UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl)
Translational studies in Zellweger spectrum disorders
Berendse, K.
Publication date
2016
Document Version
Final published version
Link to publication
Citation for published version (APA):
Berendse, K. (2016). Translational studies in Zellweger spectrum disorders.
General rights
It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons).
Disclaimer/Complaints regulations
If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible.
Chapter 4
The hypomorphic Pex1-G844D mouse: a model to
study hepatic disease in mild Zellweger spectrum
disorders
Kevin Berendse 1,2, Maxim Boek 1, Marion Gijbels 3, Nicole N. Van der Wel
4, Marius A. van den Bergh-Weerman 4, Abhijit Babaji Shinde 5, Bwee Tien
Poll-The 2, Myriam Baes 5, Ronald J.A. Wanders1, Hans R. Waterham1
1Laboratory Genetic Metabolic Diseases,
²Department of Paediatric Neurology, Emma Children’s Hospital &
4Department of Pathology, Academic Medical Centre, Amsterdam, The Netherlands. 3Department of Molecular Genetics, Cardiovascular Research Institute Maastricht, University
of Maastricht, The Netherlands.
5Department of Pharmaceutical and Pharmacological Sciences, Laboratory of Cell
Metabolism, University of Leuven, Belgium
4
Abstract
Introduction: Zellweger spectrum disorders (ZSDs) are autosomal recessive multisystemic diseases caused by a defective peroxisome biogenesis. They constitute a continuum from severe lethal to relatively milder clinical presentations in adulthood. In addition to neurological dysfunction of varying extent, liver disease is an important symptom of ZSDs. The underlying pathogenesis for the liver disease, however, is not fully understood. Here, we report the generation and characterization of hypomorphic Pex1-G844D mice, which are homozygous for the Pex1-p.G844D
variant, which is the equivalent of the most common variant found in patients with a mild ZSD.
Methods: After introducing the Pex1-G844D allele by knock-in, we characterized homozygous Pex1-G844D mice for survival, biochemical parameters, including peroxisomal and mitochondrial functions, organ histology, and developmental parameters.
Results: The first 20 post-natal days were found to be critical for survival of homozygous Pex1-G844D mice (±20% survival rate). This appeared to be due to cholestatic liver problems, liver dysfunction and malabsorption, most probably caused by defective bile acid biosynthesis. Survival beyond P20 was nearly 100%, but surviving mice showed a delay in growth and development. Furthermore, the homozygous Pex1-G844D mice showed similar hepatic problems as described for mild ZSD patients, including bile duct proliferation, liver fibrosis and mitochondrial alterations. Biochemical analyses revealed elevated levels of abnormal peroxisomal metabolites particularly in the liver.
Conclusion: Our results show that the homozygous Pex1-G844D mouse has a predominant liver phenotype and thus can be used to study hepatic pathology in peroxisome deficiency disorders. Moreover it provides an opportunity to test therapies aimed at resolving the liver disease in ZSDs.
Introduction
Peroxisomes play an important role in mammalian metabolism, including the α- and β-oxidation of specific fatty acids, and the synthesis of plasmalogens and bile acids. They are essential for human health and survival as the absence of functional peroxisomes results in a multi-system organ failure and death in the first year of life. A clinical entity first described as Zellweger syndrome (ZS, OMIM #601539) 1,
caused by mutations in PEX genes. In addition to peroxisomal dysfunction, ZS is also
associated with variable mitochondrial abnormalities, including altered morphology and function 234. Besides the severe ZS, mutations in any of the PEX genes may
also cause less severe phenotypes, including neonatal adrenoleukodystrophy (OMIM #214100) 5 and infantile Refsum disease (IRD, OMIM #266510) 6. Together
these entities constitute a continuous biochemical and clinical spectrum of disease severity, described as Zellweger spectrum disorders (ZSDs). Biochemically, ZSDs are characterized by aberrant metabolite levels reflecting peroxisomal dysfunction, including elevated levels of very long-chain fatty acids (VLCFAs), the bile acid precursors di- and trihydroxycholestanoic acid (DCHA and THCA), pristanic- and phytanic acid in plasma and decreased levels of plasmalogens and docosahexaenoic acid (DHA) in erythrocytes 7. In addition to the often progressive, neurological
dysfunction of varying extent, liver disease is a prominent symptom in ZSDs 38910.
