University of Groningen
Developmental and pathological roles of BMP/follistatin-like 1 in the lung
Tania, Navessa
IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below.
Document Version
Publisher's PDF, also known as Version of record
Publication date: 2017
Link to publication in University of Groningen/UMCG research database
Citation for published version (APA):
Tania, N. (2017). Developmental and pathological roles of BMP/follistatin-like 1 in the lung. University of Groningen.
Copyright
Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).
Take-down policy
If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.
Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum.
1
Variant club cell differentiation is
driven by bone morphogenetic
protein 4 in adult human airway
epithelium:
Implications for goblet cell metaplasia
and basal cell hyperplasia in COPD
Navessa P. Tania, Harm Maarsingh, Frank Ensink, John-Poul Ng-Blichfeldt,
Pieter S. Hiemstra, Maurice J.B. van den Hoff, Martina Schmidt,
Reinoud Gosens
Variant club cell differentiation is driven by bone morphogenetic protein 4 in adult human airway epithelium: Implications for goblet cell metaplasia and basal cell hyperplasia in COPD
Navessa P. Tania1,2, Harm Maarsingh3, Frank Ensink1, John-Poul Ng-Blichfeldt1,2, Pieter S.
Hiemstra4
, Maurice J.B. van den Hoff5, Martina Schmidt1,2, Reinoud Gosens1,2
1University of Groningen, Department of Molecular Pharmacology, Groningen, The
Netherlands.
2University of Groningen, University Medical Center Groningen, Groningen Research
Institute for Asthma and COPD, Groningen, The Netherlands.
3Palm Beach Atlantic University, Lloyd L. Gregory School of Pharmacy, Department of
Pharmaceutical Sciences, West Palm Beach, Florida, USA.
4Dept. of Pulmonology, Leiden University Medical Centre, Leiden, The Netherlands. 5Academic Medical Center, Department of Anatomy, Embryology and Physiology,
7
Abstract
Activation of BMP signaling in adult airway epithelium is required for appropriate regeneration after epithelial injury and plays key roles in proximal-to-distal patterning of airway epithelial differentiation with highest expression in the distal airways. COPD is associated with epithelial remodeling characterized by loss of functional club cells, increased goblet cell metaplasia and basal cell hyperplasia. Here, we studied the effects of BMP4 on adult airway epithelial differentiation, hypothesizing that BMP4 would regulate club cell differentiation, whilst suppressing goblet cell differentiation. An in vitro air-liquid interface (ALI) culture system was used to grow adult primary tracheobronchial epithelial cells (PTECs). After 14 days of air-exposure in the presence or absence of BMP4, distinct morphological changes were observed in BMP4-treated PTECs. BMP4 reduced gene expression for markers of ciliated (Tektin-1), goblet (MUC5AC), and basal (TP63) cells. Interestingly, BMP4 increased marker gene expression for distal variant club cells (UPK3A, SCGB3A, SFTPA), but not for common club cells (CYP2F1, SCGB1A1). Moreover, BMP4 induced gene expression of lung progenitor markers (NKX2.1, ITGA6). Mechanistically, BMP4 increased target genes downstream of Notch signaling (HEY1, HEY3) and TGF-β1 signaling (ID-1, SERPINE1). In conclusion, BMP4 promotes distal variant club cell differentiation and suppresses proximal differentiation of goblet and ciliated cells. Our findings provide a plausible connection between the loss of (variant) club cells and increased goblet cell metaplasia and basal cell hyperplasia on one hand and the observed reduction of BMP signaling in patients with COPD on the other hand. Reactivation of BMP signaling in distal airway epithelium may be a strategy worth pursuing to trigger differentiation and maintenance of distal variant club progenitor cells capable of airway epithelial repair.
Introduction In fetal and neonatal lung development, BMP signaling is crucial in governing proximal-to-distal epithelial cell fate.1–3 Loss of BMP signaling in the developing mouse lung leads to severe loss of distal epithelial cell types, whilst promoting the presence of proximal epithelial cell types - even in the most distal airway regions.3 In adult lung, it has been proposed that BMP signaling is involved in tissue repair and that inappropriate BMP activation might contribute to adult respiratory diseases, including asthma and COPD.2–4 Activation of BMP signaling in adult airway epithelium after epithelial injury regenerates normal epithelial architecture in a similar pattern as early lung development.5,6 The healthy epithelial lining of adult airways consists of a mixed population of mucus-producing (MUC5AC+) goblet cells, (TEKT1+) ciliated cells, (TP63+) basal cells, (SCGB1A1+/
CYP2F+) club cells, and (SCGB3A2+/UPK3A+/SFTPA+) variant club cells.7,8 Goblet cells are
normally expressed in the proximal airway epithelium, whereas (variant) club cells are predominantly expressed in the distal airway epithelium. In COPD, airway epithelial cell differentiation programs are inappropriately activated with loss of functional club cells, increased goblet cell metaplasia, and basal cell hyperplasia as key pathological features of airway epithelium in the disease.9–12 Low levels of secretoglobin family
1A member 1 (SCGB1A1, also known as a club (formerly clara) cell secretory protein CC10 or CC16) in serum and bronchoalveolar lavage have been associated with the prevalence, severity and acceleration of a decline in forced expiratory volume in one second (FEV1) in COPD in several studies.10,13–17 Goblet cell metaplasia is characterized
by increased numbers of goblet cells in the proximal airways of COPD patients and by the appearance of goblet cells in more distal airway regions that normally do not express these cells.9 Importantly, our previous studies demonstrate that functional
BMP4 signaling (Smad1/5/8 phosphorylation) is reduced in COPD (Chapter 3), which could explain the change in proximal-to-distal differentiation pattern.
