University of Groningen
Genetic engineering of Penicillium chrysogenum for the reactivation of biosynthetic pathways
with potential pharmaceutical value
Guzmán Chávez, Fernando
IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below.
Document Version
Publisher's PDF, also known as Version of record
Publication date: 2018
Link to publication in University of Groningen/UMCG research database
Citation for published version (APA):
Guzmán Chávez, F. (2018). Genetic engineering of Penicillium chrysogenum for the reactivation of biosynthetic pathways with potential pharmaceutical value. University of Groningen.
Copyright
Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).
Take-down policy
If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.
Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum.
CHAPTER 5
GENE INACTIVATION AND
OVEREXPRESSION OF PUTATIVE β-LACTAM
PRODUCTION RELATED TRANSPORTERS IN
PENICILLIUM CHRYSOGENUM
Fernando Guzmán-Chávez1, Stefan S. Weber1,
Roel A.L. Bovenberg2,3,Arnold J.M. Driessen1
1Molecular Microbiology and 2Synthetic Biology and Cell
Engineering, Groningen Biomolecular Sciences and
Biotechnology Institute, University of Groningen, Groningen, The Netherlands
ABSTRACT
Penicillium chrysogenum is a filamentous fungus that is used for β-lactam production at an industrial scale. Biosynthesis of these anti-biotics is a dynamic process that involves enzymes localized in differ-ent cell compartmdiffer-ents. however, the mechanism of β-lactam excre-tion across the plasma membrane has remained unresolved. To identify possible transporters involved in this process, seven genes were se-lected from a transcriptomics analysis that compared gene expression in the absence and presence of the penicillin precursors phenylacetic acid or phenoxyacetic acid, assuming that transporter genes would be upregulated during penicillin production. This set of transporter genes was deleted in a high β-lactam yielding strain, and the impact of the deletion on penicillin V/G biosynthesis was assessed through metab-olite profile analysis. Deletion of none of the seven candidate genes affected penicillin production, but deletion of the Pc22g00380 gene reduced the uptake of phenylacetic acid and phenoxyacetic acid with only little impact on penicillin production.
CHAPTER 5
157
INTroDUCTIoN
INTRODUCTION
Penicillins were the first β-lactam antibiotics used for the treatment of infectious disease and are still widely used in different areas of hu-man and veterinarian medicine (yang et al., 2012). Many of the de-tails of the biosynthesis of β-lactam have been resolved, and the pro-cess starts with the condensation of l-α-aminoadipic acid (l-aaa), l-cysteine (l-Cys) and l-valine (l-Val) to form the precursor δ-l-α-aminoadipyl-l-cysteinyl-D-valine (aCV), and in this process l-valine is epimerized to the D-form during activation and addition to form the llD-tripeptide (ozcengiz and Demain, 2013). This step is catalyzed by the 424-kDa nonribosomal peptide synthase (NrPS) called δ-(1-α- aminoadipyl)-l-cysteinyl-D-valine synthetase (aCVS) encoded by the pcbAB gene (Weber, Polli, et al., 2012). Subsequently the bicyclic ring structure isopenicillin N (IPN) is formed via oxidative ring closure through the action of the cytosolic IPN synthase (IPNS encoded by pcbC) (Bartoszewska et al., 2011; Weber, Polli, et al., 2012). IPN is sub-sequently transported into a microbody and the hydrophilic l-α-aaa side chain is exchanged for a hydrophobic acyl group of a side chain precursor by acyl coenzyme a (Coa): isopenicillin N acyl-transferase (IaT) (Bartoszewska et al., 2011), encoded by penDE. IaT is capable of substituting the aminoadipic acid moiety with phenylacetic acid (Paa) or phenoxyacetic acid (Poa) only when these precursors are provided in a Coa activated thioester form. The latter involves the phenylacetic acid Coa ligase (PlC), which is not part of the biosynthetic gene clus-ter (BGC). In the absence of an utilizable hydrophobic acid, isopenicil-lin N is hydrolyzed to 6-aminopenicillanic acid (6-aPa) by IaT (Weber, Polli, et al., 2012; ozcengiz and Demain, 2013).
So far most of research was focused on the enzymes involved in the biosynthetic pathway of β-lactams (Martín et al., 2013). In the last few years, there has been an increasing interest in the subcellular localiza-tion and compartmentalizalocaliza-tion of the penicillin biosynthetic pathway, most notably the microbodies that carry out the final stages of bio-synthesis. however, little is known about the transport of precursors into microbodies (Fernández-aguado et al., 2013). For instance, im-portant intermediates of the biosynthetic pathway such as isopenicil-lin N also need to be actively transported into the microbody (Weber, Bovenberg, et al., 2012).