The exact pathophysiological mechanism underlying the liver disease is unknown, but in vitro studies previously showed that the bile acid intermediates DHCA and
THCA, which accumulate in ZSDs, are considerably more toxic than the normal end products of bile acid synthesis cholic acid and chenodeoxycholic acid 11.
Several mouse models for ZSDs have been generated by deleting different Pex
genes, including Pex2 12, Pex5 13, Pex10 14, Pex11β15 and Pex13 16. Most of these
models, however, represent the severe ZS with mice dying within the first days after birth. More recently, mouse models with a milder phenotype or with organ-specific deletions were created 17181920.
We have generated a mouse model that is homozygous for the Pex1-p.G844D
allele, which is the equivalent of the most common mutant allele found in human ZSD patients, i.e. PEX1-p.G843D 21. Patients homozygous for this mutation have a
relatively mild phenotype and can survive into adulthood 22. We report the histological
and biochemical characterization of the homozygous Pex1-G844D mouse and
cultured mouse embryonic fibroblasts (MEFs). We found that most organs and MEFs are only mildly affected. However, the mice developed severe liver fibrosis, similar as observed in patients with a ZSD. The homozygous Pex1-G844D mouse
thus can be used to study the liver pathogenesis associated with ZSDs in more detail and can help to evaluate therapeutic strategies focused on preventing liver disease.
4
80 81
Methods
Generation of the Pex1-G844D mice
Pex1-G844D knock-in mice were generated by TaconicArtemis (Germany) in a pure C57BL/6N background. Briefly, a targeting vector with the c.2531G>A variant coding for the p.G844D amino acid substitution introduced in exon 15 and the Puromycin resistance PuroR gene flanked by FRT sites inserted into intron 15 of Pex1, was generated using BAC clones from the C57BL/6 RPCIB-731 BAC
library. After sequence confirmation, the targeting vector was transfected into the TaconicArtemis C57BL/6N Tac ES cell line and homologous recombinant clones were isolated using positive (Puro R) and negative (Thymidine kinase) selection. After FlpE-mediated removal of the PuroR gene, two confirmed ES clones were injected into C57BL/6N blastocysts for implantation. Chimaeras were crossed with FLP-deleter mice to remove the selection markers followed by confirmation of germline transmission. Once Flp recombination of Puro R and thymidine kinase was confirmed, the FlpE transgene was bred off in the Pex1-G844D line. By intercrossing heterozygous mice, homozygous Pex1-G844D mice were obtained whereas wild type littermates were used as controls. Genotyping was performed by PCR using primers: 4737_35: ACAGGTAGCATGAACTAGATCGAG and 4737_36: CATTTGAGGTCATGATATTGCTG to yield products of 283bp for the wild type and 358bp for the knock-in. Correct introduction of the G844D mutation in the PCR products was verified by Sanger sequencing. Because more females survived, all experiments were performed with female mice, unless stated otherwise.
Mouse breeding
Mice were maintained in the animal housing facility of the Academic Medical Centre at 21°C ±1°C, 40 –50% humidity, on a 12-h light-dark cycle, with ad libitum access to water and a standard rodent diet. All animal experiments were approved by the institutional review board for animal experiments of the Academic Medical Centre, University of Amsterdam (Amsterdam, The Netherlands) and were carried our according to national ethical guidelines. To promote survival of fragile homozygous Pex1-G844D pups, wild type and heterozygous littermates were removed from P3 to reach litters of a maximum of four pups. In addition, cages were provided with an electrical heating pad until weaning, plus Hydrogel and soft chow. Weaning of homozygous Pex1-G844D pups was postponed until approximately P40. Mice used for histological and/or biochemical analyses were sacrificed using a 1:1 mixture of CO2 and O2, followed by 100% CO2.