The air-liquid interface (ALI) culture system provides a valuable tool to study airway epithelial differentiation in vitro mimicking a polarized pseudostratified epithelium.18,19
In ALI culture, the expression of the BMP4 gene is markedly increased during mucociliary differentiation of adult airway epithelial cells.20 A recent study demonstrates that
BMP signaling is a negative regulator of basal progenitor cell proliferation in mouse tracheal epithelium6 and BMP4 drives specification of adult bronchoalveolar stem cells
in mice,21 yet little is known about the role of BMP4 in human airway epithelial cell
differentiation. In addition, the underlying mechanisms by which BMP exerts its effect in airway epithelial cell fate is still unclear.
In this study, we present evidence that BMP4 alters primary tracheobronchial epithelial cells (PTECs) morphology and induces variant club cell marker gene expression that is associated with high expression of distal epithelial and progenitor markers. In parallel, BMP4 suppresses ciliated, goblet, and basal cell marker gene expression. Our findings provide a plausible connection between the loss of (variant) club cells and increased goblet cell metaplasia and basal cell hyperplasia on one hand and the observed reduction of BMP signaling in patients with COPD on the other. Restoring
7
normal BMP signaling in distal airway epithelium may be a strategy worth pursuing to trigger differentiation and maintenance of distal variant club progenitor cells capable of airway epithelial repair.
Materials and methods
Air-liquid interface cultured primary tracheobronchial epithelial cells (ALI-PTEC)-human PTECs were isolated from anonymous healthy lung transplant donors. Lung transplant donors were selected according to Eurotransplant guidelines, including absence of tumor and primary chronic lung diseases, such as asthma and COPD, and with <20 pack years of smoking history. PTECs were expanded in submerged culture using keratinocyte serum free medium (17005-075, Invitrogen, CA, USA) supplemented with 25 µg/ml bovine pituitary extract and 0.2 ng/ml epidermal growth factor (37000-015, Invitrogen, CA, USA). Generation of mucociliary differentiated PTEC cultures was conducted using air-liquid interface (ALI) system as previously described.22,23 Prior to cell seeding in the ALI culture system, transwell semipermeable inserts were coated for 2 h at 37 °C with a mixture of 30 µg/ml PureCol (Advanced BioMatrix, San Diego, CA, USA), 10 µg/ml human fibronectin, and 10 µg/ml BSA (Sigma Aldrich, St. Louis, MO, USA) dissolved in PBS. Passage 1-2 of PTECs were seeded on coated Transwell 12 mm in diameter inserts at a density of 75,000 cells (Corning, New York, USA) and cultured in submerged condition using B/D medium composed of 1:1 DMEM (41966-029, Invitrogen, CA, USA) and BEBM supplemented with BEGM BulletKit singlequots excluding gentamicin (CC-3170, Lonza, Verviers, Belgium) plus freshly added retinoic acid (50 nM) (R-2625, Sigma Aldrich; St. Louis, MO, USA). For time course studies, fully confluent PTECs (~4 days) were air-exposed in the absence or presence of 100 ng/ml recombinant human BMP4 (314-BP, R&D system, Oxford, UK) in basal medium. RNA was extracted for real time quantitative PCR (RT-qPCR) and cells were fixed and sectioned for immunocytochemistry at day 0, 4, 9, and 14. For concentration response studies, cells were air-exposed in the absence or presence of 1, 10, 100 ng/ml recombinant human BMP4 (R&D system, Oxford, UK) in basal medium for 14 days. For all experiments, the apical surface was washed twice with PBS and freshly prepared BMP4-containing B/D medium was added every 48 h. At day 14, RNA was extracted for RT-qPCR and cells were fixed for immunocytochemistry (Figure 1A).
RNA isolation and RT-qPCR
Total RNA was extracted from ALI cultured cells using the NucleoSpin® RNA isolation kit according to manufacturer’s instruction (Macherey Nagel; Düren, Germany). The total RNA concentration was determined using the NanoDrop® ND1000 spectrophotometer (Thermo Scientific, Wilmington, MA). Equal amounts of total RNA were reverse transcribed using the Reverse Transcription System (Promega; Madison, WI, USA) to generate cDNA. Diluted cDNA was mixed with FastStart Universal SYBR Green Master Mix (Roche Applied Science; Penzberg, Germany) and gene-of-interest primer sets (Biolegio; Nijmegen, the Netherlands). Primer sequences are listed in Supplementary
Abbreviations used: TEKT1, tektin-1; MUC5AC, mucin 5AC;TP63, tumor protein 63; UPK3A, uroplakin 3A; SCGB3A2, secretoglobin family 3A member 2; SFTPA, surfactant protein A; BMP4, bone morphogenetic protein 4; FSTL1, follistatin-like 1; NOG, noggin; SCGB1A1, secretoglobin family 1A member 1; CYP2F1, cytochrome P450 family 2 subfamily F member 1; NKX2.1,NK2 homeobox 1; ITGA6, integrin α6; HEY, hes-related family BHLH transcription factor with YRPW motif; HPRT1, hypoxanthine guanine phosphoribosyl transferase 1; SDHA, succinate dehydrogenase complex flavoprotein subunit A; and B2M, β2-microglobulin.
Table 1. Real-time quantitative PCR was performed using the Illumina Eco Personal qPCR System (Westburg; Leusden, The Netherlands). The qPCR reaction was started by denaturation at 95 °C for 15 minutes followed by 45 cycles of denaturation at 94 °C for 30 s, annealing at 59 °C for 30 s and elongation at 72 °C for 30 s. Final elongation was for 5 minutes at 72 °C. Real time PCR data was analyzed using LinRegPCR software version 2013.1.24 Data were expressed in arbitrary units as ratio of the starting concentration (N0) of each gene of interest corrected to the geometric mean of the N0 value of 3 reference genes (B2M, HPRT1, SDHA).
