macrophage cholesterol homeostasis and atherosclerosis
Ye, D.
Citation
Ye, D. (2008, November 4). ABC-transporters and lipid transfer proteins : important players in macrophage cholesterol homeostasis and atherosclerosis. Retrieved from https://hdl.handle.net/1887/13220
Version: Corrected Publisher’s Version
License: Licence agreement concerning inclusion of doctoral thesis in the Institutional Repository of the University of Leiden
Downloaded from: https://hdl.handle.net/1887/13220
MACROPHAGE ATP-BINDING CASSETTE TRANSPORTER A5 CONTROLS SUSCEPTIBILITY TO ATHEROSCLEROSIS IN LDL RECEPTOR KNOCKOUT MICE
Dan Ye*1, Illiana Meurs*1, Megumi Ohigashi2, Ying Zhao1, Kim LL Habets1, Laura Calpe-Berdiel1, Yoshiyuki Kubo3, Akihito Yamaguchi2, Theo J.C. Van Berkel1, Tsuyoshi Nishi2, Miranda Van Eck1
1Division of Biopharmaceutics, LACDR, Leiden University, The Netherlands
2Department of Cell Membrane Biology, Institute of Scientific and Industrial Research, Osaka University, Japan
3Division of Pharmaceutical Sciences, Graduate School of Natural Science and Technology, Kanazawa University, Japan
*The first two authors contributed equally to this work.
ABSTRACT
The ATP-binding cassette transporter A5 (ABCA5) is a member of the ABC transporter A subfamily. Previously, we have shown that ABCA5 is highly expressed by hepatic macrophages and its expression can be further up- regulated by feeding mice with a high-cholesterol Western-type diet.
However, the function of macrophage ABCA5 in atherogenesis is still unknown. Chimeras that are selectively deficient for ABCA5 in macrophages were generated by transplantation of bone marrow from ABCA5 knockout (ABCA5−/−) mice into low-density lipoprotein (LDL) receptor knockout (LDLr−/−) mice. Bone marrow derived-macrophages from ABCA5−/− → LDLr−/− chimeras exhibited a 20% (p<0.05) decrease in cholesterol efflux to high-density lipoprotein (HDL), whereas a 38% (p<0.05) increase in cholesterol efflux to apolipoprotein AI was observed. In agreement, in vitro studies revealed that disruption of ABCA5 in macrophages resulted in compensatory up-regulation of ABCA1. To induce atherosclerosis, transplanted mice were fed a Western-type diet, containing 0.25% cholesterol and 15% fat for 6 weeks, starting at 8 weeks after transplantation. No significant effects of macrophage ABCA5 deficiency were observed on atherosclerotic lesion size in male ABCA5−/− → LDLr−/−
chimeras (118±10x103 µm2 vs. 104±16x103 µm2 in male controls). However, female ABCA5−/− → LDLr−/− mice did develop significantly larger atherosclerotic lesions (382±24x103 µm2 vs. 260±32x103 µm2 in female controls; p<0.05).
In conclusion, our results provide evidence that ABCA5 plays a potential role in macrophage cholesterol homeostasis, and ABCA5 deficiency in macrophages induces the progression of atherosclerotic lesions in female LDLr−/− mice.
INTRODUCTION
The transport of excess cholesterol from peripheral tissuesback to the liver for catabolism and excretion into bile, calledreverse cholesterol transport (RCT), plays an important protective role in the development of atherosclerosis.1 Several ATP-bindingcassette (ABC) transporters, which constitute a large familyof evolutionary conserved transmembrane proteins that translocatea wide variety of substrates across cellular membranes, havebeen implicated in RCT. ABCA1 is involved in the first stepof RCT1: the efflux of cholesterol from peripheral tissue macrophages to lipid-free apolipoproteins.2-4 Targeted deletion of ABCA1 in macrophages in mice susceptible for atherosclerosis leads to increased atherosclerotic lesion formation, while macrophage ABCA1 overexpression inhibits the progression of atherosclerosis.5-7 These effects are ascribed to the capacity of ABCA1 to facilitate cholesterol efflux from macrophages.
ABCA1 belongs to the subfamily A of ABC transporters, which contains 13 structurally related full-size transporters. The emerging importance of ABCA transporters in human disease is reflected by the fact that as yet four members of this protein family (ABCA1, ABCA3, ABCA4, ABCA12) have been causatively linked to human diseases.8 The biological function of the remaining 9 ABCA transporters currently awaits clarification. Recently, ABCA5 knockout mice have been generated, which develop an enlarged heart, injured liver, and decreased plasma levels of thyroid hormones.9 These findings imply the physiological importance of ABCA5. However, the exact functions and the substrate spectrum of ABCA5 are still largely unknown. ABCA5 is highly expressed in oligodendrocytes and astrocytes of the brain, cardiomyocytes of the heart, alveolar type II cells of the lung, and Leyding cells of the testis.9,10 The pronounced expression of ABCA5 in Leydig cells, which is known to process cholesterol and synthesize essential steroid hormones such as testosterone, indicates that ABCA5 may play a role in intracellular sterol/steroid trafficking.10 Recently, we identified ABCA5 as a new transporter which is highly expressed by Kupffer cells, resident macrophages of the liver. Interestingly, its expression could be further up-regulated by challenging the mice with a high-cholesterol Western-type diet.11 ABCA5 mRNA is also expressed in human monocytes and macrophages. Klucken et al. have reported that ABCA5 mRNA can be up-regulated in vitro by incubation of monocyte-derived macrophages with acetylated LDL and down-regulated by induction of cholesterol efflux by HDL3.12 Thus, ABCA5 and ABCA1 show similar up-regulation during cholesterol loading and down-regulation during cholesterol unloading. It is convincible that ABCA5 may play a potential role in macrophage cholesterol homeostasis. However, the in vivo effects of macrophage ABCA5 expression are currentlyunknown.