158 G ene inactiv ation and o ver expr ession o f puta tiv e β-lactam pr oduction r ela ted tr ansport er s in Penicillium c hry so genum INTroDUCTIoN
Several fungal transporters have been implicated in the uptake of precursors into P. chrysogenum and the secretion of β-lactams. re-garding the mechanism of β-lactam secretion into the medium, var-ious options need to be considered, i.e., passive diffusion, vesicu-lar transport and the involvement of transport proteins (Evers et al., 2004). Various lines of evidences suggest that penicillin secretion is an active process involving transporters. For instance, penicillin ex-cretion is blocked by verapamil, an antagonist of multidrug transport-ers, while in active metabolizing cells, the levels of penicillins in the medium exceed that of penicillin within the cell. (Martín et al., 2010). likely, the responsible transporters are also involved in detoxification process. For instance, the aBC transporter PDr12 in S. cerevisiae is re-sponsible for the extrusion of weak acids to protect the cell against its toxicity (Piper et al., 1998). Based on energetics and membrane pro-tein structure, secretion specific transporters in fungi can be divided into two main classes: the primary activity transporters which utilize the energy of aTP hydrolysis to secrete various substrates across the plasma membrane, i.e., the aTP-binding cassette (aBC) transporters, and the secondary multidrug transporters which utilize the transmem-brane electrochemical gradient of protons or sodium ions to drive the extrusion of drugs from the cell (Weber, Polli, et al., 2012; yang et al., 2012). Genomic sequencing of P. chrysogenum revealed this fun-gus contains 830 genes that specify transporter proteins. Secondary transporters (688) are the most numerous with the majority belonging to the major superfamily (416), whereas 51 aBC transporters were identified (van den Berg et al., 2008). Using a transcriptomic data set that assessed the expression of all transporter genes under condi-tions of penicillin production in the presence of a weak acid precursor and a control lacking the precursor, a set of seven upregulated trans-porter genes was selected. In an attempt to clarify the mechanism of β-lactam secretion in P. chrysogenum, these seven genes were deleted in a high penicillin yielding strain of P. chrysogenum. Metabolic profil-ing revealed that none of the genes impacted penicillin G/V produc-tion, but one of the transporter genes (ΔPc22g00380) appears to be involved in precursor uptake.
CHAPTER 5
159
MaTErIalS aND METhoDS
MATERIALS AND METHODS
STRAIN, MEDIA AND GROWTH CONDITIONS.
all the gene deletion strains were derived from P. chrysogenum DS54466 (hFa). The overexpression strain was derived from DS54468 (aFF401; Table 1). These strains contain 8 and 1 copy of the penicillin BGC, re-spectively. Strains were kindly provided by DSM Sinochem Pharmaceu-ticals (Delft, The Netherlands). Conidiospores immobilized on rice were inoculated in yGG medium to isolate genomic DNa (gDNa), prepare protoplasts and pre-cultures for penicillin G and V production. Precul-tures were diluted seven times at day 0 in PPM (Penicillin Producing Medium), cells were grown for up to 5 days in supplemented medium with 2.5 % Paa (phenyl acetic acid) or 2.5 % Poa (Phenoxyacetic acid) in 100 ml flasks shaken at 25 °C and 200 rpm. Correct transformants were place on r-agar for sporulation during 5 days, and used to prepare rice batches for long-term storage (Weber, kovalchuk, et al., 2012). CONSTRUCTION OF GENE DELETION STRAINS AND
OVEREXPRESSION STRAIN PC22G14600
The deletion strains were built using the Gateway system (Invitrogen, USa). The 5’ and 3’ regions of each gene (Pc12g02880, Pc13g12740, Table 1. Strain used in this study
Strain Genotype Source
DS54466 (HFA) 8 Penicillin BGC, Δku70 DSM Sinochem Pharmaceuticals DS54468 (AFF401) 1 Penicillin BGC, Δku70, DSM Sinochem Pharmaceuticals Wisconsin strain 1 Penicillin BGC DSM Sinochem Pharmaceuticals Strains derived from DS54466
ΔPc12g02880 AmdS marker This study ΔPc13g12740 AmdS marker This study ΔPc20g07650 AmdS marker This study ΔPc22g00380 AmdS marker This study ΔPc06g01070 AmdS marker This study ΔPc22g16370 AmdS marker This study ΔPc22g14600 AmdS marker This study Strains derived from DS54468
160 G ene inactiv ation and o ver expr ession o f puta tiv e β-lactam pr oduction r ela ted tr ansport er s in Penicillium c hry so genum
MaTErIalS aND METhoDS
Pc20g07650, Pc22g00380, Pc06g01070, Pc22g16370, Pc2214600 (ABC11)) were amplified using Phusion hF polymerase (Thermo Fisher Scientific, USa) from gDNa derived from strain DS54466. all primers used in this study are described in Table S1. The amplicons generated were cloned in the respective donor vector pDoNr P4-P1r and pDoNr2r-P3 us-ing the BP Clonase II enzyme mix (Invitrogen, USa). The amdS marker placed in the vector pDoNr221-aMDS ( Weber, kovalchuk, et al., 2012) was used for fungal selection. Constructions were transformed to E. coli Dh5α, plasmids were recovered from cells grown in the pres-ence of kanamycin. Subsequently, the constructions generated along with the pDEST r4-r3 vector were used in an in vitro recombination reaction utilizing lr Clonase II Plus enzyme mix ( Invitrogen, USa), fol-lowing transformation of E. coli Dh5α, the positive clones were se-lected for with ampicillin.