Supplementary Table 1: Primers used for RT-qPCR analysis
Gene Forward primer (5’ 3’) Reverse primers (5’ 3’)
TEKT1 GGCCAAGGTCATGGAAGAGAT ATCACGACACAGCTCCACG
MUC5AC CTGCCAGTCCTGCCTTTGTA GACCCTCCTCTCAATGGTGC
TP63 CCTTACATCCAGCGTTTCGTAG TTTGTCTGTGTGCTCTGGGA
UPK3A CGGTTCGGCTCGGCTG ATTCCTGGAAATGGCTGAGTCG
SCGB3A2 TTACTCTGCTACTGCCTTCCTC CCTCCACAAGGTGCTCAACA
SFTPA TGTGTGGGTCGCTGATTTCT GGGATACCAGGGCTTCCAAC
BMP4 AAGCGTAGCCCTAAGCATCA TGGTTGAGTTGAGGTGGTCA
FSTL1 ACCACGATGTGGAAACGCTGGC TGCCATTACTGCCACACACAGGC
NOG TTCATGGCCACCTCGCCCCC ACTCTAGCCCTTTGATCTCG
SCGB1A1 CGTGTCATCGAAACCCTCCT GCTTTCTCTGGGCTTTTGGG
CYP2F1 ACCCTCCTTAACACCGTCCA ATGGCGGTGAGGTACAGAAAG
NKX2.1 CGCTCATTTGTTGGCGACTG CACTGAGAACGGAGTCGTGT
ITGA6 GCCAAAGATACTAGTGCCAAAGC CTTGAGGATCACCTACATAGAGCG
HEY1 GTAGTTAACTCCTCCCTGCCC GGGGACATGGAACCTAGAGC
HEY3 CTGCGTTCGCCATGAAGC GTTTCTCTATGATCCCTCTGCGT
HPRT1 AAGCCAGACTTTGTTGGATTTGA ACTGGCGATGTCAATAGGACTC
SDHA GGGAAGACTACAAGGTGCGG CTCCAGTGCTCCTCAAAGGG
7
Immunocytochemistry
Cells were fixed on transwell inserts with 10% formalin and then paraffin-embedded according to the ‘Costar® Transwell® Inserts for Histology preparation’ manufacturer’s procedure(Corning, New York, USA). Paraffin blocks were transversely cross-sectioned in 5 µm thick sections, which were fixed to glass slides for Hematoxylin and eosinstaining (Sigma Aldrich; St. Louis, MO, USA). Sections were analysed using a light microscope (Olympus BX41; Zoeterwoude, the Netherlands) using Cell^D imaging software. Antibodies used were: SCGB3A (orb186085, Biorbyt, Cambridge, UK), UPK3A (HPA018415, Atlas antibody; Stockholm, Sweden), SFTPA (AB3420-I Millipore, Amsterdam-Zuidoost, the Netherlands). Statistical analysis Data are presented as mean ± standard error of the mean (SEM) of cultures derived from 6 different donors. To determine the normality of data distribution, a Shapiro-Wilk normality test was performed prior to further statistical analysis. The statistical significance of differences of normally distributed data was performed using an independent samples 2-tailed t-test for comparisons of 2 groups or a two-way ANOVA followed by a post hoc Tukey multiple comparisons test for comparing more than 2 groups. For non-normally distributed data, statistical significance was determined using a non-parametric Mann-Whitney U test for comparing 2 groups or non-parametric one-way ANOVA with a post hoc Kruskal-Wallis multiple comparisons test for comparing more than 2 groups. Differences were considered to be statistically significant at p<0.05.
Results
BMP4 negatively regulates pseudostratified epithelial differentiation in adult human PTECs
In comparison to untreated controls, BMP treated PTECs were characterized by en-larged cell cytoplasm following 14-days of differentiation as evident by light microscopy (Figure 1B). Higher concentrations of BMP4 were associated with more expanded cell cytoplasm compared to controls at day 14 (Figure 1C). A bilayer of cells was observed in a cross-section of the submerged cultures of PTEC-controls at day 0. After 14 days of air exposure, cells formed polarized pseudostratified layers with the luminal part covered with cells with a ciliated-like phenotype starting from day 9 onwards in PTEC-controls. Strikingly, pseudostratified epithelium with ciliated cells at the luminal side was not ob-served in BMP4 treated PTECs. Instead, a thin single epithelial cell layer was observed at day 14 (Figure 1D). BMP4 treatment was associated with flattening of cuboidal epitheli- al cells (Figure 1E). These observations indicate that BMP4 inhibits normal pseudostrat-ified epithelial differentiation and instead induces differentiation of a single layered epithelium with enlarged cytoplasm in adult human PTECs.
Figure 1. BMP4 inhibits pseudostratified epithelial differentiation in adult human PTECs. (A) A schematic diagram of air-liquid-interface (ALI) culture model. (B) Representative top view images of 100 ng/ml BMP4-treated PTECs morphology overtime and (C) in responses to different concentrations of BMP4 (1; 10; 100 ng/ml) at 14 days compared to PTEC-controls. Magnification 100x. Scale bars represent 500 µm. (D) Representative cross sectional images of H&E staining of 100 ng/ml BMP4-treated PTECs morphology overtime and (E) in responses to different concentrations of BMP4 (1, 10 and 100 ng/ml) at 14 days compared to PTEC-controls. Magnification 200x. Scale bars represent 100 µm. Images were taken using a light microscope in each well of 6 independent experiments from 6 different donors. A. B. D. C. Control BMP4 Day 0 Day 4 Day 9 Day 14 0 1 10 100 BMP4 submerged
seeding air exposure
RT-qPCR Immunocytochemistry 14 days of differentiation
refresh medium +/- BMP4 (1;10;100 ng/ml)
Day 0 Day 4 Day 9 Day 14
-4 days 500 µm 500 µm 500 µm 500 µm 500 µm 500 µm 500 µm 500 µm 500 µm 500 µm 500 µm Top view
Cross sectional view E.
