by variations in the separate housekeeping gene expressions.
Table 1: Primers for quantitative real-time PCR analysis
Gene GenBank Accession
Forward primer Reverse Primer
β-actin X03672 AACCGTGAAAAGATGACCCAGAT CACAGCCTGGATGGCTACGTA 36B4 X15267 GGACCCGAGAAGACCTCCTT GCACATCACTCAGAATTTCAATGG HPRT J00423 TTGCTCGAGATGTCATGAAGGA AGCAGGTCAGCAAAGAACTTATAG CETP NM000078 CAGATCAGCCACTTGTCCAT CAGCTGTGTGTTGATCTGGA
Plasma Corticosterone Analysis
Corticosterone levels in plasma were determined using the
CORTICOSTERONE 125I Radioimmunoassay (RIA) Kit (MP Biomedicals, Orangeburg, New York) according to the manufacturer’s instructions.
Kinetic Studies in Mice
Salmonella minnesota LPS (ReLPS) (Sigma) was fluorescein-labeled with FITC with a molar labelling efficiency of 1:1.22 50 µg/kg FITC-ReLPS was intravenously injected into the tail vein of CETP Tg mice and wild-type littermates (n=4 per group). Serum samples were collected after 5, 15, and 20 min, and then mixed with addition of 0.5% sodium deoxycholate (to determine maximum dequenching), followed by the measurement for FITC- fluorescence in a Fluostar Optima Plate Reader (BMG Labtech; λex=485 nm and λem=530 nm). After 20 min, mice were sacrificed and organs were collected for further analysis.
Fresh organs (i.e., the liver and spleen) were cut into 8 µm cryostat sections, which were subsequently stained for nuclei with 4, 6-diamidino-2- phenylindole (DAPI) (Serva Feinbiochemica, Heidelberg, Germany). Explicit care had been taken to keep all the samples in darkness during the course of the experiment. The density and distribution of FITC-ReLPS fluorescence signals in various organs were examined under a fluorescence microscope.
Photomicrographs were taken using a Bio-Rad Radiance 2100 MP confocal laser scanning system equipped with a Nikon Eclipse TE2000-U inverted fluorescence microscope.
Bone Marrow Transplantation
Bone marrow transplantationwas used to selectively introduce CETP in hematopoietic cells, including macrophages. Briefly, male wild-type mice were exposed to a singledose of 9 Gy (0.19 Gy/min, 200 kV, 4 mA) X-ray totalbody irradiation, using an Andrex Smart 225 Röntgen source(YXLON International, Copenhagen, Denmark) with a 6-mm aluminum filter 1 day before transplantation.Bone marrow was isolated by flushing the femurs and tibias from male CETP Tg mice or wild-type littermates with PBS.
Single-cellsuspensions were prepared by passing the cells through a 30- µmnylon gauze. Irradiated recipients received 0.5x107 bone marrow cells by intravenous injection into the tail vein. Transplanted mice were maintained on sterilized regular chow containing 4.3% (w/w) fat and no cholesterol (RM3; Special Diet Services) for 8 weeks in order to induce a full recovery of hematopoietic cells. Drinking water was supplied with antibiotics(83 mg/L ciprofloxacin and 67 mg/L polymyxin B sulfate) and6.5 g/L sucrose.
Data Analysis
Data were presented as means ± SEM. Statistical analyses were performed using one- and two-way ANOVA using Graphpad Prism Software (Graphpad Software, Inc.; http://www.graphpad.com). The level of statistical significance was set at p<0.05.
RESULTS
TNF-α response
To investigate whether CETP affects the host defense against LPS-induced systemic inflammation, CETP Tg mice (n=6) and wild-type littermates (n=6) were injected intravenously with a sublethal dose of LPS (50 µg/kg). Blood samples were collected up to 3 hours after injection and serum TNF-α levels were determined using ELISA. As shown in Fig. 1A, both types of mice showed an increase in serum TNF-α levels with a peak at 60 min after LPS injection. However, the peak value in serum of CETP Tg was significantly lower mice than in serum of wild-type mice (1.70±0.25 ng/ml for CETP Tg mice and 4.05±0.44 ng/ml for wild-type mice; p<0.01). The release of TNF-α started to decline in both types of mice from 60 min until the levels were normalized at 120 min after LPS injection. Of note, also at 90 min after injection, serum TNF-α levels were 4.5-fold (p<0.001) lower in CETP Tg mice than wild-type mice.