To generate an overexpression strain of Pc22g14600 (OE_ABC11), the 5’ and 3’ region were amplified and cloned in the respective donor vector using the primers listed in Table 1. The 3’ flank was amplified from the homologous regions located before and after the start codon of Pc22g14600 gene. The promoter of the pcbC gene of P. chrysoge-num was used to induce expression and was inserted between the two flanks selected. To build the donor vector that contains the pcbC promoter fused with acetamide resistant cassette, the amdS gene was amplified from plasmid pDoNr221-aMDS (Weber, kovalchuk, et al., 2012), and the pcbC promoter was amplified from the vector pDest r4-r3 + aMDS + IPNS+ MfsI + hisaT. Next, the two amplicons were fused by overlap PCr using adapter primers (Table 1). The PCr prod-uct was cloned in the donor vector pDoNr221. The pDEST r4-r3 vector with the overexpression cassette was built as described above. FUNGAL TRANSFORMATION
Protoplasts were isolated from P. chrysogenum as described previ-ously (kovalchuk et al., 2012). For all transformants, 5 µg of plasmid that contains the deletion or overexpression cassette were digested with the proper enzyme. The linearized vector was used to transform the fungal protoplasts as detailed in Weber et al., 2012. Screening of transformants was done by colony PCr using the Phire Plant Direct
CHAPTER 5
161
MaTErIalS aND METhoDS
PCr kit (life Technologies, USa), following the manufacturers proto-col. Positive transformants were subjected to three rounds of sporula-tion on r-agar medium and further validated by southern blot analysis. SOUTHERN BLOT ANALYSIS
about 15 µg of gDNa of all transformants were digested overnight with the suitable restriction enzyme(s). The digested gDNa was separated by electrophoresis on a 0.8 % agarose gel. The DNa was transferred overnight to positively charged nylon membrane (Zeta-Probe, Biorad, USa). Subsequently, the hybridisation and detection were done as de-scribed previously (Nijland et al., 2008). For the probe design, a DNa fragment between 0.7 and 0.1 kb from the upstream or downstream region of every gene was amplified using the listed primers (Table 1). qPCR ANALYSIS
Mycelium of strains (Table 2) grown for 48 h in yGG medium ( kovalchuk et al., 2012) was harvested and disrupted in a FastPrep FP120 system to isolate genomic DNa. To measure the copy number of the penicillin BGC, 40 ng of genomic DNa was used along with specific primers for pcbAB and pcbC genes. The γ-actin gene (Pc20g11630) was used as a control for normalization. assays were performed in a Miniopticon system (Biorad, USa) using SensiMix SyBr hi-roX (Bioline, australia) as master in a final reaction volume of 25 µl. The following thermo-cycler conditions were used: 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s, 60 °C for 30 s, and 72 °C for 30 s, as described previ-ously (Nijland et al., 2010). Melting curves were realized to determine the qPCr specificity. Measurements were analyzed with the Bio-rad CFX manager program in which the Ct (threshold cycles) values were determined by regression. The copy number determination was per-formed two times with independent biological samples.
162 G ene inactiv ation and o ver expr ession o f puta tiv e β-lactam pr oduction r ela ted tr ansport er s in Penicillium c hry so genum rESUlTS METABOLITE ANALYSIS
The strains were grown in PPM medium supplemented with 5 mM phe-nylacetic acid (Paa) or phenoxyacetic acid (Poa). The samples were collected at 3, 4 and 5 days and centrifuged for 5 min at 4000 rpm to di-vide the mycelium and supernatant fractions. The mycelium was dried at 65 °C for 48 h and the dry weight was measured. a volume of 2 ml of the supernatant fraction was centrifuged at 14,000 rpm for 5 min to remove the remaining mycelium whereupon 1 ml of the cleared super-natant was filtered with a 0.2 µm-pore polytetrafluoroethylene (PTFE) syringe filter. The extracellular concentrations of Paa, Poa, penicillin G and V were determined as described (Weber, kovalchuk, et al., 2012). Measurements were corrected by dry weight. The analysis was done with two biological samples with two technical duplicates.
RESULTS
To identify the putative transporters related to β-lactam production, seven candidate genes were chosen from a previous analysis per-formed in the host laboratory (Weber et al., 2012 unpublished). The candidate genes were selected according to their transcriptional re-sponse when the strain DS17690 was grown in presence and absence of Paa and Poa (Table 2 (Weber, 2012)). Pc12g02880 and Pc06g01070 genes encode for putative MFS transporters. The first gene was se-lected since it displays a reduction in the expression levels when the tested strains are fed with Poa and Paa. In contrast, the gene expres-sion for Pc06g01070 showed an increase until 5-fold further when the strains grew in presence of Paa. Two genes (Pc22g14600 (aBC11) and Pc22g16370) that encode aBC transporter proteins were chosen. Gene expression of Pc22g16370 was reduced in the tested conditions. Contrary to the rise (up to ten fold) in the transcriptional levels exhib-ited by Pc22g14600 gene. The remaining selected genes (Pc13g12740, Pc20g07650 and Pc22g00380) encode for a putative oligopeptide transporter protein, GDP/GTP exchange factor and a transmembrane subunit, respectively. Discreet changes in gene expressions were ob-served (Table 2).
CHAPTER 5
163
rESUlTS
The seven selected genes were individually deleted from a high pro-ducer penicillin strain (DS54466), cells were grown under penicillin producing conditions with Paa or Poa as precursor and the culture broth was subjected to metabolite profiling using hPlC (Figure 1). To exclude a possible effect because of a reduction of the number of pen-icillin BGCs, the number of clusters in the gene deletion mutants was determined by q-PCr (Figure 2).