Macrophages in atherosclerotic lesions primarily depend on infiltration of bone marrow (BM)-derived monocytes into the arterial wall. In this study, to clarify the role of macrophage ABCA5 in atherogenesis, we created a mouse model with selective deficiency of ABCA5 in hematopoietic cells and thus macrophages, by using the bone marrow transplantation (BMT) technique. Our results demonstrate that ABCA5 potentially affects macrophage cholesterol homeostasis. Disruption of macrophage ABCA5
function did not affect initial lesion development in male LDLr−/− mice.
Atherosclerosis in female LDLr−/− mice, which are more susceptible to lesion development, was induced in absence of macrophage ABCA5.
MATERIALS AND METHODS
Mice
ABCA5 knockout (ABCA5−/−) mice were generated as described previously.9 Nontransgenic littermates were used as controls. Homozygous LDLr–/– mice (C57Bl/6J N5) were obtained from the Jackson Laboratory (Bar Harbor, Me) as mating pairs and bred at the Gorlaeus Laboratory, Leiden, The Netherlands. Mice were maintained on sterilized regular chow containing 4.3% (w/w) fat and no cholesterol (RM3, Special Diet Services, Witham, UK) or fed Western-type diet containing 15% (w/w) fat and 0.25%
(w/w) cholesterol (Diet W, Ab diets, Woerden, The Netherlands). Drinking water was supplied with antibiotics (83 mg/L ciprofloxacin and 67 mg/L polymyxin B sulfate) and 6.5 g/L sucrose. Animal experiments were performed at the Gorlaeuslaboratories of the Leiden/Amsterdam Center for Drug Research in accordance with the national laws. All experimental protocolswere approved by the ethics committee for animal experimentsof Leiden University.
Bone Marrow Transplantation
To induce bone marrow aplasia, LDLr–/– recipient mice were exposed to a single dose of 9 Gy (0.19 Gy/min, 200 kV, 4 mA) total body irradiation using an Andrex Smart 225 Röntgen source (YXLON International) with a 6-mm aluminum filter 1 day before the transplantation. Bone marrow was isolated by flushing the femurs and tibias from the donor mice with phosphate- buffered saline. Single-cellsuspensions were prepared by passing the cells through a 30-µmnylon gauze. Irradiated recipients received 0.5x107 bone marrowcells by intravenous injection into the tail vein. After a recoveryof 8 weeks animals received a high-cholesterol Western-type diet for 6 weeks.
Gene Expression Analysis
To determine mRNA expression of ABCA5 and other genes, quantitative RT-PCR analysis was performed. In brief, guanidium thiocyanate-phenol was used to extract total RNA from macrophages. cDNA was generated using RevertAid M-MuLV reverse transcriptase (Fermentas, Burlington, Canada) according to manufacturer’s protocol. Quantitative gene expression analysis was performed using the SYBR-Green method on a 7500 fast Real-time PCR machine (Applied Biosystems, Foster City, CA).
PCR primers (Table 1) were designed using Primer Express Software according to the manufacturer’s default settings. Hypoxanthine Guanine Phosphoribosyl Transferase (HPRT), β-actins, and acidic ribosomal phosphoprotein PO (36B4) were used as the standard housekeeping genes.
Relative gene expression was calculated by subtracting the threshold cycle number (Ct) of the target gene from the average Ct of housekeeping genes and raising two to the power of this difference, in order to exclude the
possibility that changes in the relative expression were caused by variations in the separate housekeeping gene expressions.
Table 1: Primers for quantitative real-time PCR analysis
Gene GeneBank Accession
Forward primer Reverse Primer
β-actin X03672 AACCGTGAAAAGATGACCCAGAT CACAGCCTGGATGGCTACGTA 36B4 X15267 GGACCCGAGAAGACCTCCTT GCACATCACTCAGAATTTCAATGG HPRT J00423 TTGCTCGAGATGTCATGAAGGA AGCAGGTCAGCAAAGAACTTATAG ABCA5 NM_147219 TCATGGGAGAGGCCGCT GCGAGAAGGCTATGACGAGGT ABCA1 NM_013454 GGTTTGGAGATGGTTATACAATAGTTGT TTCCCGGAAACGCAAGTC ABCG1 NM_009593 AGGTCTCAGCCTTCTAAAGTTCCTC TCTCTCGAAGTGAATGAAATTTATCG
Macrophage Cholesterol Efflux Studies
Bone marrow cells isolated from ABCA5+/+→ LDLr-/- and ABCA5-/-→ LDLr-/- mice were cultured for 7 days in complete RPMI medium supplemented with 20% FCS and 30% L929 cell-conditioned medium, as the source of macrophage colony-stimulating factor (M-CSF), to generate bone marrow- derived macrophages.
Bone marrow-derived macrophages were incubated with 0.5 µCi/mL 3H- cholesterol in DMEM/0.2% BSA (fatty acid free) for 24hours at 37°C. To determine cholesterol loading, cells were washed 3 times with washing buffer (50 mmol/L Tris containing 0.9% NaCl, 1 mmol/L EDTA, and 5 mmol/L CaCl2, pH7.4), lysed in 0.1 mol/L NaOH, and the radioactivity was determinedby liquid scintillation counting. Cholesterol efflux was studiedby incubation of the cells with DMEM/0.2% BSAalone or supplemented with either 10 µg/mL apoAI (Calbiochem)or 50 µg/mL human HDL (density 1.63 to 1.21 g/mL), isolatedaccording to Redgrave et al.14 Radioactivity in the medium was determined by scintillation counting after 24 hours of incubation.
