macrophage cholesterol homeostasis and atherosclerosis
Ye, D.
Citation
Ye, D. (2008, November 4). ABC-transporters and lipid transfer proteins : important players in macrophage cholesterol homeostasis and atherosclerosis. Retrieved from https://hdl.handle.net/1887/13220
Version: Corrected Publisher’s Version
License: Licence agreement concerning inclusion of doctoral thesis in the Institutional Repository of the University of Leiden
Downloaded from: https://hdl.handle.net/1887/13220
Chapter 3
MACROPHAGE ATP-BINDING CASSETTE TRANSPORTER A1 OVEREXPRESSION INHIBITS ATHEROSCLEROTIC LESION PROGRESSION IN LOW-DENSITY LIPOPROTEIN RECEPTOR KNOCKOUT MICE
Miranda Van Eck1, Roshni R. Singaraja2, Dan Ye1, Reeni B.
Hildebrand1, Erick R. James2, Michael R. Hayden2, Theo J.C. Van Berkel1
1Division of Biopharmaceutics, LACDR, Leiden University, The Netherlands
2Centre for Molecular Medicine and Therapeutics, Children’s and Women’s Hospital, University of British Columbia, Vancouver, Canada.
Arterioscler Thromb Vasc Biol. 2006; 26(4):929-934.
ABSTRACT
ATP-binding cassette transporter A1 (ABCA1) is a key regulator of cellular cholesterol and phospholipid transport. Previously, we have shown that inactivation of macrophage ABCA1 induces atherosclerosis in low-density lipoprotein receptor knockout (LDLr–/–) mice. However, the possibly beneficial effects of specific upregulation of macrophage ABCA1 on atherogenesis are still unknown. Chimeras that specifically overexpress ABCA1 in macrophages were generated by transplantation of bone marrow from human ABCA1 bacterial artificial chromosome (BAC) transgenic mice into LDLr–/– mice. Peritoneal macrophages isolated from the ABCA1 BAC → LDLr–/– chimeras exhibited a 60% (P=0.0006) increase in cholesterol efflux to apolipoprotein AI. To induce atherosclerosis, the mice were fed a Western-type diet containing 0.25% cholesterol and 15% fat for 9, 12, and 15 weeks, allowing analysis of effects on initial lesion development as well as advanced lesions. No significant effect of macrophage ABCA1 overexpression was observed on atherosclerotic lesion size after 9 weeks on the Western-type diet (245±36x103 µm2 in ABCA1 BAC → LDLr–/– mice versus 210±20x103 µm2 in controls). However, after 12 weeks, the mean atherosclerotic lesion area in ABCA1 BAC → LDLr–/– mice remained only 164±15x103 µm2 (P=0.0008) compared with 513±56x103 µm2 in controls (3.1-fold lower). Also, after 15 weeks on the diet, lesions in mice transplanted with ABCA1 overexpressing bone marrow were still 1.6-fold smaller (393±27x103 µm2 compared with 640±59x103 µm2 in control transplanted mice; P=0.0015). In conclusion, ABCA1 upregulation in macrophages inhibits the progression of atherosclerotic lesions.
INTRODUCTION
Atherosclerotic cardiovascular disease is the major cause ofmorbidity and mortality in Western societies. The genesis and progression of atherosclerotic lesions involves a complicatedsequence of events in which various cell types in the arterial wall, including macrophages, play an important role.1 Deposition of excessive amounts of cholesterol in macrophages leading totheir transformation into foam cells is a pathological hallmark of atherosclerosis. Macrophages cannot limit their uptake of cholesterol via scavenger receptors.2 Therefore, cholesterol efflux is an important mechanism to maintain cholesterol homeostasisin macrophages and to prevent atherosclerotic lesion development.Epidemiological studies have shown a strong inverse relationshipbetween low plasma cholesterol levels and coronary artery disease.3–5 It is currently generally accepted that high plasma levels of high-density lipoprotein (HDL) protect against the developmentof atherosclerosis. Several mechanisms have been proposed bywhich HDL inhibits the development and progression of atherosclerosis, including protection against oxidative damage, inhibition of endothelial dysfunction, and anti-inflammatory effects.6,7 Mostimportant, HDL facilitates reverse cholesterol transport, aprocess by which excess cholesterol from peripheral tissues is transferred via the plasma to the liver for either recyclingor excretion from the body as bile.8 A key regulator of cholesterol efflux from macrophages is ATP-binding cassette transporter1 (ABCA1).