Control BMP4 BMP4 Day 0 Day 4 Day 9 Day 14 0 1 10 100 100 µm 100 µm 100 µm 100 µm 100 µm 100 µm 100 µm 100 µm 100 µm 100 µm 100 µm
7
BMP4 negatively regulates gene expression of ciliated, goblet, and basal cell markers in adult human PTECs
To characterize the phenotype of the BMP4 induced cells in more detail, expression of mRNA for markers of epithelial cell types, including ciliated, goblet, and basal cells, was examined at days 0, 4, 9 and 14 of ALI culture. In PTEC-controls, the ciliated cell marker Tektin-1 (p<0.05; Figure 2A,D) and the goblet cell marker MUC5AC (p<0.05; Figure 2B,E) were significantly increased over time, whereas the basal cell marker TP63 was 0 2 4 6 8 * ** ** # re la tive T EKT 1 m RNA expressi on BMP4 - - + - + - + Day 0 4 9 14 0 2 4 6 8 10 * ** ** # # BMP4 - - + - + - + re la tive MUC5AC m RNA expressi on Day 0 4 9 14 0.00 0.05 0.10 0.15 0.20 0.25 * * ## ## ## ns BMP4 - - + - + - + re la tive TP63 mR NA expressi on Day 0 4 9 14 A. B. C. D. E. F. 0.00 0.02 0.04 0.06 0.08 0.10 0.12 $$ $$ $$ re la tive T EKT 1 m RNA expressi on 1 ng/ml 10 ng/ml 100 ng/ml 0 ng/ml BMP4 0.00 0.02 0.04 0.06 0.08 0.10 $$ $$ $$ re la tive MUC5AC m RNA expressi on 1 ng/ml 10 ng/ml 100 ng/ml 0 ng/ml BMP4 0.000 0.001 0.002 0.003 $ re la tive TP63 mR NA expressi on 1 ng/ml 10 ng/ml 100 ng/ml 0 ng/ml BMP4 $ $
Figure 2. BMP4 inhibits gene expression of ciliated, goblet, and basal cell markers in adult human PTECs. Time-response effects of vehicle or BMP4 (100 ng/ml) on mRNA expression of theciliated cell marker Tektin-1 (A), the goblet cell marker MUC5AC (B), and the basal cell marker TP63 (C) in PTECs. Concentration response effects of BMP4 (1,10 and 100 ng/ml) on mRNA expression of Tektin-1 (D), MUC5AC (E), and TP63 (F) in PTECs at Day 14. Data represent mean ± SEM in arbitrary units of 6 independent experiments from 6 different donors. *p<0.05 and **p<0.01 compared to time-matched PTEC-controls; #p<0.05 and ##p<0.01 compared to Day
significantly reduced (p<0.01; Figure 2C,F). Expression of mRNA for markersof ciliated (Tektin-1), goblet (MUC5AC), and basal (TP63) cells was reduced in BMP4-treated PTECs compared to controls at corresponding time points (Figure 2A-C) and in response to different concentrations of BMP4 (Figure 2D-F). These observations demonstrate that BMP4 represses goblet, ciliated, and basal cell marker gene expression.
BMP4 induces variant club cell marker gene expression in adult human PTECs
Next, we studied the effects of BMP4 on club cells by determining the gene expression of common (SCGB1A1, CYP2F1) and distal variant club cell markers (UPK3A, SCGB3A2, SFTPA). In PTEC-controls, the mRNA expression of SCGB1A1, UPK3A (uroplakin A), SCGB3A2 (secretoglobin 3A2), and SFTPA (surfactant protein A) was unaltered (Figure 3A, C-E) whereas a time-dependent increase of CYP2F1 (p<0.01; Figure 3B) was observed. In PTECs treated with BMP4, the mRNA expression of SCGB1A1 was unaffected (Figure 3A), whereas CYP2F1 was significantly suppressed (p<0.01; Figure 3B). Intriguingly, the mRNA expression of variant club cell markers, including uroplakin 3A (p<0.05; Figure 3C), secretoglobin 3A2 (p<0.05; Figure 3D), and surfactant protein A (p<0.01; Figure 3E) was markedly upregulatedby BMP4 during the 14 day period. To confirm these findings, increasing concentrations of BMP4 were used to treat PTECs for 14 days. As observed before, BMP4 did not alter SCGB1A1 (Figure 3F) but significantly suppressed CYP2F1 (p<0.001; Figure 3G) mRNA expression in PTECs treated with increasing concentrations of BMP4. Likewise, mRNA expression for the distal variant club cell marker uroplakin 3A (p<0.001; Figure 3H), secretoglobin 3A2 (p<0.05; Figure 3I) and surfactant protein A (p<0.01; Figure 3J) were concentration-dependently induced by BMP4 in PTECs. Taken together, these results demonstrate that BMP4 suppresses marker gene expression for common club cells and promotes markers for distal variant club cells in adult human PTECs.