Serum Lipid Analyses
After an overnight fast, ≈100 µL of blood was drawn from each mouse by tail bleeding. The concentrations of total cholesterol in serum were determined using enzymatic colorimetric assays (Roche Diagnostics, Mannheim, Germany), with 0.03 U/ml cholesterol oxidase (Sigma) and 0.065 U/ml peroxidase and 15 µg/ml cholesteryl esterase (Seikagaku, Tokyo, Japan) in reaction buffer (1.0 KPi buffer, pH=7.7 containing 0.01 M phenol, 1 mM 4-amino-antipyrine, 1% polyoxyethylene-9-laurylether, and 7.5% methanol). The concentrations of triglycerides and phospholipids in serum were determined using enzymatic colorimetric assays (Roche Diagnostics and Spinreact S.A., respectively). Precipath I (Roche Diagnostics) was usedas an internal standard. Absorbance was read at 490 nm. The distribution of lipids over the different lipoproteins in serum was determined by fractionation of 30 µl serum of each mouse using a Superose 6 column (3.2x300mm, Smart-system, Pharmacia, Uppsala, Sweden). Cholesterol and phospholipid contents in the effluent were determined as described.
Histological Analysis of the Aortic Root
To analyze the development of atherosclerosis at the aortic root, transplanted LDLr–/– mice were euthanizedafter 6 weeks of feeding the high cholesterol Western-type diet. Thearterial tree was perfused in situ with
phosphate-buffered saline(100 mm Hg) for 20 minutes via a cannula in the left ventricularapex. The heart plus aortic root and descending aorta were excisedand stored in 3.7% neutral-buffered formalin (Formal-fixx; Shandon Scientific Ltd, UK). The atherosclerotic lesion areas in Oil-Red-O-stained cryostat sections of the aortic root were quantifiedusing the Leica image analysis system, consisting of a LeicaDMRE microscope coupled to a video camera and Leica Qwin Imaging software (Leica Ltd, Cambridge, UK).
Mean lesion area (in µm2) was calculated from 10 Oil-Red-O stained sections, startingat the appearance of the tricuspid valves.
Isolation of Various Cholesterol Sources
Beta-very low-density lipoprotein (β-VLDL) was obtained from rats fed a RMH-B diet containing 2% cholesterol, 5% olive oil, and 0.5% cholic acid for 2 weeks (Abdiets). The rats were fasted overnight and anesthetized after which blood was collected by puncture of the abdominal aorta. Serum was centrifuged at 40,000 rpm in a discontinuous KBr gradient for 18 hours as reported earlier.14 β-VLDL was collected and dialysed against phosphate buffered saline containing 1 mM EDTA. Isolated β-VLDL was characterized as described previously.15
Human VLDL and LDL were collected from human serum and dialyzed against phosphate buffered saline containing 1 mM and 10µM EDTA, respectively. LDL was incubated with CuSO4 for 20h at 37°C to generate oxidized-LDL (ox-LDL).
Foam Cell Formation Studies
In vivo, leukocytes were drained from the peritoneal cavity of the transplanted animals with phosphate-buffered saline. Subsequently, foam cell counts were measured on a Sysmex XT-2000i analyzer (Goffin Meyvis, the Netherlands).
In vitro, bone marrow-derived macrophages from ABCA5−/− → LDLr−/− and ABCA5+/+ → LDLr−/− mice were incubated with free cholesterol (30µg/ml, Sigma), hVLDL (50 µg/ml), β-VLDL (50 µg/ml), and ox-LDL (20 µg/ml) for 24 hours. Lipid accumulation was visualized with Oil-Red-O staining, and gene mRNA expression was determined by quantitative RT-PCR analysis.
Data Analysis
Data were presented as means±SEM. Statistical analyses were performed using one- and two-way ANOVA using Graphpad Prism Software (Graphpad Software, Inc.; http://www.graphpad.com). The level of statistical significance was set at p<0.05.
RESULTS
Generation of LDLr–/– Mice Deficient in Macrophage ABCA5
To assess the biological role of macrophage ABCA5 in lipoprotein metabolism and in the development of atherosclerotic lesions, ABCA5 was specifically disrupted in hematopoietic cells, including macrophages, by transplantation of BM from ABCA5 knockout (ABCA5−/−) mice into LDLr–/–
mice, which represent an established model for the development of
atherosclerosis. After a recovery of 8 weeks animals received a high- cholesterol Western-type diet for 6 weeks. During the course of our experiments, the weight gain curve did not show significant changes between ABCA5−/− → LDLr−/− chimeras and ABCA5+/+ → LDLr−/− mice, either in the male or the female transplanted recipients (Fig. 1A).
At 14 weeks posttransplant, quantitative RT-PCR analysis showed that mRNA expression of the wild-type ABCA5 gene was only detectable in BM- derived macrophages from ABCA5+/+ → LDLr−/− mice, but not in BM-derived macrophages from ABCA5−/− → LDLr−/− chimeras, indicating that the BMT was successful (Fig. 1B). Disruption of ABCA5 in BM-derived macrophages resulted in a 20% decrease (p<0.05) in cholesterol effluxto HDL, whereas a 38% (p<0.05) increase in cholesterol efflux to apoAI was observed (Fig.
1C).