Mutations in ABCA1 cause Tangier disease, an autosomal recessive disorder that is characterized by severe HDL deficiency and increased susceptibility to atherosclerosis.9–11 Inaddition, several lines of evidence indicate that ABCA1 genevariations may contribute to the interindividual variability in atherosclerosis susceptibility in humans.12-14 Activation of ABCA1 is thus an attractive target for development of therapeutic interventions. Overexpression of ABCA1 in mice decreases atherosclerosis in apolipoprotein E (apoE) knockout15 and C57BL/6 mice.16 We have previously shown bone marrow transplantation to be a usefultechnique to study the role of macrophage ABCA1 in atherosclerosis.Specific disruption of ABCA1 in macrophages using bone marrowtransplantation resulted in an increased susceptibility to atherosclerotic lesion development without altering plasma HDL levels, providingevidence that macrophage ABCA1 plays a critical role in theprotection against atherosclerosis, independent of effects onHDL cholesterol.17 The expression of ABCA1 in macrophages is tightly controlled by intracellular cholesterol levels.18,19 Its activity is dramatically increased on cholesterol loading of macrophages and the subsequent transformation into foam cells.Therefore, it is conceivable that cholesterol efflux via ABCA1is already maximally activated in macrophages in the atheroscleroticlesion.
To study the therapeutic potential of upregulation ofmacrophage ABCA1 to prevent atherosclerosis, we determined atherosclerosis susceptibility of chimeras that specifically overexpress ABCA1on macrophages, created by transplantation of bone marrow from human ABCA1 overexpressing bacterial artificial chromosome (BAC) transgenic mice into low-density lipoprotein (LDL) receptorknockout (LDLr–/–) mice. The findings from these studies revealed that specific upregulation of macrophage ABCA1prevents
progression of atherosclerosis and thus is an attractivetherapeutic target for the prevention of atherosclerotic lesiondevelopment.
MATERIALS AND METHODS
Mice
ABCA1 BAC transgenic mice hemizygous for the human ABCA1 genewere described previously.20 Nontransgenic littermates wereused as controls.
LDLr–/– mice were obtained fromthe Jackson Laboratory (Bar Harbor, Me).
Mice were maintainedon sterilized regular chow containing 4.3% (w/w) fat and nocholesterol (RM3; Special Diet Services) or fed a Western-typediet containing 15% (w/w) fat and 0.25% (w/w) cholesterol (Diet W; Hope Farms). Drinking water was supplied with antibiotics(83 mg/L ciprofloxacin and 67 mg/L polymyxin B sulfate) and6.5 g/L sucrose. Animal experiments were performed at the Gorlaeus laboratories of the Leiden/Amsterdam Center for Drug Research in accordance with the national laws. All experimental protocolswere approved by the ethics committee for animal experimentsof Leiden University.
Bone Marrow Transplantation
To induce bone marrow aplasia, male LDLr–/– recipient mice were exposed to a single dose of 9 Gy (0.19 Gy/min, 200 kV, 4 mA) total body irradiation using an Andrex Smart 225 Röntgen source (YXLON International) with a 6- mm aluminum filter 1 day before the transplantation. Bone marrow was isolated by flushing the femurs and tibias from male ABCA1 BAC or wild- type (WT) littermates. Irradiated recipients received 0.5x107 bone marrow cells by tail vein injection.
Assessment of Chimerism
The hematologic chimerism of the LDLr–/– mice was determined using genomic DNA from bone marrow by polymerasechain reaction (PCR) at 20 weeks after transplant. The forward and reverse primers 5'GGCTGGATTAGCAGTCCTCA3' and 5'ATCCCCAACTCAAAACCACA3' for human ABCA1 and 5'TGGGAACTCCTAAAAT3' and 5'CCATGTGGTGTGTAGACA3'for mouse ABCA1 gene were used. Murine and human ABCA1 mRNAexpression relative to 18Sr-RNA in peritoneal macrophages was quantitatively determined on an ABI Prism 7700 Sequence Detection system (Applied Biosystems) using the following primers and probes for human ABCA1: forward, 5'CCTGACCGGGTTGTTCCC3'; reverse, 5'TTCTGCCGGATGGTGCTC3';
probe, 5'ACATCCTGGGAAAAGACATTCGCTCTGA3' and for murine ABCA1: forward, 5'TCCGAGCGAATGTCCTTC3'; reverse,
5'GCGCTCAACTTTTACGAAGGC3'; probe,
5'CCCAACTTCTGGCACGGCCTACATC3'.For analyses of ABCA1 protein expression, 100 to 150 µgof protein was separated on 7.5% polyacrylamide gels and wastransferred to polyvinylidene difluoride membranes (Millipore) and probed with ABCA1 PEP4 antibody20 or anti-GAPDH (Chemicon)as a control. Immunolabeling was detected by enhanced chemiluminescence
(Amersham Pharmacia Biotech), and protein levels were quantitatedusing NIH Image software.