Generation and characterization of mouse embryonic fibroblasts
Mouse embryonic fibroblasts (MEFs) were isolated from E13 and E14 mice as previously described 23. To obtain stable cell lines, MEFs were “immortalized” to 3T3
cell lines 24. MEFs were maintained at 37°C in a humidified atmospheric environment
with 5% CO2, and cultured in 10% Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum, 25 mM HEPES buffer, 100 U/ml penicillin, 100 µg/ml streptomycin and amphotericin 250µg/ml. For analysis, cells were harvested using trypsin (0.5% trypsin-EDTA, Invitrogen), washed once with phosphate-buffered saline (PBS) (Fresensius Kabi Nederland B.V.) and twice with 9 g/L NaCl (Fresensius Kabi Nederland B.V). MEFs were used for catalase immunofluorescence microscopy 25, immunoblot analysis 26 and determination of
VLCFA profiles 27, peroxisomal α- and β-oxidation activity 2829 including incubation
with deuterium-labeled free 22,22,22-D3-docosanoic acid (D3-C22:0) 30 and
dihydroxyacetonephosphate-acyltransferase (DHAPAT) activity 31. Histochemical analyses
For histochemical analyses, skin, skeleton, brain, heart, lungs, spleen, stomach, intestine, liver, kidneys, pancreas and testis of sacrificed mice were fixed in 4% paraformaldehyde for 7 days. At least three mice were analysed for each experimental group. After fixation, the organ samples were dehydrated through a graded series of ethanol and embedded in paraffin. Skeletal tissues were first decalcified in a solution of 40 g NaOH in 173 ml formic acid and 827 ml distilled water for 7 days 32 prior to
graded series of ethanol. Oil Red O staining was performed on frozen liver sections, and histological stainings, including hematoxylin and eosin (H&E), Fouchet, Sirius Red and Periodic acid–Schiff, on paraffin sections by the Pathology Department of the Academic Medical Centre in Amsterdam, The Netherlands, according to in-house protocols. All images were captured with a Leica microscope and camera using Leica 4.1 software (Rijswijk, The Netherlands).
Immunofluorescence and immuno-EM analyses
Mice livers were collected, fixed in duplicate in 0.2M Pipes-Hepes-EGTA-MgCl2 (PHEM) buffer containing 4% paraformaldehyde either with or without 0.4% glutaraldehyde for 24 and 48 hours, respectively. Thereafter livers were embedded in gelatin, cryosectioned with a Leica FCS and trimmed using a diamond Cryotrim 90 knife (Diatome, Switzerland) at −100°C, and a Cryoimmuno knife (Diatome, Switzerland) at −120°C to generate ultrathin sections of 50 nm, as described previously 33. Immunogold labeling of the cryosections was performed using
4
USA). The antibody was labelled with rabbit anti-mouse bridging serum (DAKO) and protein-A conjugated to 15nm gold. All slides were examined with using a FEI Tecnai 12 transmission electron microscope.
Immunofluorescence microscopy using antibodies against catalase (map 17E10, own production) and PMP70 (C-terminal epitope, kind gift from Prof. Imanaka, Toyama, Japan) was performed as previously described 25 and examined with a
Leica TCS SP8 X Confocal Microscope.
Biochemical analyses
Peroxisomal parameters, including levels of VLCFAs, phytanic and pristanic acid
34, bile acids 35, poly-unsaturated fatty acids and plasmalogens (C16:0- and
C18:0-dimethyl acetal) 36 were determined in organs and/or plasma as previously
described. Bloodspots were collected from 0 and 5 days old mice on filter paper (Whatman 903, GE LifeScience) and C26:0-lysophosphatidylcholine was measured
37. Glucose was measured via a tail cut directly after sacrificing the mice. Activity of
mitochondrial complex I-IV, citrate synthase and glutamate dehydrogenase (GDH) were measured in liver homogenates (40 to 80mg) of 6 months old mice as described previously 18 38. Immunoblot analysis using antibodies against PEX1 (1:250, BD
Transduction laboratories, Franklin Lakes, New Jersey, USA) and peroxisomal thiolase (1:2000, ACAA1, Sigma-Aldrich, St Louis, Missouri, USA) was performed
as described elsewhere 26 39. Antigen-antibody complexes were visualized with
IRDye 800CW 1:10000 goat anti-rabbit and goat anti-mouse secondary antibodies, using the Odyssey Infrared Imaging System (LI-COR Biosciences, Nebraska, USA). Monoclonal α-tubulin antibody (1:10000 Sigma-Aldrich, St Louis, Missouri, USA) was used as a loading control and visualized with IRDye 680RD donkey anti-mouse secondary antibody.
Quantitative real-time RT-PCR
qRT-PCR was performed using an ABI PRISM 7500 Real Time PCR instrument (Applied Biosystems, Lennik, Belgium) as described previously 40. The relative
expression levels of the target genes were calculated as a ratio to the housekeeping gene β-actin.
Statistical analysis
For statistical analysis, two-tailed Student’s t-tests were performed using Graphpad,
software version 5.04, for Windows, GraphPad Software, La Jolla California USA, “www.graphpad.com”. P<0.05 was considered significant and for all experiments n=3 was used, unless stated otherwise.