A
-1 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 0
10 20 30 40
ABCA5+/+
ABCA5-/- BMT W TD
Time (weeks)
Weight (g)
-1 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 0
10 20 30 40
ABCA5+/+
ABCA5-/- W TD
BMT
Time (weeks)
Weight (g)
Male Female
-1 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 0
10 20 30 40
ABCA5+/+
ABCA5-/- BMT W TD
Time (weeks)
Weight (g)
-1 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 0
10 20 30 40
ABCA5+/+
ABCA5-/- W TD
BMT
Time (weeks)
Weight (g)
Male Female
B C
Fig. 1. Verification of success of bone marrow transplantation. A, The body weight was measured in male (left) and female (right) transplanted LDLr–/– mice every week. Data represent mean±SEM of ≥20 mice per group. B, Verification of successful reconstitution with donor hematopoietic cells by quantitative RT-PCR to detect the wild-type ABCA5 gene in bone marrow-derived macrophages at 14 weeks posttransplant in LDLr–/– mice transplanted with control (ABCA5+/+) or ABCA5-deficient (ABCA5−/−) bone marrow. C, Cellular cholesterol efflux induced by 10 µg/mL lipid-free ApoAI or 50 µg/mL human HDL from 3H-cholesterol-labeled bone marrow-derived macrophages from LDLr–/– mice transplanted with either ABCA5+/+ (open bars) or ABCA5−/− (closed bars) bone marrow. Data represent mean±SEM of ≥10 mice per group. *p<0.05 vs. ABCA5+/+ transplanted recipients.
Effect of Disruption of Macrophage ABCA5 Function on Plasma Lipid Levels
During the course of the experiment, the effects of the absence of ABCA5 from hematologic cells on serum lipid levels were carefully monitored.
ApoAI HDL
0 10 20 30 40 50 60
ABCA5+/+
ABCA5-/-
*
*
Cholesterol efflux (%)
ABCA5+/+ ABCA5-/- 0.000
0.001 0.002 0.003
ABCA5
Relative mRNA expression (A.U.)
During the eight week recovery period after BMT, the mice were kept on a normal chow diet. Under these conditions, serum total cholesterol, phospholipids, and triglyceride levels did not significantly differ between ABCA5−/− → LDLr−/− chimeras and ABCA5+/+ → LDLr−/− controls, either in the male or the female transplanted animals (Table 2A and 2B). The distribution of cholesterol and phospholipids over different lipoproteins of the control and experimental groups was essentially identical on the standard chow diet (data not shown).
Table 2. Effect of macrophage ABCA5 deficiency in LDLr–/– mice on serum lipid levels.
A
Male Time
(weeks) Diet
Total Cholesterol
(mg/dL)
HDL Cholesterol
(mg/dL)
Phospholipids (mg/dL)
Triglycerides (mg/dL) ABCA5+/+→LDLr−/− Baseline Chow 416±12 ND 524±20 217±19
8 Chow 317±20 104±11 644±26 158±24
14 WTD 1089±75 78±10 589±56 444±88 ABCA5−/−→LDLr−/− Baseline Chow 419±10 ND 547±14 242±11
8 Chow 303±15 122±5 718±25 193±16
14 WTD 1252±54 82±11 725±23* 477±62
B
Female Time
(weeks) Diet
Total Cholesterol
(mg/dL)
HDL Cholesterol
(mg/dL)
Phospholipids (mg/dL)
Triglycerides (mg/dL) ABCA5+/+→LDLr−/− Baseline Chow 330±11 ND 519±16 143±13
8 Chow 244±8 88±4 508±20 90±8
14 WTD 769±44 63±3 676±40 68±9
ABCA5−/−→LDLr−/− Baseline Chow 329±14 ND 497±18 143±14 8 Chow 251±12 87±3 474±17 118±10 14 WTD 878±47 36±2** 823±48* 171±38*
Blood samples were drawn after an overnight fast before transplantation (baseline) and at 8 and 14 weeks after transplantation in the male (A) and the female (B) LDLr–/– recipients transplanted with either ABCA5+/+ or ABCA5−/− bone marrow. At 8 weeks after transplantation, the regular chow diet was switched to a high-cholesterol Western-type diet (WTD). Serum lipid levels, including total cholesterol, phospholipids, and triglycerides were measured. Data represent mean±SEM of ≥8 mice per group. *p<0.05, **p<0.01 vs. ABCA5+/+ transplanted recipients. ND indicates not determined
To induce atherosclerotic lesion formation, the transplanted LDLr–/– mice were fed the high-cholesterol Western-type diet (WTD) for 6 weeks, starting at 8 weeks after BMT. Due to the diet switch, the serum total cholesterol levels in both the control and experimental groups increased ≈3-fold, both in the male and the female transplanted animals. Under these conditions, in the male transplanted LDLr−/− mice, serum total cholesterol levels were moderately increased by 13% (1252±54 mg/dL) in ABCA5−/− → LDLr−/−
chimeras as compared to controls (1089±75 mg/dL), but this failed to reach statistical significance (Table 2A). Fractionation of serum lipoproteins showed that the mildly increased cholesterol levels were mainly caused by an increase the VLDL/LDL fraction, while HDL was largely unaffected (82±11 mg/dL for male ABCA5−/− → LDLr−/− chimeras vs. 78±10 mg/dL for controls; p=0.79) (Fig. 2A). Serum phospholipid levels were significantly increased in male ABCA5−/− → LDLr−/− (725±23 mg/dL; p<0.05) as compared to controls (589±56 mg/dL) (Table 2A), which was mainly caused by an increase in the VLDL/LDL fraction, whereas no changes were found
in the HDL fraction (Fig. 2B). No significant differences in triglyceride levels were observed between the 2 groups of male transplanted mice. On the other hand, in the female transplanted LDLr−/− mice, serum total cholesterol levels were moderately increased by 12% (878±47 mg/dL) in ABCA5−/− → LDLr−/− chimeras as compared to controls (769±44 mg/dL), but this also failed to reach statistical significance (Table 2B). Fractionation of serum lipoproteins indicated that the observed increase in cholesterol levels was mainly caused by an increase in the VLDL fraction, in contrast to a significant decrease in the HDL fraction (36±2 mg/dL for female ABCA5−/−
→ LDLr−/− chimeras vs. 63±3 mg/dL for controls; p<0.01) (Fig. 2C). Serum phospholipid levels were 1.2-fold higher in female ABCA5−/− → LDLr−/−
chimeras (823±48 mg/dL; p<0.05) as compared to controls (676±40 mg/dL) (Table 2B), which was mainly caused by an increase in the VLDL fraction, whereas no changes were found in the HDL fraction (Fig. 2D). Furthermore, serum triglyceride levels were 2.5-fold higher in female ABCA5−/− → LDLr−/−
chimeras (171±38 mg/dL; p<0.05) as compared to controls (68±9 mg/dL) (Table 2B), which was also mainly caused by an increase in the VLDL fraction (data not shown). Therefore, under dietary conditions, macrophage ABCA5 deficiency resulted in increased lipid levels associated with VLDL and/or LDL particles, while HDL was affected only in the female transplanted animals.