Macrophage Cholesterol Efflux Studies
Thioglycollate-elicited peritoneal macrophages were incubated with 0.5 µCi/mL 3H-cholesterol in DMEM/0.2% BSA for 24 hours at 37°C. To determine cholesterol loading, cells were washed 3 times with washing buffer (50 mmol/L Tris containing 0.9% NaCl, 1 mmol/L EDTA, and 5 mmol/L CaCl2, pH 7.4), lysedin 0.1 mol/L NaOH, and the radioactivity was determined by liquidscintillation counting. Cholesterol efflux was studied by incubationof the cells with DMEM/0.2% BSA alone or supplemented with either10 µg/mL apoAI (Calbiochem) or 50 µg/mL human HDL.Radioactivity in the medium was determined by scintillationcounting after 24 hours of incubation.
Serum Lipid Analyses
After an overnight fast, blood was drawn from each mouse bytail bleeding.
Total cholesterol, triglycerides, and phospholipidsin serum were determined using enzymatic colorimetric assays(Roche Diagnostics). The distribution of lipids over the differentlipoproteins was determined by fractionation using a Superose 6 column (3.2x300 mm; Smart-system; Pharmacia). Total cholesterol, triglyceride, and phospholipid contents in the effluent were determined as above.
Histological Analysis of the Aortic Root
To analyze the effect of macrophage ABCA1 overexpression on atherosclerosis, transplanted mice were euthanized after 9, 12, and 15 weeks on the Western-type diet. The atheroscleroticlesion areas in oil red O–stained cryostat sections of the aortic root were quantified using the Leica image analysis system, consisting of a Leica DMRE microscope coupled to a videocamera and Leica Qwin Imaging software (Leica Ltd.).
Mean lesionarea (in µm2) was calculated from 10 oil red O-stainedsections, starting at the appearance of the tricuspid valves.For the assessment of macrophage infiltration, sections were immunolabeled with MOMA-2 (generous gift of Dr G. Kraal, Vrije Universiteit, Amsterdam, The Netherlands). The amount of collagenin the lesions was determined using Masson’s Trichrome Accustain according to manufacturer instructions (Sigma Diagnostics).TUNEL staining of lesions was performed using the In Situ Cell Death Detection kit (Roche). TUNEL-positive nuclei were visualizedwith Nova Red (Vector), and sections were counterstained with 0.3% methylgreen. Sections treated with DNase (2U per section)served as positive control. All quantifications were done blindedby computer-aided morphometric analysis using the Leica imageanalysis system.
Statistical Analyses
Statistical analyses were performed using the unpaired Studentt test (Instat GraphPad software).
RESULTS
Generation of LDLr–/– Mice Overexpressing Macrophage ABCA1
To assess the therapeutic potential of increasing macrophageABCA1 to prevent atherosclerotic lesion development, we used bone marrow transplantation to selectively upregulate ABCA1 in hematopoietic cells.
Bone marrow from ABCA1 overexpressing BAC transgenic mice was transplanted into LDLr–/– mice, which represent an established model for the developmentof atherosclerosis. Genomic DNA isolated from the LDLr–/–
mice transplanted with bone marrow from ABCA1 BAC transgenic mice contained both the human and the mouse ABCA1 transcript,whereas the control transplanted group contained only mouseABCA1, indicating that the bone marrow transfer was successful(Fig. 1A). No effect was observed of human ABCA1 overexpressionon murine ABCA1 mRNA levels (0.27±0.06 and 0.24±0.03 for human ABCA1 overexpressing macrophages and WT macrophages, respectively). Overexpression of ABCA1 in macrophages resultedin a 2.5-fold increase in ABCA1 protein expression (Fig. 1B)and a 60% (n=3; P=0.0006) increase in cholesterol efflux toapoAI (Fig. 1C).
Fig. 1. Verification of success of bone marrow transplantation. A, Verification of successful reconstitution with donor hematopoietic cells by PCR amplification of the human ABCA1 and murine ABCA1 gene at 20 weeks after transplant using genomic DNA isolated from bone marrow. B, Analyses of the effect of ABCA1 overexpression on macrophage ABCA1 protein levels by Western blotting. C, ApoAI and HDL induced cellular cholesterol efflux from
3H-cholesterol-labeled peritoneal macrophages isolated from LDLr–/– mice transplanted with either ABCA1 BAC (n=3) or control (n=3) bone marrow at 20 weeks after transplant.