Since TNF-α is mainly secreted by activated mononuclear macrophages in response to LPS, we subsequently isolated peripheral blood leukocytes from both CETP Tg mice and wild-type mice after 180 min post LPS administration. RT-PCR analysis indicated 2.4-fold (p<0.05) lower TNF-α mRNA expression in circulating leukocytes in CETP Tg mice (Fig. 1B).
Thus, the production of the pro-inflammatory cytokine TNF-α appears to be lower as a result of CETP expression.
A B
0 30 60 90 120 150 180
0 1 2 3 4 5
CETP Tg WT
Time (min)
Plasma TNF-αααα (ng/ml) **
***
WT CETP Tg
0.000 0.005 0.010 0.015 0.020 0.025
***
*
Relative TNF-αααα mRNA expression (A.U.)
Fig. 1. LPS induced TNF-α production in vivo. A: CETP Tg mice (filled circles) and wild-type mice (WT, open circles) were intravenously injected with 50 µg/kg LPS, after which blood samples were collected and serum TNF-α levels were determined using ELISA. B: After 180 min upon LPS treatment, all the mice were sacrificed. Peripheral blood leukocytes were isolated for TNF-α mRNA expression, determined by quantitative RT-PCR. Values are means±SEM of 6 mice per group. *p<0.05, **p<0.01, ***p<0.001 vs. WT mice.
Plasma CETP activity
Previous observations in animals have shown that LPS is a potent inhibitor of CETP activity in plasma.17 Therefore, we also analyzed plasma CETP activity in CETP Tg mice after LPS challenge. A time course study revealed that plasma CETP activity did not significantly change within 2 hours after LPS injection. Interestingly, plasma CETP activity was mildly reduced by 12% (p=0.16) at 180 min after LPS challenge, which was further decreased by 23% (p=0.04) afterward when the animals were sacrificed (Fig. 2).
0 30 60 90 120 150 180 210 0
100 200 300 400
Time (min) Plasma CETP activity (nmol CE transfer/mL/h)
*
N.S.
Fig. 2. Plasma CETP activity after LPS injection. CETP Tg mice were intravenously injected with 50 µg/kg LPS, after which blood samples were collected and plasma CETP activity was determined at the indicated time points. Values are means±SEM of 6 mice. *p<0.05 vs.
baseline t=0 min. N.S. = non-significant.
Serum cholesterol levels
At baseline, serum total cholesterol levels did not differ between CETP Tg mice and wild-type mice on regular chow diet (data not shown). However, CETP did induce a redistribution of cholesteryl esters fromHDL to apoB- containing lipoproteins. As a result, HDL cholesterol was significantly lower in CETP Tg mice than wild-type littermates (26±3 mg/dL vs. 38±5 mg/dL;
p=0.05) (Fig. 3A). As compared to baseline, no significant changes in serum total cholesterol were found after 3 hours post LPS injection, either in CETP Tg or in wild-type controls (data not shown). Still, HDL cholesterol was significantly lower in CETP Tg mice than wild-type littermates (23±4 mg/dL vs. 34±3 mg/dL; p=0.04) (Fig. 3B). In contrast to the marked 23%
reduction in plasma CETP activity (Fig. 2), HDL cholesterol in CETP Tg mice was, however, not significantly changed after LPS injection.
A B
Fig. 3. Serum cholesterol profiles after LPS treatment. Blood was collected from CETP Tg mice (filled circles) and wild-type (WT, open circles) at baseline, i.e., before LPS treatment (A) and after 180 min post LPS injection (B). The amount of total cholesterol and their distribution over the different lipoproteins is shown. Fractions 2 to 5 represent VLDL; fraction 6 to 14, LDL;
and fractions 15 to 20, HDL, respectively. Values are means±SEM of 6 mice per group.
Regulation of CETP gene expression
CETP mRNA has been reported to show a widespread tissue distribution, with the highestlevels found in the liver, spleen, and adipose tissue.21,23,24 In accordance, CETP Tg mice in our studies also display a predominant CETP mRNA expression in the liver (data not shown). LPS administration induced a ~12-fold (p<0.001) decrease in hepatic CETP mRNA expression (Fig. 4A).