Fig. 2. Effect of macrophage ABCA5 deficiency in LDLr–/– mice on serum cholesterol, and phospholipid distribution. Blood samples were drawn after an overnight fast at 14 weeks after bone marrow transplantation, that is, after 6 weeks of feeding a high cholesterol Western-type diet (WTD) (male: A-B; female: C-D). Sera from individual mice were loaded onto a Superose 6 column, and fractions were collected. Fractions 3 to 6 represent VLDL;
fraction 7 to 14, LDL; and fractions 15 to 20, HDL, respectively. The distribution of cholesterol and phospholipids over the different lipoproteins in ABCA5+/+ → LDLr−/− (○) and ABCA5−/− → LDLr−/− (●) chimeras is shown. Values represent the mean±SEM of ≥8 mice per group.
0 5 10 15 20 25
0 100 200 300
400 Cholesterol
Female VLDL
LDL
HDL
Lipids (mg/dL)
10 15 20
0 10 20 30 40 50
LDL HDL
Lipids (mg/dL)
0 5 10 15 20 25
0 50 100 150
200 Phospholipids
Female
ABCA5-/- ABCA5+/+
VLDL
LDL HDL
0 5 10 15 20 25
0 100 200
300 Cholesterol
VLDL Male
LDL
HDL
Lipids (mg/dL)
0 5 10 15 20 25
0 50 100 150 200
ABCA5+/+
ABCA5-/-
Phospholipids Male VLDL
LDL HDL
C D A B
Disruption of Macrophage ABCA5 Function Induces Increased Susceptibility to Atherosclerosis in LDLr–/– Mice
To investigate the importance of macrophage ABCA5 for atherosclerotic lesion development, we analyzed the aortic root of ABCA5−/− → LDLr−/− and ABCA5+/+ → LDLr−/− mice after 6 weeks of WTD feeding. As shown in Fig.
3, disruption of macrophage ABCA5 function did not significantly affect the lesion development in the male transplanted LDLr−/− mice, as evidenced by the unchanged atherosclerotic lesion size [118±10x103 µm2 in male ABCA5−/− → LDLr−/− chimeras (n=10) vs. 104±16x103 µm2 in male ABCA5+/+
→ LDLr−/− controls (n=11)] (Fig. 3A). However, in the female transplanted LDLr−/− mice, macrophage ABCA5 deficiency did induce a 1.5-fold (p<0.05) increase in the mean lesion area from 260±32x103 µm2 (n=6) in female ABCA5+/+ → LDLr−/− mice to 382±24x103 µm2 (n=9) in female ABCA5−/− → LDLr−/− chimeras (Fig. 3B).
A B
Fig. 3. Macrophage ABCA5 deficiency controls susceptibility to atherosclerosis in LDLr–/– mice. Formation of atherosclerotic lesions was determined at 14 weeks after transplant at the aortic root of male (A) and female (B) ABCA5+/+ → LDLr−/− and ABCA5−/− → LDLr−/−
chimeras that were fed a high-cholesterol Western-type diet for 6 weeks. The mean lesion area was calculated from Oil-Red-O stained cross-sections of the aortic root at the level of the tricuspid valves. Values represent the mean of 6 to 12 mice. *p<0.05 vs. ABCA5+/+
transplanted recipients. N.S. = non-significant. Original magnification 50x.
Foam Cell Assay
In order to unravel the mechanism by which macrophage ABCA5 differentially affects atherosclerotic lesion development in the male and female transplanted recipients, in vivo and in vitro foam cell assays were performed.
In vivo, peritoneal macrophages were isolated from ABCA5−/− → LDLr−/−
chimeras and ABCA5+/+ → LDLr−/− mice at 14 weeks after BMT. Strikingly, a 2.7-fold (p<0.05) increase in foam cell counts was observed in female ABCA5−/− → LDLr−/− mice (7.1±1.1×104 vs. 2.7±1.2×104 in controls) (Fig.
4A). In agreement, microscopic visualization using Oil-Red-O stained cytospins also showed enhanced foam cell formation in female ABCA5−/− → LDLr−/− chimeras (Fig. 4B). However, no significant changes in foam cell counts were found in male ABCA5−/− → LDLr−/− chimeras (3.8±0.7×104 vs.
4.3±0.9×104 in controls; p=0.83). Thus, enhanced foam cell formation was
ABCA5+/+→→→→LDLr-/- ABCA5-/-→→→→LDLr-/- 0
100 200 300 400 500
N.S.
Lesion size (x103µµµµm2)
ABCA5+/+→→→→LDLr-/- ABCA5-/-→→LDLr-/-→→ 0
200 400 600 800
*
Lesion size (x103 µµµµm2)
Male Female
only observed in the peritoneal cavity of female transplanted LDLr−/− mice, which is most likely caused by the observed low HDL levels in these animals.
A
Male Female
0.0 2.5 5.0 7.5 10.0
ABCA5+/+
ABCA5-/-
*
N.S.