Statistically significant difference ***P<0.001 compared with WT → LDLr–/– mice.
Effect of Macrophage ABCA1 Overexpression on Plasma Lipid Levels On regular chow diet, the majority of the cholesterol in LDLr–/– mice is transported by LDL and HDL, phospholipids by HDL, andtriglycerides by very low–density lipoprotein (VLDL) andLDL (Fig. 2). In contrast to the ABCA1 BAC transgenic mice that displayed mildly increased HDL cholesterol levels,20 nosignificant effect on HDL cholesterol, triglyceride, or phospholipidlevels was observed when ABCA1 was overexpressed solely in macrophages.
To induce atherosclerotic lesion development, the transplantedmice were fed Western-type diet starting at 8 weeks after transplantation. On diet feeding, serum cholesterol levels increased ~3-foldin both groups because of an increase in VLDL and LDL cholesterol, which coincided with an increase in phospholipids (Table). No significant effect of macrophage ABCA1 overexpression on serum lipid levelsor lipid distribution among the different lipoproteins was observed(Fig. 2).
Fig. 2. Effect of macrophage ABCA1 overexpression in LDLr–/– mice on serum cholesterol, phospholipid, and triglyceride distribution. Blood samples were drawn after an overnight fast at 8 weeks after transplant while feeding regular chow diet (CHOW) and at 17 weeks after bone marrow transplantation after 9 weeks of feeding a high cholesterol Western- type diet (WTD). Sera from individual mice were loaded onto a Superose 6 column, and fractions were collected. Fractions 3 to 7 represent VLDL; fraction 8 to 14, LDL; and fractions 15 to 19, HDL, respectively. The distribution of cholesterol, phospholipids, and triglycerides over the different lipoproteins in WT → LDLr–/– (○) and ABCA1 BAC → LDLr–/– (●) chimeras is shown. Values represent the mean±SEM of ≥12 mice. No statistically significant differences were observed.
Table. Effect of Leukocyte ABCA1 Overexpression in LDLr–/– Mice on Serum Lipid Levels.
Mice Time
(weeks)
Diet Total Cholesterol
(mg/dL)
HDL Cholesterol
(mg/dL)
Phospholipids (mg/dL)
Triglycerides (mg/dL)
Baseline Chow 322±13 ND 524±20 310±34
8 Chow 312±40 140±37 475±65 336±22
WT → LDLr–/–
17 WTD 869±45 118±5 666±27 349±41
Baseline Chow 336±12 ND 547±14 296±11
8 Chow 299±47 125±19 465±49 369±31
ABCA1 BAC → LDLr–/–
17 WTD 893±58 117±4 721±42 300±21
Serum lipids were measured in LDLr–/– mice before transplantation (baseline) and at 8 and 17 weeks after transplantation with control bone marrow or ABCA1 BAC overexpressing bone marrow. At 8 weeks after transplantation, the regular chow diet was switched to a high- cholesterol Western-type diet (WTD). Data represent mean±SEM of ≥12 mice. No statistically significant differences were observed between the control transplanted group and the mice transplanted with ABCA1 BAC bone marrow. ND indicates not determined.
Effect of Macrophage ABCA1 Overexpression on Atherosclerotic Lesion Initiation and Progression
To investigate the therapeutic potential of increasing macrophageABCA1 expression as a means of preventing atherosclerosis, weassessed whether and to what degree upregulation of ABCA1 inmacrophages affected lesion formation. Lesion development wasanalyzed in the aortic root of WT →
LDLr–/– miceand in ABCA1 BAC → LDLr–/– chimeras after 9, 12,and 15 weeks of Western-type diet feeding (Fig. 3).
Fig. 3. Macrophage ABCA1 overexpression in LDLr–/– mice prevents atherosclerotic lesion progression. Formation of atherosclerotic lesions was determined at 17, 20, and 23 weeks after transplant at the aortic root of WT → LDLr–/– and ABCA1 BAC → LDLr–/– chimeras that were fed a high-cholesterol Western-type diet for 9, 12, and 15 weeks, respectively. The mean lesion area was calculated from oil red O–stained cross-sections of the aortic root at the level of the tricuspid valves. Values represent the mean of 9 to 14 mice. Original magnification x50. Lesions in ABCA1 BAC → LDLr–/– mice showed a statistically significant difference of