CETP mRNA expression in other tissues, however, showed a different
0 5 10 15 20
0 50 100 150
VLDL LDL
HDL Before LPS injection
Fraction number
Serum cholesterol (µµµµg/ml)
0 5 10 15 20
0 50 100
150 WT
CETP Tg
VLDL
LDL
HDL 3h after LPS injection
Fraction number
Serum cholesterol (µµµµg/ml)
pattern of response. For instance, in the spleen, a tendency to increased (1.4-fold higher) CETP mRNA expression was observed after LPS administration (data not shown), but this failed to reach statistical significance. Previously, we have shown that CETP is produced by the various cell types in the spleen.9 Therefore, we also analyzed the regulation of CETP expression in response to LPS in different types of splenocytes.
As shown in Fig. 4B, most of the tested splenocytes displayed up- regulation of CETP mRNA. For example, CETP mRNA was significantly increased in B-cells (3.6-fold; p=0.02); CETP mRNA was mildly but not significantly up-regulated in CD8+ cytotoxic T-cells (1.9-fold; p=0.42) and macrophages/neutrophils (1.9-fold; p=0.27), whereas its expression in CD4+ T-helper cells was unchanged after LPS treatment. Analysis of other organs (e.g., adipose tissue, small intestine and lung) also demonstrated a similar response to the spleen, i.e., a tendency to increased CETP mRNA expression after LPS challenge (data not shown). Thus, after LPS administration, a dramatic decrease in hepatic CETP mRNA abundance was observed, while a tendency to increased CETP mRNA expression was found in other organs.
A B
Fig. 4. Regulation CETP expression after LPS injection. A: Hepatic CETP mRNA expression in response to LPS, determined by quantitative RT-PCR. B: CETP mRNA expression in various splenocytes in response to LPS, which were harvested using magnetic nanoparticles conjugated with anti-mouse CD4, CD8a, CD45R/B220, or CD11b monoclonal antibodies for the isolation of CD4+ T-helper cells, CD8+ cytotoxic T-cells, B-cells, and macrophages/neutrophils, respectively, determined by quantitative RT-PCR. Values are means + SEM of 6 CETP Tg mice per group. *p<0.05, and ***p<0.001 vs. Non-LPS (i.e. before LPS challenge). N.S. = non-significant.
Plasma corticosterone levels
The profound decrease in hepatic CETP mRNA after LPS administration has been reported primarily as a result of adrenal corticosteroid release.17 Therefore, we also analyzed plasma corticosterone levels both in CETP Tg mice and wild-type mice after LPS injection. A time course study revealed gradually increased adrenal corticosteroid release in both types of mice after LPS treatment (Fig. 5). Although the baseline levels were slightly higher in CETP Tg mice than that in wildtype mice, this failed to reach statistical significance (82±24 ng/ml for CETP Tg mice and 54±17 ng/ml wild-type mice; p=0.41). Furthermore, significantly higher plasma corticosterone levels were found at 90 min after LPS injection (291±14 ng/ml for CETP Tg mice and 241±5 ng/ml wild-type mice; p=0.05). After 2 hours post LPS injection, plasma corticosterone levels were identical between CETP Tg mice and wild-type mice.
Non-LPS LPS
0.00 0.25 0.50 0.75 1.00
Relative CETP mRNA expression (A.U.)
Non-LPS LPS
0 1 2 3 4 5 6
B cells CD4+ T cells CD8+ T cells Macrophages/Neutrophils
*
N.S.
N.S.
N.S.
Relative CETP mRNA expression (A.U.)
***
0 30 60 90 120 150 180 0
100 200 300
400 WT
CETP Tg
*
Time (min)
Plasma corticosterone levels (ng/ml)
N.S.
Fig. 5. Plasma corticosterone levels after LPS injection. CETP (filled circles) and wild-type mice (WT, open circles) were intravenously injected with 50 µg/kg LPS, after which blood samples were collected and plasma corticosterone levels were determined at the indicated time points. Values are means±SEM of 6 mice per group. *p<0.05 vs. WT mice. N.S. = non- significant.