With all tested mutants no changes were detected in the levels pen-icillin V and G (Figure 1) as compared to the parental strain. a discreet change in the consumption of Poa at day 3 was observed in most of the mutants, with exception of ΔPc13g12740 and ΔPc22g16370 strains. however, this detected difference was not sustained along the all the tested days. only strain ΔPc22g00380 showed a lower uptake of Poa (around 50 %) throughout the fermentation (Figure 1G) but this did not impact the penicillin production. With all strains, except again for the ΔPc22g00380 strain (Figure 1h), there was no change Table 2. Transporter analysis using microarray. AFF indicates AFF206 strain.
DS indicates Ds17690 strain. Data taken from Weber et al., 2012 unpublished.
NRRL-Wisconsin Shake Flasks: POA PAA Chemostats Annotation Gene AFF (-) AFF (+) DS (-) DS (+) DS (-) DS (+) DS (-) DS (+) Wis (-) Wis (+) MFS; The Major Facilitator Superfamily (MFS) Pc12g02880 23.1 49.1 43.6 39.0 15.3 7.5 72.6 43.8 73.9 48.3 OPT; OPT oligopeptide transporter protein Pc13g12740 178.2 124.6 201.0 206.3 79.7 67.1 183.1 181.7 172.0 200.9 Sec2p; GDP/GTP
ex-change factor Sec2p Pc20g07650 118.1 98.8 127.1 138.8 45.4 57.9 77.1 87.4 89.5 83.7 M_PBP2;
Transmem-brane subunit (TM) found in Periplasmic
Binding Protein (PBP) Pc22g00380 169.8 203.7 179.5 221.9 99.9 94.3 218.4 291.5 261.2 232.4 Wisconsin-DS
Annotation Gene AFF (-) AFF (+) DS (-) DS (+) DS (-) DS (+) DS (-) DS (+) Wis (-) Wis (+) MFS; The Major Facilitator Superfamily (MFS) Pc06g01070 36.9 43.3 71.3 98.6 9.3 49.0 25.5 62.0 12 57.7 ABC_PDR_domain2; The pleiotropic drug resistance-like (PDR) family of ABC transporters. Pc22g14600 276.5 442.5 176.7 307.8 135.3 223.5 176.0 567.2 35.0 399.5 ABC2_membrane_5; ABC-2 family transporter protein Pc22g16370 1677.1 1142.1 1890.81671.7 561.4 453.5 1692.4 1466.3 1318.7 1239.9
164 G ene inactiv ation and o ver expr ession o f puta tiv e β-lactam pr oduction r ela ted tr ansport er s in Penicillium c hry so genum rESUlTS 0,00 0,05 0,10 0,15 0,20 0,25 0,30 0,00 0,02 0,04 0,06 0,08 0,10 0,12 ΔPc12g02880 P enV / d ry w ei gh t 0,00 0,05 0,10 0,15 0,20 0,25 0,30 0,00 0,02 0,04 0,06 0,08 0,10 0,12 0,00 0,05 0,10 0,15 0,20 0,25 0,30 0,00 0,02 0,04 0,06 0,08 0,10 0,12 P O A / d ry w ei gh t Fermentation Days ΔPc13g12740 ΔPc20g07650 0,00 0,05 0,10 0,15 0,20 0,25 0,30 0,00 0,02 0,04 0,06 0,08 0,10 0,12 0,14 0,16 0,18 ΔPc12g02880 0,00 0,05 0,10 0,15 0,20 0,25 0,30 0,00 0,02 0,04 0,06 0,08 0,10 0,12 0,14 0,16 0,18 ΔPc13g12740 0,00 0,05 0,10 0,15 0,20 0,25 0,30 0,00 0,02 0,04 0,06 0,08 0,10 0,12 0,14 0,16 0,18 P A A / d ry w ei gh t P enG / d ry w ei gh t 0,00 0,05 0,10 0,15 0,20 0,25 0,30 0,00 0,02 0,04 0,06 0,08 0,10 0,12 2 3 4 5 6 ΔPc20g07650 ΔPc22g00380 0,00 0,05 0,10 0,15 0,20 0,25 0,30 0,00 0,02 0,04 0,06 0,08 0,10 0,12 0,14 0,16 0,18 2 3 4 5 6 ΔPc22g00380 A C B D E F G H
Figure 1. Metabolite analysis. Penicillin G and V levels (bold line) detected in
supernatants of the indicated deletion (A to N) and overexpression (O to P) strains. PAA and POA residual levels measured in the extracellular medium (dashed lines). Bullet points: Circles indicate control DS54466 strain. Trian-gles represent the deletion indicated strain. All the samples were taken after 3, 4 and 5 days. Data were corrected for dry weight. Analysis was done in two independents experiments by two technical replicates.
CHAPTER 5
165
rESUlTS
in Paa consumption or uptake. Thus deletion of Pc22g00380 reduces the uptake of the weak acids Poa and Paa suggesting that it may en-code a weak acid transporter.