***P<0.001 or **P<0.01 when compared with WT → LDLr–/– mice.
After9 weeks on the Western diet, no significant effect of macrophage ABCA1 overexpression on the atherosclerotic lesion size was observed (245±36x103 µm2 in ABCA1 BAC → LDLr–/– mice [n=11] versus 210±20x103 µm2 in controls [n=11]).Lesions in both groups of mice were primarily composed of macrophage-derivedfoam cells (94±2.3% and 94±2.1% for WT and ABCA1 BAC transplanted mice, respectively), indicating that macrophageABCA1 overexpression does not prevent foam cell formation andthus the initiation of atherosclerosis. Between 9 and 12 weeksof diet feeding, atherosclerosis in the mice transplanted withcontrol bone marrow progressed further in size to 513±56x103 µm2 (n=14). However, in the ABCA1 BAC → LDLr–/– mice, no time-dependent increase in lesion size was observed. The mean atherosclerotic lesion area was thus 3.1-fold smaller (164±15x103 µm2; n=14, P=0.0008) compared with control transplanted animals. Interestingly, at this time point, lesions were still primarily composed of macrophage-derived foam cells (88±3.0% and 91±4.0% for WT and ABCA1BAC transplanted mice, respectively). Thus, although macrophageABCA1 overexpression did not inhibit the initiation of foamcell formation, the progression of lesions was markedly inhibitedby upregulation of ABCA1 in macrophages. Between 12 and 15 weeksof diet feeding, lesions in control transplanted mice had progressedonly slightly in size to 640±59x103 µm2 (n=9), whereas lesion development in mice transplanted with ABCA1 overexpressingbone marrow had increased to 393±27x 103 µm2 (n=9;P=0.0015). At this time point, the lesion composition was markedly different. The macrophage content of the lesions of mice transplanted with WT bone marrow was 40±4.0%, whereas the collagen content was 15±2.2%. In contrast, mice transplanted with ABCA1
overexpressing bone marrow contained more macrophages and less collagen (53±3.9% [P=0.026] and 8.9±1.1% [P=0.029], respectively), indicative of less advanced lesions.Also, a predominant part of the lesions consisted of acellularnecrotic areas. However, the acellular area of the lesions ofmice reconstituted with ABCA1 overexpressing bone marrow was 2-fold smaller compared with control transplanted animals (53±17x103 µm2 in ABCA1 BAC and 108±20x103 µm2 in WT,respectively; P=0.057). Thus, although lesion progression wasnot completely halted by overexpression of ABCA1 in macrophages,the progression was still largely reduced.
Because ABCA1 has been implicated in the removal of apoptoticcells, the effect of macrophage ABCA1 overexpression on thenumber of TUNEL- positive cells was determined at the differentstages of lesion development (Fig. 4). After 9 weeks on Western-type diet, no effect of macrophage ABCA1 overexpression on the absolutenumber of TUNEL-positive cells in the lesions was observed.However, after 12 and 15 weeks, the number of TUNEL-positive cells was significantly lower in the ABCA1 BAC transplantedanimals. In addition, the percentage of apoptotic nuclei tothe total number of nuclei was decreased in lesions of micetransplanted with ABCA1 BAC overexpressing bone marrow. However,this effect was also observed at 9 weeks on Western-type dietand was independent of the extent of lesion development.
Fig. 4. Effect of macrophage ABCA1 overexpression in LDLr–/– mice on apoptosis in atherosclerotic lesions. Numbers of apoptotic nuclei were quantified in atherosclerotic lesions at the aortic root of WT → LDLr–/– and ABCA1 BAC → LDLr–/– chimeras that were fed a high-cholesterol Western-type diet for 9, 12, and 15 weeks, respectively. Apoptosis is expressed as the absolute number of TUNEL-positive nuclei (left) and the percentage TUNEL- positive to total nuclei (right) in the atherosclerotic lesion. The absolute number of apoptotic nuclei in lesions in ABCA1 BAC → LDLr–/– mice showed a statistically significant difference of
*P<0.05 when compared with WT → LDLr–/– (open bars) mice. Two-way ANOVA analysis showed that the percentage of apoptotic nuclei to the total number of nuclei was significantly lower (P<0.05) in lesions of ABCA1 BAC → LDLr–/– (closed bars) mice.
DISCUSSION
Insights into the role of ABCA1 in atherogenesis have been gainedfrom both patients affected with Tangier disease and recentlydeveloped animal models. Patients with mutations in ABCA1 are significantly at risk for coronary artery disease.21,22 Thecardioprotective effects of ABCA1 have been confirmed recently in animal models. Overexpression of ABCA1
resulted in decreasedsusceptibility to spontaneous atherosclerosis in apoE knockoutmice15 and in C57BL/6 mice with diet-induced atherosclerosis.16 In addition to its expression in macrophages, ABCA1 is alsohighly expressed by hepatocytes in the liver, where it is importantfor HDL lipidation.23–26 In agreement, the reduction in atherosclerosis susceptibility as a result of ABCA1 overexpression coincided with an increase in HDL cholesterol levels. Using bone marrow transplantation, we17 and Aeillo et al27 have shown that selective inactivation of ABCA1 in macrophages results in markedly increased atherosclerosis in different animal models without affecting HDL cholesterol levels. ABCA1-dependent cholesterol efflux is thus a crucial factor in the prevention of excessivecholesterol accumulation in macrophages of the arterial walland their transformation into foam cells.