Serum decay and organ association
To investigate the effect of CETP on the removal of LPS from the blood circulation, we measured the serum decay of intravenously injected FITC- ReLPS (50 µg/kg). In wild-type mice, >85% fluorescently labeled LPS was cleared from the circulation at 20 min after injection. However, serum concentrations of FITC-ReLPS remained significantly higher in CETP expressing animals (29±3% vs. 13±2% in wild-type controls; p<0.05), indicating a prolonged residence time of LPS in serum of CETP Tg mice (Fig. 6).
0 5 10 15 20
0 25 50 75 100
WT CETP Tg
* *
Time (min)
FITC-ReLPS (% dose)
Fig. 6. Serum decay of LPS. CETP Tg mice (filled circles) and wild-type controls (WT, open circles) were intravenously injected with fluorescein-labeled FITC-ReLPS (50 µg/kg). At the indicated time points, fluorescence intensity in serum was determined. Values are means±SEM of 4 mice per group. *p<0.05 vs. WT mice.
LPS is cleared from the blood mainly by the liver and spleen.25-27 Therefore, we also determined the organ association of FITC-ReLPS by evaluating the density and distribution of FITC-fluorescence in livers and spleens of both CETP Tg and wild-type mice (Fig. 7). As shown, FITC-fluorescence was detected in livers of wild-type mice with strong signals in Kupffer cells (macrophages in the liver) (Fig. 7A) and endothelial cells (data not shown), indicating that Kupffer and endothelial cells, but not hepatocytes, in the liver show high-affinity binding sites for LPS. Strikingly, extremely weak FITC- fluorescence was present in livers of CETP Tg mice (Fig. 7B), suggesting that CETP may affect the hepatic association of LPS. The FITC-ReLPS signal was clearly detectable in spleens of both wild-type (Fig. 7C) and CETP Tg mice (Fig. 7D). The highest fluorescence was observed in the marginal zone and in the red pulp, where the splenic macrophage population is predominant. There was no demonstrable difference in the
association of LPS with the spleen between these two types of mice.
Fig. 7. Association of LPS with the liver and spleen. Wild-type (WT, A and C) and CETP Tg (B and D) mice were intravenously injected with fluorescein-labeled FITC-ReLPS. After 20 min, mice were sacrificed and fresh organs were collected to detect the LPS association. Cryostat sections of the liver (A and B) and the spleen (C and D) were checked for FITC-ReLPS (green) and nuclei (blue). FITC-fluorescence signal was clearly detected in Kupffer cells (red arrows) in the liver of wild-type mice. Furthermore, FITC-ReLPS association was also observed in splenic macrophages (red arrows) both in wild-type and CETP Tg mice. Original magnification ×400.
Role of bone marrow-derived CETP in TNF-α response induced by LPS To assess the role of bone marrow-derived CETP in response LPS, wild- type mice were transplanted with bone marrow from CETP Tg mice (CETP Tg→WT) and nontransgenic littermates (WT→WT). In the CETP Tg→WT animals, CETP is thus solely produced by bone marrow-derived cells, including tissue macrophages. At 8 weeks after transplantation, the mice were subsequently challenged with a sublethal dose of LPS (50 µg/kg).
Blood samples were collected up to 3 hours after LPS injection and serum TNF-α levels were determined using ELISA. No significant differences in the TNF-α response to LPS were observed between these two types of transplanted mice. Although we did find a moderate decrease (~33%) in serum TNF-α levels in the circulation at 90 min post-injection, this failed to reach statistical significance (Fig. 8).
Liver 10X 10X
Liver A
CETP Tg
C
B
WT
D
WT CETP Tg
0 30 60 90 120 150 180 0
1 2 3 4 5
CETP Tg to WT WT to WT
Time (min)
Plasma TNF-αααα (ng/ml)
Fig. 8. LPS-induced TNF-α production in transplanted wild-type mice. Wild-type mice transplanted with bone marrow from CETP Tg mice (CETP Tg→WT, filled circles) and nontransgenic littermates (WT→WT, open circles) were intravenously injected with 50 µg/kg LPS, after which blood samples were collected and serum TNF-α levels were determined using ELISA. Values are means±SEM of 6 mice per group. No significant differences were observed.
DISCUSSION
In this study, we investigated whether CETP is important for a general host defense mechanism against systemic inflammation. Our data indicate that CETP plays a protective role in the resistance to LPS in a murine model, as evidenced by the impairment of pro-inflammatory TNF-α response in CETP Tg mice after LPS treatment.