0,00 0,05 0,10 0,15 0,20 0,25 0,30 0,00 0,02 0,04 0,06 0,08 0,10 0,12 ΔPc06g01070 0,00 0,05 0,10 0,15 0,20 0,25 0,30 0,00 0,02 0,04 0,06 0,08 0,10 0,12 0,14 0,16 0,18 ΔPc06g01070 0,00 0,05 0,10 0,15 0,20 0,25 0,30 0,00 0,02 0,04 0,06 0,08 0,10 0,12 0,00 0,05 0,10 0,15 0,20 0,25 0,30 0,00 0,02 0,04 0,06 0,08 0,10 0,12 0,14 0,16 0,18 ΔPc22g16370 ΔPc22g16370 0,00 0,05 0,10 0,15 0,20 0,25 0,30 0,00 0,02 0,04 0,06 0,08 0,10 0,12 ΔPc22g14600 0,00 0,05 0,10 0,15 0,20 0,25 0,30 0,00 0,02 0,04 0,06 0,08 0,10 0,12 0,14 0,16 0,18 P O A / d ry w ei gh t P enV / d ry w ei gh t P A A / d ry w ei gh t P enG / d ry w ei gh t ΔPc22g14600 0,000 0,005 0,010 0,015 0,020 0,025 0,030 0,035 0,00 0,02 0,04 0,06 0,08 0,10 0,12 Fermentation Days 2 3 4 5 6 OE_Pc22g14600 0,000 0,005 0,010 0,015 0,020 0,025 0,030 0,035 0,00 0,02 0,04 0,06 0,08 0,10 0,12 0,14 0,16 0,18 2 3 4 5 6 OE_Pc22g14600 I J K L M N O P
166 G ene inactiv ation and o ver expr ession o f puta tiv e β-lactam pr oduction r ela ted tr ansport er s in Penicillium c hry so genum DISCUSSIoN OVEREXPRESSION OF PC22G14600
a transcriptional analysis performed to all 48 aBC transporter genes present in the genome of P. chrysogenum showed that Pc22g17530 (abc40) gene is overexpressed when it is grown in present of Paa. like-wise, a complementation experiment done in Saccharomyces cerevisiae Δpdr12, in which abc40 was introduced, demonstrated that aBC40 acts aTP detoxification system to protect the cell, partially restoring the function of PDr12 (Weber, kovalchuk, et al., 2012). This study also revealed that abc11 is not upregulated in presence of Paa. how-ever, aBC 11 belongs to aBC-G transporters, that includes PDr12, which makes aBC11 a potential and attractive target to investigate (harris et al., 2009; Weber, kovalchuk, et al., 2012). To further test the possible participation of the aBC11 transporter in penicillin se-cretion and/or week acid detoxification, the Pc22g14600 gene was overexpressed in a low penicillin yielding strain (DS54468). The re-sults demonstrated that overexpression mutant of ABC11 did not im-pact Paa and Poa consumption, neither did it affect the production of penicillin G and V (Figure 1o–P).
DISCUSSION
Penicillin biosynthesis takes place in different cell compartments (Martín et al., 2010), and thus for an optimal metabolite flux, there
0 2 4 6 8 10 12 IPNS ACVS
Number Copies Penicillin Cluster
CHAPTER 5
167
DISCUSSIoN
must be transporter proteins involved that carry out the uptake and excretion of intermediates and end products. a previous analysis of the transcriptome (microarray) of P. chrysogenum (Weber et al., 2012 unpublished), showed that gene expression of a specific set of genes is altered when an industrial strain of P.chrysogenum is grown in PPM medium supplemented with Poa and Paa. This data suggests that putative transmembrane proteins encoded by these genes might be involved in the process of β-lactams transport. Taking into account this information, seven genes were proposed as potential transporters involved in penicillin secretion. These genes were individually deleted in a high β-lactam yielding strain in order to assess its possible partic-ipation in the excretion process. however, none of the tested genes when deleted affected the kinetics of β-lactam production, which ei-ther suggests that they are not involved in this process, or that ei-there is a redundancy in the transporter activity such that the deletion of a sin-gle transporter does not lead to an appreciable effect on β-lactam pro-duction. only with the deletion of Pc22g00380 transporter there was a reduced uptake of Paa and Poa from the medium, without affect-ing the penicillin production (Figure 1G–h). Since Paa and Poa are present in excess in the medium, we speculate that this transporter is involved in uptake of these weak acids. however, also another mech-anism exists such as passive diffusion, as previously it has been re-ported (hillenga et al., 1995; Eriksen et al., 1998). Indeed it has been suggested that only when low concentrations of Paa are used, trans-porter proteins are required (Evers et al., 2004).
Pc22g14600 (aBC11) belongs to the aBC-G transporter family, such as Pdr12 protein that is involved in the detoxification of weak acids (Piper et al., 1998; harris et al., 2009; Nygård et al., 2014). This makes aBC11 an attractive candidate to be involved in penicillin pro-duction. Metabolite analysis (Figure 1M–N), however, showed that the deletion strain of this gene does not affect penicillin production and the uptake of Paa and Poa. Probably, it is because of aBC40 is the main aBC transporter involved in the detoxification process of Paa/Poa (Weber, kovalchuk, et al., 2012), which makes redundant the expression of a second aBC transporter as aBC11. This observa-tion agrees with the previous results reported by Weber et al. 2012, in which ABC11 is weakly expressed under conditions of shaken flask growth and not upregulated when cells were grown in presence of
168 G ene inactiv ation and o ver expr ession o f puta tiv e β-lactam pr oduction r ela ted tr ansport er s in Penicillium c hry so genum aCkNoWlEDGEMENTS
Paa. Therefore the overexpression of abc11, in a lower penicillin yield-ing strain (1 copy penicillin BGC), was chosen as strategy. however, the overexpression did not affect production or the precursors uptake, which confirms that aBC11 is not a critical transporter involved in penicillin biosynthesis or in detoxification mechanism of Poa and Paa under the tested conditions.