To study the therapeutic potential of upregulation of macrophageABCA1 to prevent atherosclerosis, we determined atherosclerosis susceptibility of chimeras that specifically overexpress ABCA1on macrophages, created by transplantation of bone marrow fromhuman ABCA1 BAC transgenic mice into LDLr–/– mice.In this study, we show that overexpression of ABCA1 in macrophagesdid not influence initial lesion development in LDLr–/– mice.
However, specific deletion of macrophage ABCA1 in LDLr–/– mice did induce initial lesion development (M.V.E., unpublished data, 2005). The expression of ABCA1 in macrophages is tightlycontrolled by intracellular cholesterol levels.18,19 Its activityis dramatically increased on cholesterol loading of macrophagesand the subsequent transformation into foam cells.
It is therefore conceivable that cholesterol efflux via ABCA1 is already maximally activated in macrophages in the atherosclerotic lesion. As a result, further upregulation of ABCA1 expression does not inhibit initial lesion development. However, ABCA1 overexpression did inhibit the progression of the size of these fatty streak lesions.During the progression of atherosclerosis, macrophage foam cells accumulate large amounts of unesterified cholesterol, a process that is thought to contribute to macrophage death.28 Increased levels of intracellular free cholesterol accelerate the degradation of ABCA1 in macrophages.29 In agreement, Albrecht et al recently showed that the microenvironment of the atherosclerotic plaque induces ABCA1 protein degradation.30 This might provide a possibleexplanation for the fact that overexpression of ABCA1 did not inhibit initial lesion formation, whereas the progression of these lesions was inhibited. Progression of atherosclerotic lesions is also characterized by an ongoing chronic inflammatoryreaction and extensive cellular necrosis and apoptosis.31 Severallines of evidence have suggested a role for ABCA1 in the engulfmentof apoptotic cells.32–34 In agreement, we demonstratethat the percentage of apoptotic nuclei to the total numberof nuclei was decreased in lesions of mice transplanted withABCA1 BAC overexpressing bone marrow. However, this effect wasindependent of the extent of lesion development. It is thusunlikely that the protective effects of macrophage ABCA1 overexpressionin later stages of lesion development are solely the resultof accelerated clearance of apoptotic cells.
In conclusion, the important effect of macrophage ABCA1 overexpression in prevention of atherosclerotic lesion progression reported in this study renders this transporter an attractive target for the development of novel therapeutic agents designed to prevent the progression of atherosclerosis.
ACKNOWLEDGEMENTS
This work was supported by the Netherlands Heart Foundation (grant 2001T041) and an International HDL research award awarded to M.V.E.
REFERENCES
1. Ross R. Atherosclerosis-An inflammatory disease. N Engl J Med. 1991; 340:115–
125.
2. Graeves DR, Gough PJ, Gordon S. Recent progress in defining the role of scavenger receptors in transport, atherosclerosis and host defense. Curr Opin Lipidol. 1998; 9:425–432.
3. Miller GJ, Miller NE. Plasma high-density-lipoprotein concentration and development of ischemic heart disease. Lancet. 1975; 1:16–19.
4. Wilson PWF, Abbott RD, Castelli WP. High density lipoprotein cholesterol and mortality: the Framingham Heart Study. Arteriosclerosis. 1988; 8:737–741.
5. Goldbourt U, Yaari S, Medalie JH. Isolated low HDL cholesterol as a risk factor for coronary heart disease mortality: a 21 year follow-up of 8000 men. Arterioscler Thromb Vasc Biol. 1997; 17:107–113.
6. Barter PJ, Nicholls S, Rye KA, Anantharamaiah GM, Navab M, Fogelman AM.
Antiinflammatory properties of HDL. Circ Res. 2004; 95:764–772.
7. Assmann G, Gotto AM Jr. HDL cholesterol and protective factors in atherosclerosis.
Circulation. 2004; 109:III8–III14.
8. Von Eckardstein A, Nofer JR, Assmann G. High density lipoproteins and arteriosclerosis. Role of cholesterol efflux and reverse cholesterol transport.
Arterioscler Thromb Vasc Biol. 2001; 21:13–27.