LPS administration was previously reported to cause decreased hepatic CETP mRNA abundance and plasma CETP activity in animals.16-18 The reduced hepatic CETP mRNA expression induced by LPS was suggested to be mediated probably by adrenal corticosteroid release.17 In agreement, we also found a marked reduction in hepatic mRNA expression, together with a gradual increase in plasma corticosteroid levels after LPS treatment.
Interestingly, suppression of hepatic CETP expression paralleled inverse responses in other organs (i.e., the spleen), which may at least in part compensate for the rapid profound reduction in hepatic CETP synthesis. As a result, a gradual reduction in plasma CETP activity was observed after LPS stimulation. In species expressing CETP, such as humans, the decrease in plasma CETP activity may help to preserve HDL levels after exposure to LPS. In this study, in contrast to a marked (~23%) reduction in plasma CETP activity, the effects of LPS on HDL cholesterol in CETP Tg mice were, however, less than anticipated. Actually, inhibitory effects of CETP on plasma HDL cholesterol may be dose-dependent. This was supported by other models, in which rabbits were injected with a CETP monoclonal antibody and CETP inhibition of >80% was needed to produce a doubling of HDL cholesterol.18 It is thus possible that the LPS-induced inhibition of plasma CETP activity in our current studies may be not sufficient to markedly raise HDL cholesterol.
Another novel finding in this study is that plasma CETP appears to delay the clearance of intravenously injected FITC-ReLPS from the blood circulation. It has been shown that a direct, high affinity interaction can be formed between purified CETP and LPS.17,19 It is conceivable that the plasma CETP levels in CETP Tg mice might already be sufficient to bind small amounts of LPS, thereby prolonging the clearance of LPS from the circulation and subsequent delaying the association of LPS with organs.
The interaction of LPS with macrophages leading to activation of these cells plays a key role in the development of endotoxin shock. Kupffer cells, macrophages in the liver, constitute the largest population of tissue macrophages in the body.28 Depletion of Kupffer cells results in a marked decrease in the LPS-induced TNF-α production and protects against endotoxemia, indicating that Kupffer cells play a critical role in the development of endotoxemia.29 In this regard, our data disclosed a predominant association of FITC-ReLPS with Kupffer cells in livers of wild- type mice. In contrast, markedly less FITC-ReLPS association was observed with Kupffer cells in livers of CETP Tg mice. This most likely resulted in less activation of these macrophages, thereby explaining the lower TNF-α response in CETP Tg mice. However, though we did find an impaired hepatic association of LPS in CETP Tg mice, no difference was observed between the splenic association of LPS in CETP Tg mice and wild-type mice. The residual association of LPS with macrophages in the spleen and possibly other organs may at least in part explain why CETP Tg mice display a reduction, but not a complete inhibition of TNF-α response upon LPS challenge. It is currently unclear why CETP specifically inhibits the binding of LPS to Kupffer cells in the liver, but not macrophages in the spleen. Taken together, our data indicate that CETP delays LPS clearance from the blood circulation and subsequently inhibits the activation of macrophages in the liver, thereby modulating the toxicity of LPS. The fate of the LPS/CETP complex, however, still requires further investigation.
The extreme production of pro-inflammatory cytokines during infection and sepsis may bring about many of its injurious and sometimes fatal outcomes.30,31 Importantly, we reveal here that CETP plays a protective role in the resistance of CETP Tg mice to LPS, as evidenced by markedly decreased TNF-α secretion. The observed impaired TNF-α response might partly be due to less activated Kupffer cells as a result of the reduced hepatic uptake of LPS in CETP Tg mice as compared to wild-type mice.
Furthermore, LPS is targeted to inflammatory cells (such as macrophages) through a transfer reaction initiated by the acute phase protein LBP, which plays a pivotal role in the transport and sequestration of LPS by HDL but is also important for presenting LPS to the macrophage surface TLR-4.32 It has been demonstrated that binding of LPS to TLR-4 and plasma membrane CD14 plays a crucial role in the initiation of intracellular signaling followed by activation of LPS responsive genes.33 We speculate that CETP binding to inflammatory cells and to LPS might hinder the LBP/LPS/CD14/TLR-4 interaction on the cell surface, thereby preventing cells from overproducing pro-inflammatory cytokines.