Results
Generation of Pex1-G844D mice
In order to mimic the most common genotype of peroxisome biogenesis disorders, we introduced by knock-in, the p.G844D mutation in exon 15 of the Pex1 gene in
mice on a pure C57Bl/6N background. Routine genotyping of pups was performed by PCR analysis of genomic DNA using primers to amplify sequence-specific fragments of the wild type and Pex1-G844D alleles (figure 1A). As previously observed in human cells homozygous for the PEX1-p.G843D mutation 39, this
mutation still gives raise to considerable amounts of Pex1 protein in liver compared to wild type control mice (figure 1B).
Clinical phenotype of Pex1-G844D mice
Genotyping the offspring of intercrossed heterozygous Pex1-G844D mice at postnatal day 0-5 yielded 26%, 57%, and 17% of wild type, heterozygous and homozygous Pex1-G844D mice, respectively (n=487). At birth, no difference in size and weight between wild type, heterozygous and homozygous Pex1-G844D littermates was observed. However, at P3, the homozygous Pex1-G844D pups were clearly smaller, weighed less (figure 1C) and appeared hypotonic when compared to their wild type and heterozygous littermates, although they were found to have normal amounts of milk in their stomach. We determined body weight and growth of wild type and homozygous Pex1-G844D mice from birth until 100 days postnatally and found that both homozygous female and male Pex1-G844D mice showed a significant growth impairment, compared to wild type mice (figure 1D). We noted a critical phase in survival between day 0 and 20 days postnatal, in which 80% of the homozygous Pex1-G844D mice died (figure 1E). More females than males survived this critical phase. After the first 20 critical days, survival was 90% (n=10; one homozygous Pex1-G844D mice died of a natural cause at 187 days of age). The growth impairment of the homozygous Pex1-G844D mice remained evident throughout life, but they showed a similar growth pattern as wild type animals with a growth spurt between 20 and 50 days.
Interestingly, we found that plasma glucose levels in homozygous Pex1-G844D mice were markedly decreased at day 0 (mean: 0.7mmol/l versus 3.6mmol/l in heterozygous Pex1-G844D littermates; p=0.0015; n=3) and day 5 (mean: 2.5mmol/l versus 6.0mmol/l in wild type littermates; p=0.0002; n=3), indicating a hypoglycaemic state. In line with this, glycogen staining of livers of homozygous Pex1-G844D mice at day 0 using Periodic acid–Schiff revealed a marked absence of glycogen compared to wild type mice. Glycogen could be demonstrated in livers
4
84 85 (A) +/- +/+ -/-358 bp 283 bp WT Targetede14 e15 e16
P35 P36 283 bp
e14 e15 e16
P35 P36 358 bp PM FRT (C) Day 3 Day 15 WT Pex1-G844D WT Pex1-G844D (D) Age (days) W ei gh t ( gr am ) 10 20 30 40 50 60 70 80 90 100 0 10 20 30 Pex1-G844D WT (E) Pex1-G844D WT Age (days) Pe rc en t s ur vi va l 10 20 30 40 50 0 20 40 60 80 100 (B) Pex1-G844D WT ZS IRD C Pex1 Tubuline
Figure 1(A) Schematic representation of the targeting of Pex1. Wild type locus (top) and targeting
allele (below), and PCR genotyping results. PCR amplification results in a 283p product of the wild type allele and a 358bp product of the targeted allele (=Pex1-G844D). (B) Western blot analysis of total mice liver homogenates (25µg of protein) from 6 months old wild type and homozygous Pex1-G844D mice and, as controls, human skin fibroblasts (50µg of protein) using anti-Pex1 antibody. Tubulin was used as a loading control. ZS, skin fibroblasts from a severe Zellweger syndrome patient (=severe phenotype); IRD, skin fibroblasts from an infantile Refsum patient homozygous for PEX1-p.G843D; C, human control skin fibroblasts. (C) Pex1-G844D mice displayed growth retardation starting at 3 days postnatal. (D) Individual growth curves of wild type and homozygous Pex1-G844D mice from 3 days to 100 days postnatal (both females and males combined). PM, point mutation
of homozygous Pex1-G844D mice at day 10, 15 and 3 months, but the intensity of staining was less than in wild type mice of the same age (data not shown, n=3). Surprisingly, we observed that homozygous Pex1-G844D males were fertile (n=4), albeit delayed. They were able to produce offspring with heterozygous females after approximately 5 months of age. Because Pex1-G884D females were very fragile and underweight, they were not used for breeding. Information regarding fertility of female mice is therefore unknown.