7
0.0 0.1 0.2 0.3 ** ** ## ## ## rela tive CY P2F1 mR NA expressi on 0.00 0.01 0.02 0.03 $$ $ rela tive UPK3 A mRNA expressi on 1 ng/ml 10 ng/ml 100 ng/ml 0 ng/ml BMP4 A. B. D. C. E. F. G. SCGB3A 0.000 0.002 0.004 0.006 $ rela tive 2 m RNA expressi on 1 ng/ml 10 ng/ml 100 ng/ml 0 ng/ml BMP4 I. H. J. rela tive mRNA on SCGB3A expressi 0.0000 0.0005 0.0010 0.0015 0.0020 0.0025 * * * 2 0 5.0×10-3 1.0×10-2 1.5×10-2 2.0×10-2 * * * rela tive UPK3 A mRNA expressi on rela tive SCGB1A 1 mR NA expressi on 0 1 2 3 4 0.0 0.2 0.4 0.6 $$ $$ 1 ng/ml 10 ng/ml 100 ng/ml 0 ng/ml BMP4 rela tive CY P2F1 mRNA expressi on rela tive SCGB1A 1mR NA expressi on 0.0 0.2 0.4 0.6 0.8 1.0 1 ng/ml 10 ng/ml 100 ng/ml 0 ng/ml BMP4Figure 3. BMP4 promotes variant club cell marker gene expression in adult human PTECs. Time-response effects of vehicle or BMP4 (100 ng/ml) on mRNA expression of the common club cell markers SCGB1A1 (A) and CYP2F1 (B), and the variant club cell markers uroplakin 3A (UPK3A; C), secretoglobin 3A2 (SGB3A2; D) and surfactant protein A (SFTPA; E) in PTECs. Concentration response effects of BMP4 (1, 10 and 100 ng/ml) on mRNA expression of SCGB1A1 (F), CYP2F1 (G), uroplakin 3A (H), secretoglobin 3A2 (I) and surfactant protein A (J) in PTECs at Day 14. Data represent mean ± SEM in arbitrary units of 6 independent experiments from 6 different donors. *p<0.05 and **p<0.01 compared to time-matched PTEC-controls; ##p<0.01 compared to Day 0 PTEC-controls; $p<0.05 and $$p<0.01 compared to Day 14 PTEC-controls; ns = not significant.
BMP4 induces time- and concentration-dependent increased of its own antagonist Fstl1 during epithelial differentiation
To investigate the underlying mechanism of BMP4 in adult epithelial differentiation, we explored the expression of BMP4 and its endogenous antagonists, FSTL1 and Noggin. A previous study showed upregulation of BMP4 expression during epithelial differentiation in ALI culture.20 In line with this, we observed that the mRNA expression of BMP4
was upregulated in a time-dependent manner (p<0.01; Figure 4A) in PTEC-controls. Interestingly, BMP4 treatment significantly inhibited its own gene transcription as evident by lower BMP4 mRNA levels (p<0.05; Figure 4A and 4D). The mRNA expression of FSTL1 was significantly reduced (P<0.05; Figure 4B) whereas Noggin was unaltered (Figure 4C) after 14 days of air exposure. BMP4 concentration dependently increased mRNA expression of FSTL1 (P<0.01; Figure 4E), but not of Noggin (Figure 4F) at day 14.
BMP4 may regulate dedifferentiation of adult lung epithelial cells by modulating expression of progenitor markers
At early stages of embryonic lung development, active BMP signaling is evident in lung buds, which predominantly consist of lung-specific progenitor cells. Involvement of BMP signaling in differentiation of lung progenitor cells from stem cells has been reported.2 To address the question whether the expression of lung progenitor markers in adult human PTECs is affected by BMP4, we determined the mRNA expression of the lung progenitor markers NKX2.1 and ITGA6. In PTEC-controls,the mRNA expression of NKX2.1 (p<0.01; Figure 5A) and ITGA6 (p<0.001; Figure 5B) was significantly reduced over time, which was prevented by BMP4 (p<0.01 and p<0.001; Figure 5A,B) in a concentration-dependent manner (Figure 5C,D). These observations suggest that BMP4 modulates gene expression of lung progenitor markers in adult human PTECs.
BMP4 induces Notch target gene expression during epithelial cell differentiation
To shed light on a possible mechanisms involved in BMP4-regulated distal variant club cell differentiation, we examined the expression of Notch target genes (HEY1 and HEY3) and TGF-β1 target genes (ID-1 and SERPINE1) as previous studies suggest that these genes are downstream target of active BMP signaling in pulmonary cells.25,26 In PTEC-controls, a significant increase in mRNA expression of HEY1 (p<0.05; Figure 6A) and ID-1 (p<0.05; Figure 6C), was observed, whereas HEY3 was unaltered (Figure 6B) and SERPINE1 decreased (p<0.01; Figure 6D) over the course of 14 days of differentia-tion. BMP4 significantly induced mRNA expression of HEY1, HEY3, ID-1, and SERPINE1 (p<0.01 all; Figure 6A-D) in a concentration-dependently manner (p<0.001; Figure 6G-H). These data suggest that both Notch and TGF-β signaling are downstream of BMP4.
BMP4 induces distal variant club cell differentiation in adult human airway epithelium
To confirm that BMP4 inhibits goblet cell differentiation and promotes variant club cell differentiation, periodic acid schiff (PAS) staining and immunostaining for distal variant club cell markers (SCGB3A/SFTPA) were performed, respectively. PAS staining
7
0.00 0.05 0.10 0.15 * * p=0.09 ## ## # BMP4 - - + - + - + re la tive BMP4 mRNA expressi on Day 0 4 9 14 re la tive NO G mR NA expressi on 0.000 0.005 0.010 0.015 Day 0 4 9 14 BMP4 - - + - + - + 0.00 0.05 0.10 0.15 $ $ 1 ng/ml 10 ng/ml 100 ng/ml 0 ng/ml BMP4 re la tive BMP4 mR NA expressi on A. B. C. D. E. F. 0.0 0.5 1.0 1.5 2.0 2.5 $$ $$ $ 1 ng/ml 10 ng/ml 100 ng/ml 0 ng/ml BMP4 re la tive FSTL 1 mR NA expressi onFigure 4. BMP4 induces gene expression of its antagonist Fstl1 in adult human PTECs time and concentration dependently. Time-response effects of vehicle or BMP4 (100 ng/ml) on mRNA expression of BMP4 (A), FSTL1 (B), and Noggin (C) in PTECs. Concentration response effects of BMP4 (1, 10 and 100 ng/ml) on mRNA expression of BMP4 (D), FSTL1 (E), and Noggin (F) in PTECs at Day 14. Data represent mean ± SEM in arbitrary units of 6 independent experiments from 6 different donors. *p<0.05 and **p<0.01 compared to time-matched PTEC-controls; #p<0.05 and ##p<0.01 compared to Day 0 PTEC-controls; $p<0.05 and $$p<0.01 compared to Day 14 PTEC-controls.