Summarizing, so far the deletion analysis of transporters has not led to the elucidation of the penicillin secretion mechanism, and fu-ture studies should therefore take a full genomic high throughput ap-proach to find the elusive transporter, which is currently beyond the possibilities of the genetic toolbox of P. chrysogenum.
ACKNOWLEDGEMENTS
This work was supported by the Perspective Genbiotics program subsi-dized by Stichting toegepaste wetenschappen (STW) and (co)financed by the Netherlands Metabolomics Centre (NMC) which is a part of the Netherlands Genomics Initiative/Netherlands organization for Scientific research (NWo). FGC was supported by Consejo Nacional de Ciencia y Tecnología (CoNaCyT, México) and Becas Complemento SEP (México). The authors acknowledge DSM Sinochem Pharmaceuti-cals (Delft, The Netherlands) for kindly providing the DS54466 (hFa) and DS54468 (aFF401).
REFERENCES
Bartoszewska, M., Opaliński, Ł., Veenhuis, M., and van der Klei, I.J. (2011) The significance of peroxisomes in secondary metabolite biosynthesis in fil-amentous fungi. Biotechnol. Lett. 33: 1921–1931.
van den Berg, M. a, Albang, R., Albermann, K., Badger, J.H., Daran, J.-M., Driessen, A.J.M., et al. (2008) Genome sequencing and analysis of the filamentous fungus Penicillium chrysogenum. Nat. Biotechnol. 26: 1161–1168.
Eriksen, S.H., Soderblom, T.B., Jensen, B., and Olsen, J. (1998) Uptake of phenyl acetic acid by two strains of Penicillium chrysogenum. Biotechnol.
CHAPTER 5
169
rEFErENCES
Evers, M.E., Trip, H., van den Berg, M.A., Bovenberg, R.A.L., and Driessen, A.J.M. (2004) Compartmentalization and transport in beta-lactam anti-biotics biosynthesis. In, Brakhage,A.A. (ed), Adv Biochem Eng Biotechnol., pp. 111–135.
Fernández-Aguado, M., Ullán, R. V, Teijeira, F., Rodríguez-Castro, R., and Martín, J.F. (2013) The transport of phenylacetic acid across the peroxisomal membrane is mediated by the PaaT protein in Penicillium chrysogenum.
Appl. Microbiol. Biotechnol. 97: 3073–84.
Harris, D.M., van der Krogt, Z.A., Klaassen, P., Raamsdonk, L.M., Hage, S., van den Berg, M.A., et al. (2009) Exploring and dissecting genome-wide gene expression responses of Penicillium chrysogenum to phenylacetic acid consumption and penicillinG production. BMC Genomics 10: 1–20. Hillenga, D.J., Versantvoort, H., van der Molen, S., Driessen, A., and Konings, W.N. (1995) Penicillium chrysogenum Takes up the Penicillin G Precursor Pheny-lacetic Acid by Passive Diffusion. Appl. Environ. Microbiol. 61: 2589–95. Kovalchuk, A., Weber, S.S., Nijland, J.G., Bovenberg, R.A.L., and Driessen,
A.J.M. (2012) Chapter 1 Fungal ABC Transporter Deletion and Localiza-tion Analysis. In, Bolton, M.D. and Thomma, B.P.H.J. (eds), Plant Fungal
Pathogens: Methods and Protocols., pp. 1–16.
Martín, J.-F., García-Estrada, C., and Ullán, R. V (2013) Transport of substrates into peroxisomes: the paradigm of β-lactam biosynthetic intermediates.
Biomol. Concepts 4: 197–211.
Martín, J.F., Ullán, R. V., and García-Estrada, C. (2010) Regulation and compart-mentalization of β-lactam biosynthesis. Microb. Biotechnol. 3: 285–299. Nijland, J.G., Ebbendorf, B., Woszczynska, M., Boer, R., Bovenberg, R.A.L., and Driessen, A.J.M. (2010) Nonlinear Biosynthetic Gene Cluster Dose Ef-fect on Penicillin Production by Penicillium chrysogenum. Appl.
Enviro-mental Microbiol. 76: 7109–7115.
Nijland, J.G., Kovalchuk, A., van den Berg, M.A., Bovenberg, R.A.L., and Driessen, A.J.M. (2008) Expression of the transporter encoded by the cefT gene of
Acremonium chrysogenum increases cephalosporin production in Penicil-lium chrysogenum. Fungal Genet. Biol. 45: 1415–1421.
Nygård, Y., Mojzita, D., Toivari, M., Penttilä, M., Wiebe, M.G., and Ruohonen, L. (2014) The diverse role of Pdr12 in resistance to weak organic acids.
Yeast 31: 219–232.
Ozcengiz, G. and Demain, A.L. (2013) Recent advances in the biosynthesis of penicillins, cephalosporins and clavams and its regulation. Biotechnol.
170 G ene inactiv ation and o ver expr ession o f puta tiv e β-lactam pr oduction r ela ted tr ansport er s in Penicillium c hry so genum rEFErENCES
Piper, P., Mahé, Y., Thompson, S., Pandjaitan, R., Holyoak, C., Egner, R., et al. (1998) The Pdr12 ABC transporter is required for the development of weak organic acid resistance in yeast. EMBO J. 17: 4257–4265.
Weber, S.S. (2012) Engineeringof Pencillium chrysogenum for enhanced β- lactam biosynthesis.