9. Brooks-Wilson A, Marcil M, Clee SM, Zhang LH, Roomp K, van Dam M, Yu L, Brewer C, Collins JA, Molhuizen HO, Loubser O, Ouelette BF, Fichter K, Ashbourne- Excoffon KJ, Sensen CW, Scherer S, Mott S, Denis M, Martindale D, Frohlich J, Morgan K, Koop B, Pimstone S, Kastelein JJ, Genest JJr, Hayden MR. Mutations in ABC1 in Tangier disease and familial high-density lipoprotein deficiency. Nat Genet.
1999; 22:336–345.
10. Bodzioch M, Orso M, Klucken J, Langmann T, Bottcher A, Diederich W, Drobnik W, Barlage S, Buchler C, Porsch-Ozcurumez M, Kaminski WE, Hahmann HW, Oette K, Rothe G, Aslanidis C, Lackner KJ, Schmitz G. The gene encoding ATP-binding cassette transporter 1 is mutated in Tangier disease. Nat Genet. 1999; 22:347–351.
11. Rust S, Rosier M, Funke H, von Eckardstein A, Cullen P, Kroes HY, Hordijk R, Geisel J, Kastelein J, Molhuizen HO, Schreiner M, Mischke A, Hahmann HW, Assmann G. Tangier disease is caused by mutations in the gene encoding ATP- binding cassette transporter 1. Nat Genet. 1999; 22:352–355.
12. Clee SM, Zwinderman AH, Engert JC, Zwarts KY, Molhuizen HO, Roomp K, Jukema JW, van Wijland M, van Dam M, Hudson TJ, Brooks-Wilson A, Genest JJr, Kastelein JJ, Hayden MR. Common genetic variation in ABCA1 is associated with altered lipoprotein levels and a modified risk for coronary artery disease. Circulation. 2001;
103:1198–1205.
13. Tregouet DA, Ricard S, Nicaud V, Arnould I, Soubigou S, Rosier M, Duverger N, Poirier O, Mace S, Kee F, Morrison C, Denefle P, Tiret L, Evans A, Deleuze JF, Cambien F. In-depth haplotype analysis of ABCA1 gene polymorphisms in relation to plasma ApoA1 levels and myocardial infarction. Arterioscler Thromb Vasc Biol.
2004; 24:775–781.
14. Brousseau ME, Bodzioch M, Schaefer EJ, Goldkamp AL, Kielar D, Probst M, Ordovas JM, Aslanidis C, Lackner KJ, Bloomfield Rubins H, Collins D, Robins SJ, Wilson PW, Schmitz G. Common variants in the gene encoding ATP-binding cassette transporter 1 in men with low HDL cholesterol levels and coronary heart disease. Atherosclerosis. 2001; 154:607–611.
15. Singaraja RR, Fievet C, Castro G, James ER, Hennuyer N, Clee SM, Bissada N, Choy JC, Fruchart JC, McManus BM, Staels B, Hayden MR. Increased ABCA1 activity protects against atherosclerosis. J Clin Invest. 2002; 110:35–42.
16. Joyce CW, Amar MJ, Lambert G, Vaisman BL, Paigen B, Najib-Fruchart J, Hoyt RFJr, Neufeld ED, Remaley AT, Fredrickson DS, Brewer HBJr, Santamarina-Fojo S.
The ATP binding cassette transporter A1 (ABCA1) modulates the development of aortic atherosclerosis in C57BL/6 and apoE-knockout mice. Proc Natl Acad Sci USA.
2002; 99:407–412.
17. Van Eck M, Bos IST, Kaminski WE, Orso E, Rothe G, Twisk J, Bottcher A, Van AmersfoortES, Christiansen-Weber TA, Fung-Leung WP, Van BerkelTJ, Schmitz G.
Leukocyte ATP-binding cassette transporter A1 (ABCA1) deficiency promotes atherosclerotic lesion development. Proc Natl Acad Sci USA. 2002; 99:6298–6303.
18. Langmann T, Klucken J, Reil M, Liebisch G, Luciani MF, Chimini G, Kaminski WE, Schmitz G. l. Molecular cloning of the human ATP-binding cassette transporter 1 (hABC1): evidence for sterol-dependent regulation in macrophages. Biochem Biophys Res Commun. 1999; 257:29–33.
19. Wade DP, Owen JS. Regulation of the cholesterol efflux gene, ABCA1. Lancet.
2001; 357:161–163.