0 5 10 15 ** * ** # ## # BMP4 - - + - + - + re la tive NKX2.1 m RNA expressi on Day 0 4 9 14 re la tive ITGA 6 m RNA expressi on 0.000 0.005 0.010 0.015 0.020 Day 0 4 9 14 BMP4 - - + - + - + ** *** ### ### ### re la tive ITGA 6 mR NA expressi on 0.00 0.02 0.04 0.06 0.08 0.10 1 ng/ml 10 ng/ml 100 ng/ml 0 ng/ml BMP4 $$ 0.00 0.02 0.04 0.06 0.08 0.10 1 ng/ml 10 ng/ml 100 ng/ml $ 0 ng/ml BMP4 re la tive NKX2.1 m RNA expressi on A. B. C. D.
Figure 5. BMP4 induces gene expression of lung progenitor cell markers in adult human PTECs. Time-response effects of vehicle or BMP4 (100 ng/ml) on mRNA expression ofNKX2.1 transcription factor(A) and integrin subunit α6 (B) in PTECs. Concentration response effects of BMP4 (1; 10; 100 ng/ml) on mRNA expression of NKX2.1 transcription factor(C) and integrin subunit α6 (D) in PTECs. Data represent mean ± SEM in arbitrary units of 6 independent experiments from 6 different donors. *p<0.05, **p<0.01 and ***p<0.001 compared to time- matched non-treated controls. #p<0.05, ##p<0.01 and ###p<0.001 compared to Day 0 PTEC-controls; $p<0.05 and $$p<0.01 compared to Day 14 PTEC-controls.
7
Figure 6. BMP increases Notch and TGF target gene expression in adult human PTECs. Time-res-ponse effects of vehicle or BMP4 (100 ng/ml) on mRNA expression of Notch targets HEY1 (A) and HEY3 (B) and of TGF-β1 targets ID-1 (C) and SERPINE1 (D) in PTECs. Concentration response effects of BMP4 (1, 10 and 100 ng/ml) on mRNA expression of HEY1 (E), HEY3 (F), ID-1 (G) and SERPINE1 (H) in PTECs at Day 14. Data represent mean ± SEM in arbitrary units of 6 independent experiments from 6 different donors. **p<0.01 and ***p<0.001 compared to time-matched PTEC-controls; #p<0.05, ##p<0.01 compared to Day 0 PTEC-controls; $p<0.05, $$p<0.01 and $$$p<0.001compared to Day 14 PTEC-controls. 0.0 0.2 0.4 0.6 0.8 1.0 ** ** ** # # ## BMP4 - - + - + - + re la tive HE Y1 m RNA expressi on Day 0 4 9 14 re la tive HE Y3 m RNA expressi on 0.000 0.005 0.010 0.015 0.020 Day 0 4 9 14 BMP4 - - + - + - + *** ** ** A. B. C. E. D. F. G. H.
Figure 7. BMP4 inhibits goblet cells and promotes distal variant club cell differentiation in adult human PTECs. Representative images of PTEC-BMP4 compared to PTEC-controls stained using periodic acid-schiff (PAS, A) or the variant club cell markers secretoglobin 3A2 or surfactant protein A (B) at Day 14. Magnification 200x. Scale bars represent 100 µm.
A.
Control BMP4 (100 ng/ml) Day 14 SFTPA PASC.
SCGB3AImmunofluoresce staining CC10/CYP2F
B.
Control BMP4 (100 ng/ml) Day 14 on cross-sections of PTEC-controls showed more intense staining intensity compared to BMP4 treated cells at day 14 (Figure 7A). In contrast, the expression of distal variant club cell markers was more apparent in BMP4 treated cells compared to PTEC-controls at 14 days (Figure 7B). Taken together, these findings indicate that BMP4 may drive epithelial differentiation toward distal variant club cells in adult human PTECs. The observed mRNA expression profile of PTECs treated for 14 days with or without BMP4 is summarized in Table 1.7
Acknowledgements This study was financially supported by a grant from the Netherlands Lung Foundation (grant 3.2.12.083). Conflict of interests The authors declare no financial conflict of interests. Author contributions NPT and RG conceived the study and designed the experiments. NPT carried out the experiments, analyzed the data, and drafted the manuscript. FE performed some experiments and analyzed the data. All co-authors approved the final version of the manuscript.Table 1. Summary
Characteristics Control BMP4
Morphology Pseudostratified columnar Widened, flatten cells
Gene expression TEKT1 + - Ciliated cell marker MUC5AC + - Goblet cell marker TP63 - - Basal cell marker SCGB1A1 - -Common club cell markers CYP2F1 + -UPK3A - + Variant club cell markers SCGB3A - + SFTPA - + NKX2.1 - + Progenitor cell markers ITGA6 - + Abbreviations used: TEKT1, tektin-1; MUC5AC, mucin 5AC;TP63, tumor protein 63; SCGB1A1, secretoglobin family 1A member 1; CYP2F1, cytochrome P450 family 2 subfamily F member 1; UPK3A, uroplakin 3A; SCGB3A2, secretoglobin family 3A member 2; SFTPA, surfactant protein A; NKX2.1,NK2 homeobox 1; and ITGA6, integrin α6.
References
1. Bellusci S, Henderson R, Winnier G, Oikawa T, Hogan BL. Evidence from normal expression and targeted misexpression that bone morphogenetic protein (Bmp-4) plays a role in mouse embryonic lung morphogenesis. Dev Camb Engl. 1996;122(6):1693-1702.
2. Sountoulidis A, Stavropoulos A, Giaglis S, et al. Activation of the canonical bone morphogenetic protein (BMP) pathway during lung morphogenesis and adult lung tissue repair. PloS One. 2012;7(8):e41460. doi:10.1371/journal.pone.0041460.