Finally, we also evaluated whether bone marrow-derived CETP plays a protective role in the resistance of CETP Tg mice to LPS. However, serum TNF-α levels induced by LPS were not significantly different between wild- type mice transplanted with and without CETP expressing bone marrow, indicating that bone marrow-derived CETP does not contribute to the resistance of CETP Tg mice to LPS. Of note, we have previously shown that ~50% of the circulating CETP originates from bone marrow-derived cells.9 Therefore, CETP levels in the plasma of CETP Tg→WT transplanted animals might be too low to sufficiently bind and neutralize the toxicity of LPS. Furthermore, CETP is also produced by other cell types which are not
from bone marrow origin, such as hepatocytes and endothelial cells.9,26 In fact, Kupffer cells contain 48% of the total liver CETP expression, as compared with 38% and 14% for hepatocytes and endothelial cells, respectively.9 In addition to Kupffer cells, endothelial cells also show high association of LPS.26,34 In agreement, we did observe high-affinity binding sites of LPS in endothelial cells lining the blood vessels in the liver of wild- type mice. Interestingly, hepatic endothelial cells were found to express high levels of TNF-α mRNA (data not shown), implying a potential role of these cells in TNF-α production induced by LPS. Further research is needed to find out whether CETP expression in endothelial cells plays a possible protective during the host response to LPS.
As HDL has a protective function in atherosclerosis and cardiovascular disease, pharmacological inhibition of CETP is being studied as a method to induce HDL levels.35 The hope for new HDL-mediated treatment of atherosclerosis was severely affected on December 2, 2006, when a large clinical trial called ILLUMINATE involving Torcetrapib, a potent CETP inhibitor, was stopped prematurely. In this trial, an excess of deaths and morbidity from cardiovascular endpoints (e.g. myocardial infarction, unstable angina, revascularization, and heart failure) was reported in the group receiving Torcetrapib/Atorvastatin compared with Atorvasatin alone.35 Of note, significantly more Torcetrapib-treated patients died from cancer and infectious disease, which implies that CETP inhibitors might affect the immune system. As a potent endotoxin, LPS triggers a host innate immune response, resulting in activation of various cell types and production of multiple cytokines. In the current study, we challenged CETP Tg mice with a sublethal dose of LPS. Our findings demonstrate that CETP lowers TNF-α production induced by LPS. Furthermore, plasma CETP plays an important role in the removal of LPS from the blood circulation, and thereby reduces the toxicity of LPS. The presence of CETP in the circulation arises here as a new and beneficial strategy against systemic inflammation, which is important for the understanding the role of CETP in inflammatory diseases, and also important for the continued development of other CETP inhibitors which are currently in initial studies.
SOURCES OF FUNDING
This work was supported by the Chinese Scholarship Council (Scholarship to D.Y.), the Netherlands Organization for Scientific Research (VIDI Grant 917.66.301 to M.V.E., VIDI grant 917.36.351 to P.C.N.R.), and the Netherlands Heart Foundation (Grants 2001T041 to M.V.E.). M. Van Eck is an Established Investigator of the Netherlands Heart Foundation (Grant 2007T056).
REFERENCES
1. Harris, R. L., D. M. Musher, K. Bloom, J. Gathe, L. Rice, B. Sugarman, T. W. Williams, and E. J. Young. Manifestation of sepsis. Arch. Intern. Med. 1987; 1477:1895-1906.
2. Lien E, Means TK, Heine H, Yoshimura A, Kusumoto S, Fukase K, Fenton MJ, Oikawa M, Qureshi N, Monks B, Finberg RW, Ingalls RR and Golenbock DT. Toll-like receptor 4
imparts ligand-specific recognition of bacterial lipopolysaccharide. J Clin Invest. 2000;
105:497-504.
3. Chow JC, Young DW, Golenbock DT, Christ WJ and Gusovsky F. Toll-like receptor-4 mediates lipopolysaccharide-induced signal transduction. J Biol Chem. 1999; 274:10689- 10692.
4. Van Amersfoort ES, Van Berkel TJ and Kuiper J. Receptors, mediators, and mechanisms involved in bacterial sepsis and septic shock. Clin Microbiol Rev. 2003; 16:379-414.