Weber, S.S., Bovenberg, R.A.L., and Driessen, A.J.M. (2012) Biosynthetic con-cepts for the production of β-lactam antibiotics in Penicillium
chrysoge-num. Biotechnol. J. 225–236.
Weber, S.S., Kovalchuk, A., Bovenberg, R.A.L., and Driessen, A.J.M. (2012) The ABC transporter ABC40 encodes a phenylacetic acid export system in
Penicillium chrysogenum. Fungal Genet. Biol. 49: 915–921.
Weber, S.S., Polli, F., Boer, R., Bovenberg, R.A.L., and Driessen, A.J.M. (2012) Increased penicillin production in Penicillium chrysogenum production strains via balanced overexpression of isopenicillin n acyltransferase.
Appl. Environ. Microbiol. 78: 7107–7113.
Yang, J., Xu, X., and Liu, G. (2012) Amplification of an MFS transporter coding gene penT significantly stimulates penicillin production and en-hances the sensitivity of Penicillium chrysogenum to phenylacetic acid. J.
CHAPTER 5
171
SUPPorTING INForMaTIoN
SUPPORTING INFORMATION
Table S1. Primers used in this study.
Name Sequence (5→’3’) Reference Use
Pc12g02880-5-fw TAAGTTAACCCAGTGTGATATCCGGGGACAACTTTGTATAGAAAAGTTGGThis study
Clonin
g
Kn
ock
outs
Pc12g02880-5-rv TTCTATAAAATAAGCTCTGCTTGGGGGGACTGCTTTTTTGTACAAACTTGGThis study Pc12g02880-3-fw GGGGACAGCTTTCTTGTACAAAGTGGGCAATATTGAAGGAGAGAGAATTTC This study Pc12g02880-3-rv ATGACACCTCATAATGGTTGGGGGGACAACTTTGTATAATAAAGTTGGTThis study Pc13g12740-5-fw TCTCTTTACTCCAGATATCACCTAGGGGGACAACTTTGTATAGAAAAGTTGGThis study Pc13g12740-5-rv ATGATAAAATGCTCTCATTGCGGGGACTGCTTTTTTGTACAAACTTGGTThis study Pc13g12740-3-fw ATAAGCGTCGCTGATTAATGGGGACAGCTTTCTTGTACAAAGTGGGThis study Pc13g12740-3-rv AAACAAGGTGACACAGGTGGGGGACAACTTTGTATAATAAAGTTGGTThis study Pc20g07650-5-fw ATCAAATGTTGTAAGAGTCAAGGGGGGACAACTTTGTATAGAAAAGTTGGThis study Pc20g07650-5-rv ACAGGTTACTATCCACGCCGGGGACTGCTTTTTTGTACAAACTTGGThis study Pc20g07650-3-fw TTGATCATAAGCGATCAACAGGGGACAGCTTTCTTGTACAAAGTGGGThis study Pc20g07650-3-rv ATGGCGATCTGTCCTTACTGGGGACAACTTTGTATAATAAAGTTGGThis study Pc22g00380-5-fw ACGAAGTTGGTCTCTTCGTGGGGACAACTTTGTATAGAAAAGTTGGThis study Pc22g00380-5-rv GGGGACTGCTTTTTTGTACAAACTTGGTCTCTATAGAATTTGGAAGCCTG This study Pc22g00380-3-fw ACTTCCTATTGCTGTTTCTCAGGGGACAGCTTTCTTGTACAAAGTGGGThis study Pc22g00380-3-rv GGGGACAACTTTGTATAATAAAGTTGGCCATCAATATCGTACAATTG This study Pc06g01070-5-fw GGGGACAACTTTGTATAGAAAAGTTGGCTGTGCATAGTACTGCACTC This study Pc06g01070-5-rv ATCCACCTATCGAATATTGTCTGGGGACTGCTTTTTTGTACAAACTTGGThis study Pc06g01070-3-fw ACCTTGGTTTATCAACAGAGTCGGGGACAGCTTTCTTGTACAAAGTGGGThis study Pc06g01070-3-rv GGGGACAACTTTGTATAATAAAGTTGGTCACATGTACTCACAGTGCATA This study Pc22g16370-5-fw AGTCGATTTGTTGCAAGAGGGGGACAACTTTGTATAGAAAAGTTGGThis study Pc22g16370-5-rv GGGGACTGCTTTTTTGTACAAACTTGGTCCGTATGCATGATGTCTC This study Pc22g16370-3-fw ATGCGCTTGTATATAAGAGTTGTGGGGACAGCTTTCTTGTACAAAGTGGGThis study Pc22g16370-3-rv AGTGCGTCAGCTAACATGAGGGGACAACTTTGTATAATAAAGTTGGTThis study Pc22g14600-5-fw GGGGACAACTTTGTATAGAAAAGTTGGCAGACAGAAGTTGCACTTC This study Pc22g14600-5-rv ATCTTTGCGTAGAATATTCTTCCGGGGACTGCTTTTTTGTACAAACTTGGTThis study Pc22g14600-3-fw GGGGACAGCTTTCTTGTACAAAGTGGGCCGATCCCATATAAACTCT This study Pc22g14600-3-rv TGAAACCAACGTTTATGCGGGGACAACTTTGTATAATAAAGTTGGTThis study