3. Weaver M, Yingling JM, Dunn NR, Bellusci S, Hogan BL. Bmp signaling regulates proximal-distal differentiation of endoderm in mouse lung development. Dev Camb Engl. 1999;126(18):4005-4015.
4. Warburton D, Bellusci S. The molecular genetics of lung morphogenesis and injury repair. Paediatr Respir Rev. 2004;5 Suppl A:S283-287. 5. Shi W, Chen F, Cardoso WV. Mechanisms of lung development: contribution to adult lung disease and relevance to chronic obstructive pulmonary disease. Proc Am Thorac Soc. 2009;6(7):558-563. doi:10.1513/pats.200905-031RM. 6. Tadokoro T, Gao X, Hong CC, Hotten D, Hogan BLM. BMP signaling and cellular dynamics during regeneration of airway epithelium from basal progenitors. Dev Camb Engl. 2016;143(5):764-773. doi:10.1242/dev.126656. 7. Kotton DN, Morrisey EE. Lung regeneration: mechanisms, applications and emerging stem cell populations. Nat Med. 2014;20(8):822-832. doi:10.1038/nm.3642. 8. Li F, He J, Wei J, Cho WC, Liu X. Diversity of Epithelial Stem Cell Types in Adult Lung. Stem Cells Int. 2015;2015:e728307. doi:10.1155/2015/728307.
9. Saetta M, Turato G, Baraldo S, et al. Goblet cell hyperplasia and epithelial inflammation in peripheral airways of smokers with both symptoms of chronic bronchitis and chronic airflow limitation. Am J Respir Crit Care Med. 2000;161(3 Pt 1):1016-1021. doi:10.1164/ ajrccm.161.3.9907080.
10. Pilette C, Godding V, Kiss R, et al. Reduced epithelial expression of secretory component in small airways correlates with airflow obstruction in chronic obstructive pulmonary disease. Am J Respir Crit Care Med. 2001;163(1):185-194. doi:10.1164/ajrccm.163.1.9912137.
11. Gamez AS, Gras D, Petit A, et al. Supplementing defect in club cell secretory protein attenuates airway inflammation in COPD. Chest. 2015;147(6):1467-1476. doi:10.1378/chest.14-1174. 12. Shaykhiev R, Crystal RG. Early events in the pathogenesis of chronic obstructive pulmonary
disease. Smoking-induced reprogramming of airway epithelial basal progenitor cells. Ann Am Thorac Soc. 2014;11 Suppl 5:S252-258. doi:10.1513/AnnalsATS.201402-049AW. 13. Bernard A, Marchandise FX, Depelchin S, Lauwerys R, Sibille Y. Clara cell protein in serum and bronchoalveolar lavage. Eur Respir J. 1992;5(10):1231-1238. 14. Vestbo J, Edwards LD, Scanlon PD, et al. Changes in Forced Expiratory Volume in 1 Second over Time in COPD. N Engl J Med. 2011;365(13):1184-1192. doi:10.1056/NEJMoa1105482.
15. Park HY, Churg A, Wright JL, et al. Club cell protein 16 and disease progression in chronic obstructive pulmonary disease. Am J Respir Crit Care Med. 2013;188(12):1413-1419. doi:10.1164/rccm.201305-0892OC. 16. Lomas DA, Silverman EK, Edwards LD, et al. Evaluation of serum CC-16 as a biomarker for COPD in the ECLIPSE cohort. Thorax. 2008;63(12):1058-1063. doi:10.1136/thx.2008.102574. 17. Guerra S, Halonen M, Vasquez MM, et al. The relation of circulating CC16 to lung function growth, decline, and development of COPD across the lifespan. Lancet Respir Med. 2015;3(8):613-620. doi:10.1016/S2213-2600(15)00196-4. 18. Kaartinen L, Nettesheim P, Adler KB, Randell SH. Rat tracheal epithelial cell differentiation in vitro. In Vitro Cell Dev Biol Anim. 1993;29A(6):481-492.
19. Whitcutt MJ, Adler KB, Wu R. A biphasic chamber system for maintaining polarity of differentiation of cultured respiratory tract epithelial cells. Vitro Cell Dev Biol J Tissue Cult Assoc. 1988;24(5):420-428. 20. Ross AJ, Dailey LA, Brighton LE, Devlin RB. Transcriptional profiling of mucociliary differentiation in human airway epithelial cells. Am J Respir Cell Mol Biol. 2007;37(2):169-185. doi:10.1165/ rcmb.2006-0466OC. 21. Lee J-H, Bhang DH, Beede A, et al. Lung stem cell differentiation in mice directed by endothelial
7
cells via a BMP4-NFATc1-thrombospondin-1 axis. Cell. 2014;156(3):440-455. doi:10.1016/j.cell.2013.12.039.
22. Mertens TCJ, Hiemstra PS, Taube C. Azithromycin differentially affects the IL-13-induced expression profile in human bronchial epithelial cells. Pulm Pharmacol Ther. 2016;39:14-20. doi:10.1016/j. pupt.2016.05.005. 23. Amatngalim GD, van Wijck Y, de Mooij-Eijk Y, et al. Basal cells contribute to innate immunity of the airway epithelium through production of the antimicrobial protein RNase 7. J Immunol Baltim Md 1950. 2015;194(7):3340-3350. doi:10.4049/jimmunol.1402169. 24. Ruijter JM, Ramakers C, Hoogaars WMH, et al. Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Res. 2009;37(6):e45. doi:10.1093/nar/gkp045. 25. Rock JR, Gao X, Xue Y, Randell SH, Kong Y-Y, Hogan BLM. Notch-Dependent Differentiation of Adult Airway Basal Stem Cells. Cell Stem Cell. 2011;8(6):639-648. doi:10.1016/j.stem.2011.04.003. 26. Cibois M, Luxardi G, Chevalier B, et al. BMP signalling controls the construction of vertebrate
mucociliary epithelia. Development. 2015;142(13):2352-2363. doi:10.1242/dev.118679.