5. Galanos C and Freudenberg MA. Mechanisms of endotoxin shock and endotoxin hypersensitivity. Immunobiology. 1993; 187:346-356.
6. Dinarello CA. Cytokines as mediators in the pathogenesis of septic shock. Curr Top Microbiol Immunol. 1996; 216:133-165.
7. Tall AR. Plasma cholesteryl ester transfer protein. J Lipid Res. 1993; 34:1255–1274.
8. Tollefson JH, Faust R, Albers JJ, Chait A. Secretion of a lipid transfer protein by human monocyte-derived macrophages. J Biol Chem. 1985; 260:5887–5890.
9. Van Eck M, Ye D, Hildebrand RB, Kar Kruijt J, de Haan W, Hoekstra M, Rensen PC, Ehnholm C, Jauhiainen M, Van Berkel TJC. Important role for bone marrow-derived cholesteryl ester transfer protein in lipoprotein cholesterol redistribution and atherosclerotic lesion development in LDL receptor knockout mice. Circ Res. 2007;
100:678–685.
10. Dan Ye, Adriaan O. Kraaijeveld, Robert W. Grauss, Leonie C. van Vark-van der Zee, Stefan M. Willems, Saskia C.A. de Jager, Matti Jauhiainen, Douwe E. Atsma, Geesje M.
Dallinga-Thie, Jan-Albert Kuivenhoven, Pancras C.W. Hogendoorn, Erik A.L. Biessen, Theo J.C. Van Berkel, J. Wouter Jukema, Miranda Van Eck. Reduced leukocyte cholesteryl ester transfer protein expression in acute coronary syndromes. Journal of Internal Medicine. 2008, in press.
11. Bingle CD, Craven CJ. Meet the relatives: a family of BPI- and LBP-related proteins.
Trends Immunol. 2005; 25:53–55.
12. Schumann, R. R., Leong, S. R., Flaggs, G. W., Gray, P. W., Wright, S. D., Mathison, J.
C., Tobias, P. S., and Ulevitch, R. J. Science. 1990; 249:1429-1431.
13. Weiss, J., Muello, K., Victor, M., and Elsbach, P. J. Immunol. 1984; 132:3109-3115.
14. Hailman E, Albers JJ, Wolfbauer G, Tu AY, Wright SD. Neutralization and transfer of lipopolysaccharide by phospholipid transfer protein. J Biol Chem. 1996; 271(21):12172-8.
15. Thomas Gautier, Alexis Klein, Valérie Deckert, Catherine Desrumaux, Nicolas Ogier, Anne-Laure Sberna, Catherine Paul, Naig Le Guern, Anne Athias, Thomas Montange, Serge Monier, Françoise Piard, Xian-Cheng Jiang, David Masson, Laurent Lagrost. Effect of plasma phospholipid transfer protein deficiency on lethal endotoxemia in mice. J Biol Chem. 2008. In press.
16. Hardardóttir I, Moser AH, Fuller J, Fielding C, Feingold K, Grünfeld C. Endotoxin and cytokines decrease serum levels and extra hepatic protein and mRNA levels of cholesteryl ester transfer protein in syrian hamsters. J Clin Invest. 1996; 97:2585–2592.
17. Masucci-Magoulas L, Moulin P, Jiang XC, Richardson H, Walsh A, Breslow JL, Tall A.
Decreased cholesteryl ester transfer protein (CETP) mRNA and protein and increased high density lipoprotein following lipopolysaccharide administration in human CETP transgenic mice. J Clin Invest. 1995; 95:1587–1594.
18. Whitlock ME, Swenson TL, Ramakrishnan R, Leonard MT, Marcel YL, Milne RW, Tall AR.
Monoclonal antibody inhibition of cholesteryl ester transfer protein activity in the rabbit.
Effects on lipoprotein composition and high density lipoprotein cholesteryl ester metabolism. J Clin Invest. 1989; 84(1):129–137.
19. Cazita PM, Barbeiro DF, Moretti AI, Quintão EC, Soriano FG. Human CETP expression enhances the mouse survival rate in an experimental systemic inflammation model: a novel role for CETP. Shock. 2008; in press.
20. Jiang XC, Agellon LB, Walsh A, Breslow JL, Tall AR. Dietary cholesterol increases transcription of the human cholesteryl ester transfer protein gene in transgenic mice.