*
Foam cells (x104)
Fig. 4 In vivo foam cell assay. A, Peritoneal leukocytes were isolated from male and female ABCA5+/+ → LDLr−/− chimeras (open bars) and ABCA5−/− → LDLr−/− mice (closed bars)at 14 weeks after transplantation. The amount of foam cells in the peritoneal cavity was quantified.
Values represent the mean±SEM of ≥12 mice per group. *p<0.05 vs. ABCA5+/+ transplanted recipients. N.S. = non-significant. B, Lipid accumulation in peritoneal macrophages from female ABCA5+/+ → LDLr−/− chimeras (left) and ABCA5−/− → LDLr−/− mice (right) was visualized with Oil-Red-O staining in order to detect foam cells (red arrows). Original magnification 400x.
In vitro, BM-derived macrophages from male ABCA5−/− → LDLr−/− andmale ABCA5+/+ → LDLr−/− mice were incubated with different types of cholesterol sources (i.e. free cholesterol, human VLDL, β-VLDL, and ox-LDL) for 24 hours, and lipid accumulation was visualized with Oil-Red-O staining.
Interestingly, the use of different lipid loading led to clearly different lipid accumulation patterns in macrophages (Fig. 5A). No visible differences in lipid accumulation could be observed between ABCA5+/+ and ABCA5−/−
macrophages as a result of free cholesterol, human VLDL, or β-VLDL loading. However, clearly less extensive lipid staining was observed in ABCA5−/− macrophages upon ox-LDL loading.
RT-PCR analysis revealed that mRNA expression of ABCA5 was not significantly affected by β-VLDL loading, but it was significantly (p<0.05) up- regulated after loading with ox-LDL in ABCA5+/+ macrophages (Fig. 5B).
Interestingly, ABCA1 mRNA expression was significantly (p<0.01) up- regulated in ABCA5−/− macrophages upon β-VLDL loading, while ABCG1 mRNA expression was not affected. Similarly, significantly (p<0.05) increased expression of ABCA1 was found in ABCA5−/− macrophages after ox-LDL loading. Though ABCG1 mRNA expression was greatly (p<0.001) up-regulated upon ox-LDL loading in both ABCA5+/+ and ABCA5−/−
macrophages, no difference was found between these 2 types of macrophages. Furthermore, mRNA expression of several scavenger
ABCA5+/+ ABCA5-/-
B
receptors (SRs) (i.e., SR-A, SR-BI, CD36, and) was not significantly different between ABCA5+/+ andABCA5−/− macrophages after loading with ox-LDL (data not shown), suggesting that the observed less extensive lipid staining in ABCA5−/− macrophages upon ox-LDL loading was rather due to enhanced cholesterol efflux than less cholesterol uptake in these macrophages. Thus, ABCA1 may functionally compensate for the lack of ABCA5 in macrophages, thereby facilitating cholesterol efflux and inhibiting foam cell formation in vitro.
A
B
Control ββ-VLDLββ 0.0
0.2 0.4 0.6 0.8
N.S.
**
Relative mRNA expression (A.U.) ABCA1
Control ββββ-VLDL 0.0
0.2 0.4 0.6
0.8 ABCG1
N.S.
N.S.
ABCA5+/+
ABCA5-/-
Relative mRNA expression (A.U.)
Control ox-LDL 0.000
0.002 0.004 0.006
0.008 ABCA5
#
Relative mRNA expression (A.U.)
Control ββββ-VLDL 0.000
0.001 0.002
0.003 ABCA5
N. S.
Relative mRNA expression (A.U.)
Control ox-LDL 0.0
0.2 0.4 0.6 0.8
N.S. ABCA5+/+
ABCA5-/-
ABCG1
N.S .
###
###
Relative mRNA expression (A.U.)
Control ox-LDL 0.00
0.02 0.04 0.06 0.08 0.10
N. S.
*
ABCA1
p =0.06
Relative mRNA expression (A.U.)
Control ββ-VLDLββ 0.0
0.2 0.4 0.6 0.8
N.S.
**
Relative mRNA expression (A.U.) ABCA1
Control ββββ-VLDL 0.0
0.2 0.4 0.6
0.8 ABCG1
N.S.
N.S.
ABCA5+/+
ABCA5-/-
Relative mRNA expression (A.U.)
Control ox-LDL 0.000
0.002 0.004 0.006
0.008 ABCA5
#
Relative mRNA expression (A.U.)
Control ββββ-VLDL 0.000
0.001 0.002
0.003 ABCA5
N. S.
Relative mRNA expression (A.U.)
Control ox-LDL 0.0
0.2 0.4 0.6 0.8
N.S. ABCA5+/+
ABCA5-/-
ABCG1
N.S .
###
###
Relative mRNA expression (A.U.)
Control ox-LDL 0.00
0.02 0.04 0.06 0.08 0.10
N. S.
*
ABCA1
p =0.06
Relative mRNA expression (A.U.)
Fig. 5 In vitro foam cell assay. Bone marrow-derived macrophages from male ABCA5+/+ → LDLr−/− chimeras (open bars) and male ABCA5−/− → LDLr−/− mice (closed bars) were incubated with different cholesterol sources, including free cholesterol (FC), human VLDL (hVLDL), β- VLDL, or oxidized-LDL (ox-LDL) for 24 hours. A, Lipid accumulation was visualized with Oil- Red-O staining. Original magnification 400x. B, Quantitative RT-PCR analysis was used to
ABCA5+/+ → LDLr−/−:
FC hVLDL
Control ββββ-VLDL ox-LDL
ABCA5−/− → LDLr−/−:
FC hVLDL
Control ββββ-VLDL ox-LDL
determine mRNA expression of ABCA5, ABCA1, and ABCG1 after loading with β-VLDL or ox- LDL. Values represent the mean±SEM of relative mRNA expression compared to housekeeping gene expression. *p<0.05, **p<0.01 vs. ABCA5+/+ bone marrow-derived macrophages. #p<0.05, ###p<0.001 vs. control loading condition. N.S. = non-significant.