20. Singaraja RR, Bocher V, James ER, Clee SM, Zhang LH, Leavitt BR, Tan B, Brooks- Wilson A, Kwok A, Bissada N, Yang YZ, Liu G, Tafuri SR, Fievet C, Wellington CL, Staels B, Hayden MR. Human ABCA1 BAC transgenic mice show increased high density lipoprotein cholesterol and apoAI-dependent efflux stimulated by an internal promoter containing liver X receptor response elements intron 1. J Biol Chem. 2001;
276:33969–33979.
21. Clee SM, Kastelein JJ, Van Dam M, Marcil M, Roomp K, Zwarts KY, Collins JA, Roelants R, Tamasawa N, Stulc T, Suda T, Ceska R, Boucher B, Rondeau C, DeSouich C, Brooks-Wilson A, Molhuizen HO, Frohlich J, Genest JJr, Hayden MR.
Age and residual cholesterol efflux affect HDL cholesterol levels and coronary artery disease in ABCA1 heterozygotes. J Clin Invest. 2000; 106:1263–1270.
22. Van DamMJ, de Groot E, Clee SM, Hovingh GK, Roelants R, Brooks-Wilson A, Zwinderman AH, Smit AJ, Smelt AH, Groen AK, Hayden MR, Kastelein JJ.
Association between increased arterial-wall thickness and impairment in ABCA1- driven cholesterol efflux: an observational study. Lancet. 2002; 359:37–41.
23. Kiss RS, McManus DC, Franklin V, Tan WL, McKenzie A, Chimini G, Marcel YL. The lipidation by hepatocytes of human apolipoprotein A-I occurs by both ABCA1- dependent and -independent pathways. J Biol Chem. 2003; 278:10119–10127.
24. Basso F, Freeman L, Knapper Cl, Remaley A, Stonik J, Neufeld EB, Tansey T, Amar MJ, Fruchart-Najib J, Duverger N, Santamarina-Fojo S, Brewer HB Jr. Role of the hepatic ABCA1 transporter in modulating intrahepatic cholesterol and plasma HDL cholesterol concentrations. J Lipid Res. 2003; 44:296–302.
25. Wellington CL, Brunham LR, Zhou S, Singaraja RR, Visscher H, Gelfer A, Ross C, James E, Liu G, Huber MT, Yang YZ, Parks RJ, Groen A, Fruchart-Najib J, Hayden MR. Alterations of plasma lipids in mice via adenoviral-mediated hepatic overexpression of human ABCA1. J Lipid Res. 2003; 44:1470–1480.
26. Timmins JM, Lee J-Y, Boudyguina E, Kluckman KD, Brunham LR, Mulya A, Gebre AK, Coutinho JM, Colvin PL, Smith TL, Hayden MR, Maeda N, Parks JS. Targeted inactivation of hepatic Abca1 causes profound hypoalphalipoproteinemia and kidney hypercatabolism of apoA-I. J Clin Invest. 2005; 115:1333–1142.
27. Aiello RJ, Brees D, Bourassa PA, Royer L, Lindsey S, Coskran T, Haghpassand M, Francone OL. Increased atherosclerosis in hyperlipidemic mice with inactivation of ABCA1 in macrophages. Arterioscler Thromb Vasc Biol. 2002; 22:630–637.
28. Tabas I. Free cholesterol-induced cytotoxicity. A possible contributing factor to macrophage foam cell necrosis in advanced atherosclerotic lesions. Trends Cardiovasc Med. 1997; 7:256–263.
29. Feng B, Tabas I. ABCA1-mediated cholesterol efflux is defective in free cholesterol- loaded macrophages. J Biol Chem. 2002; 277:43271–43280.
30. Albrecht C, Soumian S, Amey JS, Sardini A, Higgins CF, Davies AH, Gibbs RG.
ABCA1 expression in carotid atherosclerotic plaques. Stroke. 2004; 35:2801–2806.
31. Geng Y-J, Libby P. Progression of the atheroma. A struggle between death and procreation. Arterioscler Thromb Vasc Biol. 2002; 22:1370–1380.
32. Hamon Y, Chambenoit O, Chimini G. ABCA1 and the engulfment of apoptotic cells.
Biochim Biophys Acta. 2002; 1585:64–71.
33. Luciani MF, Chimini G. The ATP binding cassette transporter ABC1, is required for the engulfment of corpses generated by apoptotic cell death. EMBO J. 1996;
15:226–235.
34. Hamon Y, Broccardo C, Chambenoit O, Luciani MF, Toti F, Chaslin S, Freyssinet JM, Devaux PF, McNeish J, Marguet D, Chimini G. ABC1 promotes engulfment of
apoptotic cells and transbilayer redistribution of phosphatidylserine. Nat Cell Biol.
2000; 2:399–406.