Dependence on natural flanking sequences. J Clin Invest. 1992; 90:1290–1295.
21. Drayna D, Jarnagin AS, Mclean J, Henzel W, Kohr W, Fielding C, Lawn R. Cloning and sequencing of human cholesteryl ester transfer protein cDNA. Nature. 1987; 327:632–
634.
22. Troelstra, A., Antal-Szalmas, P., de Graaf-Miltenburg, L. A., Weersink, A. J., Verhoef, J., Van Kessel, K. P., Van Strijp, J. A. Saturable CD14-dependent binding of fluorescein- labeled lipopolysaccharide to human monocytes. Infect. Immun. 1997; 65,2272-2277.
23. Nagashima M, McLean JW, Lawn RM. Cloning and mRNA tissue distribution of rabbit cholesteryl ester transfer protein. J Lipid Res. 1988; 29:1643–1649.
24. Jiang XC, Moulin P, Quinet E, Goldberg IJ, Yacoub LK, Agellon LB, Compton D, Schnitzer-Polokoff R, Tall AR. Mammalian adipose tissue and muscle are major sources of lipid transfer protein mRNA. J Biol Chem. 1991; 266:4631–4639.
25. Freudenberg MA, Freudenberg N and Galanos C. Time course of cellular distribution of endotoxin in liver, lungs and kidneys of rats. Br J Exp Pathol. 1982; 63:56-65.
26. Van Oosten M, van de Bilt E, van Berkel TJ and Kuiper J. New scavenger receptor-like receptors for the binding of lipopolysaccharide to liver endothelial and Kupffer cells. Infect Immun. 1998; 66:5107-5112.
27. Hiraoka E, Nonami T, Kurokawa T, Kobayashi H, Takagi H. The role of the spleen in endotoxin-induced liver injury. Liver. 1995; 15(1):35-38.
28. Naito M, Hasegawa G, Ebe Y and Yamamoto T. Differentiation and function of Kupffer cells. Med Electron Microsc. 2004; 37:16-28.
29. Hirose M, Nishikawa M, Qian W, Haque A, Mashimo M and Inoue M. Mannose- conjugated alendronate selectively depletes Kupffer cells and inhibits endotoxemic shock in the mice. Hepatol Res. 2006; 36:3-10.
30. Rossi MA, Celes MR, Prado CM, Saggioro FP: Myocardial structural changes in long- term human severe sepsis/septic shock may be responsible for cardiac dysfunction.
Shock. 2007; 27:10-18.
31. Bone RC, Balk RA, Cerra FB, Dellinger RP, Fein AM, Knaus WA, Schein RM, Sibbald WJ:
Definitions for sepsis and organ failure and guidelines for the use of innovative therapies in sepsis. The ACCP/SCCM Consensus Conference Committee. American College of Chest Physicians/Society of Critical Care Medicine. Chest. 1992; 101:1644-1655.
32. Haziot A, Hijiya N, Gangloff SC, Silver J and Goyert SM. Induction of a novel mechanism of accelerated bacterial clearance by lipopolysaccharide in CD14-deficient and Toll-like receptor 4-deficient mice. J Immunol. 2001; 166:1075-1078.
33. Haziot A, Ferrero E, Kontgen F, Hijiya N, Yamamoto S, Silver J, Stewart CL and Goyert SM. Resistance to endotoxin shock and reduced dissemination of gram-negative bacteria in CD14-deficient mice. Immunity. 1996; 4:407-414.
34. Ion V. Deaciuc, Nympha B. D'Souza, John J. Spitzer. Tumor Necrosis Factor-α Cell Surface Receptors of Liver Parenchymal and Nonparenchymal Cells during Acute and Chronic Alcohol Administration to Rats Alcoholism: Clinical and Experimental Research. 1995; 19 (2):332–338.
35. Barter PJ, Caulfield M, Eriksson M, Grundy SM, Kastelein JJ, Komajda M, Lopez-Sendon J, Mosca L, Tardif JC, Waters DD, Shear CL, Revkin JH, Buhr KA, Fisher MR, Tall AR, Brewer B. Effects of torcetrapib in patients at high risk for coronary events. N Engl J Med.
2007; 357:2109–2122.