DISCUSSION
Macrophages cannot limit their uptake of cholesterol via scavenger receptors.16 Therefore, cholesterol efflux is an important mechanism to maintain cholesterol homeostasisin macrophages. In the current study, we demonstrate for the first time that ABCA5 potentially affects macrophage cholesterol efflux, as evidence by the observed 20% decreased cholesterol efflux to HDL in macrophages lacking functional ABCA5, while apoAI- mediated efflux was increased. Previous studies have highlighted the central importance of ABCA1 and ABCG1 in facilitating cholesterol efflux from macrophages. ABCA1 mediates export of cellular cholesterol, phospholipids, and other metabolites to lipid-poor apoAI.2-4 In contrast to ABCA1, ABCG1 facilitates cellular cholesterol and phospholipid efflux from macrophages to HDL particles, which represent a much largerproportion of the HDL and apoA-I found in the plasma than thesmall pool of lipid-poor apoA-I.17,18 In our study, no difference in ABCG1 mRNA expression was observed between macrophages with and without functional ABCA5 upon using different cholesterol sources for loading (e.g., β-VLDL or ox-LDL).
ABCA5 thus plays a potential role in macrophage cholesterol efflux to HDL, independently of the ABCG1-mediated cholesterol efflux pathway from macrophages. Interestingly, a notable up-regulation of ABCA1 was observed in ABCA5-deficient macrophages upon cholesterol loading, which may explain the observed 38% increased cholesterol efflux to apoAI in the cells lacking ABCA5. Like ABCA1, ABCA5 belongs to the ABCA subfamily.
ABCA5 knockout (ABCA5−/−) mice exhibit symptoms of lysosomal disease in heart. In agreement, ABCA5 protein is expressed intracellularly in lysosomes and late endosomes.9 Interestingly, ABCA1 is also found in the late endosomal and lysosomal compartment and mediates the trafficking of vesicles between these intracellular compartments and the plasma membrane.19 Furthermore, Tangier disease fibroblasts lacking functional ABCA1 display defective endocytic trafficking, leading to the accumulation of cholesterol in late endosomes.20 Thus, ABCA5, like ABCA1, possibly plays a role in macrophage cholesterol homeostasis. Our in vitro data indicate the possibility that ABCA1 may functionally compensate for the lack of ABCA5 in macrophages.
To study the potential of macrophage ABCA5 deficiency to affect atherosclerosis, we determined atherosclerosis susceptibility of chimeras that specifically lack functional ABCA5 on macrophages, created by transplantation of bone marrow fromABCA5−/−mice into LDLr–/– mice. In contrast to ABCA5−/− mice, which have been reported to develop dilated cardiomyopathy and die at approximately 10 weeks of age after reaching adulthood,9 LDLr–/– mice transplanted with ABCA5−/− bone marrow did survive at 14 weeks and even longer time points (data not shown) after BMT.
Specific disruption of ABCA5 in macrophages induced progression of atherosclerosis in the female LDLr–/– mice. This pro-atherogenic effect was,
however, not observed in the male transplanted recipients with smaller atherosclerotic lesions.
The expression of ABCA1 in macrophages is tightly controlled by intracellular cholesterol levels.20,21 Its activityis dramatically increased on cholesterol loading of macrophagesand the subsequent transformation into foam cells.22 It is therefore possible that compensatory up-regulation of ABCA1 in ABCA5−/− macrophages in small atherosclerotic lesions is already sufficient to facilitate cellular cholesterol efflux, thereby preventing excessive cholesterol accumulation in macrophages in the vessel wall and thus inhibiting atherosclerotic lesion development. As compared to male LDLr–/– mice, female recipients are more susceptible to develop large and advanced lesions. In this study, we indeed found larger atherosclerotic lesions in the female recipients than the male animals after 6 weeks Western-type diet feeding post transplantation. The composition and microenvironment of the atherosclerotic plaque has been shown to induce ABCA1 protein degradation.22 Furthermore, high levels of free cholesterol have been shown to accelerate ABCA1 degradation in macrophages.23-25 It is thus possible that ABCA1 production is impaired in large and advanced lesions in the female transplanted animals, due to the degradation of ABCA1 protein. Under these conditions, the effect of macrophage ABCA5 deficiency on atherosclerosis can be more pronounced, independent of compensatory up-regulation of ABCA1. As a result, specific disruption of ABCA5 function in macrophages induces the progression of atherosclerotic lesions in female LDLr−/− mice.
In our chimeric mouse model, macrophage ABCA5-deficiency resulted in substantially higher lipid levels associated with apoB-containing lipoproteins (both in the male and female transplanted animals), whilst HDL was significantly affected only in the female transplanted recipients. The observed low HDL levels provides another possible explanation for the enhanced foam cell formation and increased susceptibility to atherosclerotic lesion development in the female LDLr−/− mice lacking functional ABCA5 in macrophages. The direct cause for the pro-atherogenic plasma lipid profiles in mice transplanted with ABCA5−/− bone marrow is currently unknown.
Previously, replacement of Kupffer cells after BMT was assessed by transplantation of LDLr-/- mice with bone marrow from enhanced green fluorescent protein (EGFP) expressing mice. Already at 8 weeks after transplantation a significant amount of Kupffer cells were EGFP positive and of donor-origin.26 Since ABCA5 is highly expressed by Kupffer cells, it is convincible that hepatic ABCA5 expression could be significantly reduced in LDLr−/− mice transplanted with ABCA5−/− bone marrow, which might directly or indirectly influence hepatic lipoprotein biosynthesis or secretion.