27. Rackley CR, Stripp BR. Building and maintaining the epithelium of the lung. J Clin Invest. 2012;122(8):2724-2730. doi:10.1172/JCI60519. 28. Wells JM, Melton DA. Early mouse endoderm is patterned by soluble factors from adjacent germ layers. Dev Camb Engl. 2000;127(8):1563-1572. 29. Mou H, Vinarsky V, Tata PR, et al. Dual SMAD Signaling Inhibition Enables Long-Term Expansion of Diverse Epithelial Basal Cells. Cell Stem Cell. 2016;19(2):217-231. doi:10.1016/j.stem.2016.05.012. 30. Reynolds SD, Giangreco A, Power JH, Stripp BR. Neuroepithelial bodies of pulmonary airways serve as a reservoir of progenitor cells capable of epithelial regeneration. Am J Pathol. 2000;156(1):269-278. doi:10.1016/S0002-9440(10)64727-X. 31. Barnes PJ. CLub cells, their secretory protein, and copd. Chest. 2015;147(6):1447-1448. doi:10.1378/ chest.14-3171.
32. Shijubo N, Itoh Y, Yamaguchi T, et al. Clara cell protein-positive epithelial cells are reduced in small airways of asthmatics. Am J Respir Crit Care Med. 1999;160(3):930-933. doi:10.1164/ ajrccm.160.3.9803113. 33. Rokicki W, Rokicki M, Wojtacha J, Dżeljijli A. The role and importance of club cells (Clara cells) in the pathogenesis of some respiratory diseases. Kardiochirurgia Torakochirurgia Pol Pol J Cardio-Thorac Surg. 2016;13(1):26-30. doi:10.5114/kitp.2016.58961. 34. Myllärniemi M, Lindholm P, Ryynänen MJ, et al. Gremlin-mediated decrease in bone morphogenetic protein signaling promotes pulmonary fibrosis. Am J Respir Crit Care Med. 2008;177(3):321-329. doi:10.1164/rccm.200706-945OC. 35. De Langhe E, Cailotto F, De Vooght V, et al. Enhanced endogenous bone morphogenetic protein signaling protects against bleomycin induced pulmonary fibrosis. Respir Res. 2015;16:38. doi:10.1186/s12931-015-0202-x.
36. Dong Y, Geng Y, Li L, et al. Blocking follistatin-like 1 attenuates bleomycin-induced pulmonary fibrosis in mice. J Exp Med. 2015;212(2):235-252. doi:10.1084/jem.20121878.
37. Miller M, Beppu A, Rosenthal P, et al. Fstl1 Promotes Asthmatic Airway Remodeling by Inducing Oncostatin M. J Immunol Baltim Md 1950. 2015;195(8):3546-3556. doi:10.4049/jimmunol.1501105. 38. Murphy N, Gaynor KU, Rowan SC, et al. Altered Expression of Bone Morphogenetic Protein
Accessory Proteins in Murine and Human Pulmonary Fibrosis. Am J Pathol. 2016;186(3):600-615. doi:10.1016/j.ajpath.2015.10.032.
39. Miller M, Esnault S, Kurten RC, et al. Segmental allergen challenge increases levels of airway follistatin-like 1 in patients with asthma. J Allergy Clin Immunol. 2016;138(2):596-599.e4. doi:10.1016/j. jaci.2016.01.019.
40. Liu M, Liu R, Wu H, et al. Radix puerariae extracts ameliorate paraquat-induced pulmonary fibrosis by attenuating follistatin-like 1 and nuclear factor erythroid 2p45-related factor-2 signalling pathways through downregulation of miRNA-21 expression. BMC Complement Altern Med. 2016;16:11. doi:10.1186/s12906-016-0991-6.
41. Sylva M, Li VSW, Buffing AAA, et al. The BMP antagonist follistatin-like 1 is required for skeletal and lung organogenesis. PloS One. 2011;6(8):e22616. doi:10.1371/journal.pone.0022616.
42. Geng Y, Dong Y, Yu M, et al. Follistatin-like 1 (Fstl1) is a bone morphogenetic protein (BMP) 4 signaling
antagonist in controlling mouse lung development. Proc Natl Acad Sci U S A. 2011;108(17):7058-7063. doi:10.1073/pnas.1007293108.
43. Maeda Y, Chen G, Xu Y, et al. Airway epithelial transcription factor NK2 homeobox 1 inhibits mucous cell metaplasia and Th2 inflammation. Am J Respir Crit Care Med. 2011;184(4):421-429. doi:10.1164/rccm.201101-0106OC.
44. Chapman HA, Li X, Alexander JP, et al. Integrin α6β4 identifies an adult distal lung epithelial population with regenerative potential in mice. J Clin Invest. 2011;121(7):2855-2862. doi:10.1172/ JCI57673. 45. Guha A, Vasconcelos M, Cai Y, et al. Neuroepithelial body microenvironment is a niche for a distinct subset of Clara-like precursors in the developing airways. Proc Natl Acad Sci. 2012;109(31):12592-12597. doi:10.1073/pnas.1204710109. 46. Paul MK, Bisht B, Darmawan DO, et al. Dynamic changes in intracellular ROS levels regulate airway basal stem cell homeostasis through Nrf2-dependent Notch signaling. Cell Stem Cell. 2014;15(2):199-214. doi:10.1016/j.stem.2014.05.009. 47. Lafkas D, Shelton A, Chiu C, et al. Therapeutic antibodies reveal Notch control of transdifferentiation in the adult lung. Nature. 2015;528(7580):127-131. doi:10.1038/nature15715.