172 G ene inactiv ation and o ver expr ession o f puta tiv e β-lactam pr oduction r ela ted tr ansport er s in Penicillium c hry so genum SUPPorTING INForMaTIoN
Name Sequence (5→’3’) Reference Use
RV-Pc22g14600 pDON41 GGGGACAACTTTGTATAGAAAAGTTGC ATCGTCATGTCTCGTATATGA This Study
Clonin g O ver expr ession str ain FW-Pc22g14600 pDON41 GGGGACTGCTTTTTTGTACAAACTTGG GCTTTCAATATCGTGGTT This Study RV-Pc22g14600 pDON23 GGGGACAGCTTTCTTGTACAAAGTGGC
CATGGCGGAAACCAGCA This Study FW-Pc22g14600 pDON23 GGGGACAACTTTGTATAATAAAGTTGGT
TGAGGCATCCAGACCG This Study attB1AMDS FW-ALT2 CAAAAAAGCAGGCTCCTG This Study AMDS-pIPNS-RV GCAGACCAATGCAGCAGGCCCAGTATA
AGGATACCGCTCGTACCATGGGTTG This Study AMDS-pIPNS-FW CATACCACTCAACCCATGGTACGAGCG
GTATCCTTATACTGGGCCTGCTG This Study attB2 pIPNS RV-ALT1 GGGGACCACTTTGTACAAGAAAGCTGG
GTGCGTCTAGAAAAATAATGGTGA This Study attB1 FW-Adapter GGGGACAAGTTTGTACAAAAAAGCAGGCT This Study attB2 Rv-Adapter GGGGACCACTTTGTACAAGAAAGCTGGGT This Study 5Fw-Pc12g02880-Putative GCACGTATCGTATCATAGTGC This Study
Colon
y PCR
3Rv- Pc12g02880-Putative GGTATACACTGCAACCGATC This Study 5Fw-Pc13g12740-Putative GAATCGTGAACAATGAGAATC This Study 3Rv-Pc13g12740-Putative GAACGCAGTGGCAGTAAG This Study 5Fw-Pc20g07650-Putative GCTCAAATCTATCAGCAAGC This Study 3Rv- Pc20g07650-Putative GATACAGGTATGGAACGACG This Study 5Fw-Pc22g00380-Putative GTCGTAGTATCGCTCTTGTCC This Study 3Rv-Pc22g00380-Putative GTCTCTTCCTTGATCATCTGAT This Study 5Fw-Pc06g01070-Putative GTCGAGTTTGCGAATATCC This Study 3Rv- Pc06g01070-Putative GCACTTATGATCTGCATTAGC This Study 5Fw-Pc22g16370-Putative GTACGTGATAGGACCTATGCA This Study 3Rv- Pc22g16370-Putative GCATAATCGACTCTCCACTATC This Study 5Fw-Pc22g14600-Putative GGCATACAGAATATGTGACTCC This Study 3Rv-Pc22g14600- Putative GCTCAGTCCTAGAATGCTGT This Study 5’P-AMDS 1Fw GTCTTCTACGTCAAGACCTCTG This Study 5’P-AMDS 1Rv GGTACTCCATCTGGTAATTCC This Study 3’P-AMDS 1Fw GATCAACCTGCTGGATTTC This Study 3’P-AMDS 1Rv GTGCCGTTATACGTGTCTAGAC This Study 3FW-Pc12g02880-Sblot Opt1 GCAATATTGAAGGAGAGAGAATTTC This Study
Southern B lo t A naly sis
3RV-Pc12g02880-Sblot Opt1 GTATGACACCTCATAATGGTTGG This Study 3FW-Pc13g12740-Sblot Opt1 GATTGCATGGATGTATGCA This Study 3RV-Pc13g12740-Sblot Opt1 GCAATCACTATCTCCGAGAC This Study FW-Pc20g07650-Sblot Opt1 GATCAAATGTTGTAAGAGTCAAGG This Study 5RV-Pc20g07650-Sblot Opt1 CATAAAGCACATGTTGAGGTC This Study 5FW-Pc22g00380-Sblot Opt1 GACGAAGTTGGTCTCTTCGT This Study 5RV-Pc22g00380-Sblot Opt1 GAATACTTGTCTGTCGACAACTG This Study 5FW-Pc06g01070-Sblot Opt1 GATGTGGATTCGACTCCAC This Study 5RV-Pc06g01070-Sblot Opt1 CGGTCACATGTACTCACAGT This Study 5Fw-Pc22g14600-SBlot Opt2 GTTCGGAGCGTTTATCGA This Study 5Rv-Pc22g14600-SBlot Opt3 TGACCAAGTACTTTATCGCG This Study FW- Cassete OverExp Pc22g14600 GCTAATACAGTCGCAGAGGT This Study B-RV Pc22g14600 GACTTCTCGGAGCTGAGC This Study γ-actin gDNA_Fw TTCTTGGCCTCGAGTCTGGCGG (Nijland et al., 2010)
q-PCR
A
naly
sis
γ-actin gDNA_Rv GTGATCTCCTTCTGCATACGGTCG Nijland et al., 2010)
pcbAB_Fw CACTTGACGTTGCGCACCGGTC Nijland et al., 2010)
pcbAB_Rv CTGGTGGGTGAGAACCTGACAG Nijland et al., 2010)
pcbC_Fw AGGGTTACCTCGATATCGAGGCG Nijland et al., 2010)
pcbC_Rv GTCGCCGTACGAGATTGGCCG Nijland et al., 2010)