In conclusion, the effect of macrophage ABCA5 disruption in induction of atherosclerotic lesion development in female LDLr–/– mice reported in this study renders this transporter an attractive new target for the development of novel therapeutic agents designed to prevent the progression of atherosclerosis. Due to compensatory up-regulation of ABCA1 in macrophages lacking functional ABCA5, the generation of ABCA1 and ABCA5 double knockout mouse is worth exploiting to clarify the exact role of ABCA5 in atherosclerosis.
ACKNOWLEDGEMENTS
This work was supported by the Chinese Scholarship Council (Scholarship to D.Y.), the Netherlands Organization for Scientific Research (VIDI Grant 917.66.301 to M.V.E.), and the Netherlands Heart Foundation (Grant 2001T041 to M.V.E.). M. Van Eck is an Established Investigator of the Netherlands Heart Foundation (Grant 2007T056).
REFERENCES
1. Van Eck M, Pennings M, Hoekstra M, Out R, Van Berkel TJ. Scavenger receptor BI and ATP-binding cassette transporter A1 in reverse cholesterol transport and atherosclerosis.
Curr Opin Lipidol. 2005; 16:307–315.
2. Bodzioch M, Orso E, Klucken J, Langmann T, Bottcher A, Diederich W, Drobnik W, Barlage S, Buchler C, Porsch-Ozcurumez M, Kaminski WE, Hahmann HW, Oette K, Rothe G, Aslanidis C, Lackner KJ, Schmitz G. The gene encoding ATP-binding cassette transporter 1 is mutated in Tangier disease. Nat Genet. 1999; 22:347–351.
3. Orso E, Broccardo C, Kaminski WE, Bottcher A, Liebisch G, Drobnik W, Gotz A, Chambenoit O, Diederich W, Langmann T, Spruss T, Luciani MF, Rothe G, Lackner KJ, Chimini G, Schmitz G. Transport of lipids from golgi to plasma membrane is defective in tangier disease patients and Abc1-deficient mice. Nat Genet. 2000; 24:192–196.
4. Brooks-Wilson A, Marcil M, Clee SM, Zhang LH, Roomp K, van Dam M, Yu L, Brewer C, Collins JA, Molhuizen HO, Loubser O, Ouelette BF, Fichter K, Ashbourne-Excoffon KJ, Sensen CW, Scherer S, Mott S, Denis M, Martindale D, Frohlich J, Morgan K, Koop B, Pimstone S, Kastelein JJ, Genest J Jr, Hayden MR. Mutations in ABC1 in Tangier disease and familial high-density lipoprotein deficiency. Nat Genet. 1999; 22:336–345.
5. Aiello RJ, Brees D, Bourassa PA, Royer L, Lindsey S, Coskran T, Haghpassand M, Francone OL. Increased atherosclerosis in hyperlipidemic mice with inactivation of ABCA1 in macrophages. Arterioscler Thromb Vasc Biol. 2002; 22:630–637.
6. Van Eck M, Bos IS, Kaminski WE, Orso E, Rothe G, Twisk J, Bottcher A, Van Amersfoort ES, Christiansen-Weber TA, Fung-Leung WP, Van Berkel TJ, Schmitz G. Leukocyte ABCA1 controls susceptibility to atherosclerosis and macrophage recruitment into tissues. Proc Natl Acad Sci U S A. 2002; 99:6298–6303.
7. Van Eck M, Singaraja RR, Ye D, Hildebrand RB, James ER, Hayden MR, Van Berkel TJ.
Macrophage ATP-binding cassette transporter A1 overexpression inhibits atherosclerotic lesion progression in low-density lipoprotein receptor knockout mice. Arterioscler Thromb Vasc Biol. 2006; 26:929–934.
8. Wolfgang E. Kaminski, Armin Piehler, Jürgen J. Wenzel. ABC A-subfamily transporters:
Structure, function and disease. Biochimica et Biophysica Acta. 2006; 1762(5):510-524.
9. Kubo Y, Sekiya S, Ohigashi M, et al. ABCA5 resides in lysosomes, and ABCA5 knockout mice develop lysosomal disease-like symptoms. Mol Cell Biol. 2005; 25:4138-4149.
10. Petry F, Ritz V, Meineke C, et al. Subcellular localization of rat Abca5, a rat ATP-binding- cassette transporter expressed in Leydig cells, and characterization of its splice variant apparently encoding a half-transporter. Biochem J. 2006; 393:79-87.
11. Ye D, Hoekstra M, Out R, Meurs I, Kruijt JK, Hildebrand RB, Van Berkel TJ, Van Eck M.
Hepatic cell-specific ATP-binding cassette (ABC) transporter profiling identifies putative novel candidates for lipid homeostasis in mice. Atherosclerosis, 2008; 196(2):650-8.
12. Langmann T, Klucken J, Reil M, Liebisch G, Luciani MF, Chimini G, Kaminski WE, Schmitz G. l. Molecular cloning of the human ATP-binding cassette transporter 1 (hABC1): evidence for sterol-dependent regulation in macrophages. Biochem Biophys Res Commun. 1999; 257:29–33.
13. Klucken J, Buchler C, Orso E, et al. ABCG1 (ABC8), the human homolog of the Drosophila white gene, is a regulator of macrophage cholesterol and phospholipid transport. Proc. Natl. Acad. Sci. USA. 2000; 97:817-822.
14. Redgrave TG, Roberts DC, West CE. Separation of plasma lipoproteins by density- gradient ultracentrifugation. Anal Biochem. 1975; 65:42–49.
15. Van Eck M, Herijgers N, Yates J, Pearce NJ, Hoogerbrugge PM, Groot PH and Van Berkel TJ (1997) Bone marrow transplantation in apolipoprotein E-deficient mice. Effect of ApoE gene dosage on serum lipid concentrations, (beta)VLDL catabolism, and atherosclerosis. Arterioscler Thromb Vasc Biol. 17: 3117-3126.