Analysis of mouse embryonic fibroblasts
MEFs of wild type and homozygous Pex1-G844D mice were used for analysis of peroxisomal parameters. The activity of dihydroxyacetonephosphate-acyltransferase, a peroxisomal enzyme involved in plasmalogen synthesis, was decreased in homozygous Pex1-G844D compared to wild type MEFs (figure 2A). No differences between homozygous Pex1-G844D and wild type MEFs could be observed in the β-oxidation rates of C16:0 or C26:0 fatty acids (figure 2B/C), but the
β-oxidation rate of pristanic acid was decreased in the homozygous Pex1-G844D MEFs. Incubation of the MEFs with deuterium labelled C22:0 (=D3-C22:0) showed normal absolute levels of D3-C26:0, reflecting elongation (not shown), but the ratio of D3-C26:0/D3-C16:0 (i.e. elongation/peroxisomal degradation) was significantly increased in homozygous Pex1-G844D compared to wild type MEFs, indicating an impairment in peroxisomal β-oxidation (figure 2E). The C26:0/C22:0 ratio was similar for wild type and homozygous Pex1-G844D MEFs when cultured at 37°C, but were clearly different after growth of the cells at 40°C (figure 2F), a condition at which the cells lose functional peroxisomes, similar as previously reported for skin fibroblasts of PEX1-p.G843D patients 41 .
The PEX1-p.G843D mutation in human cells is associated with a phenomenon
called peroxisomal mosaicism, in which some cells still contain functional peroxisomes whereas others do not 41. Cells without functional peroxisomes still
contain peroxisomal vesicles containing peroxisomal membrane proteins but lack matrix proteins. To determine whether this peroxisomal mosaicism also occurs in the homozygous Pex1-G844D MEFs, we incubated these with antibodies against the peroxisomal matrix protein catalase and the peroxisomal membrane protein PMP70, followed by immunofluorescence. The majority of cells contained both catalase- and PMP70-positive peroxisomes, while a minor portion showed catalase-deficient but PMP70-positive peroxisomal vesicles, indicating peroxisomal mosaicism similar as observed for human patient skin fibroblasts (figure 2G). When the MEFs were cultured at 40°C, an increase in catalase-deficient cells was observed (data not shown).
4
Substrate: C16:0 pm ol /(h r.m g) WT Pex1-G844D 0 5000 10000 15000 20000 25000 Substrate: C26:0 pm ol /(h r.m g) WT Pex1-G844D 0 500 10001500 Substrate: Pristanic acid
WT Pex1-G844D 0 500 1000 1500 * DHAPAT activity pm ol /(h r.m g) 0 5 10 15 20 * Fo ld in cr ea se WT Pex1-G844D 0.0 0.5 1.0 1.5 2.0 2.5Ratio C26:0/C22:0, 40°C versus 37°C** D 3-C 26 :0 /D 3-C 16 :0 WT Pex1-G844D 0 1 2 3 * (A) (D) (C) (B) (E) (F) Pex1-G844D WT Deuterium labeled (D3)-C22:0 PEX1-G844DPex1-G844D WT ZS C DHAPAT activity pm ol /(h r.m g) 0 5 10 15 20 * (A) Pex1-G844D WT Substrate: C16:0 pm ol /(h r.m g) WT Pex1-G844D 0 5000 10000 15000 20000 25000 Substrate: C26:0 pm ol /(h r.m g) WT Pex1-G844D 0 500 1000 1500 (B) (C)
Substrate: Pristanic acid
pm ol /(h r.m g) WT Pex1-G844D 0 500 1000 1500 * (D) Fo ld in cr ea se WT Pex1-G844D 0.0 0.5 1.0 1.5 2.0 2.5Ratio C26:0/C22:0, 40°C versus 37°C** (F) D 3-C 26 :0 /D 3-C 16 :0 WT Pex1-G844D 0 1 2 3 *
(E) Deuterium labeled (D3)-C22:0
Figure 2Characterization of wild type and homozygous Pex1-G844D MEFs (n=3). (A) Activity of
the peroxisomal enzyme dihydroxyacetonephosphate-acyltransferase (DHAPAT). To test peroxisomal β-oxidation, MEFs were incubated with (B) C16:0, (C) C26:0 or (D) pristanic acid as a substrate. (E) Ratio of deuterium labelled (D3) C26:0 over C16:0 (i.e. elongation over peroxisomal degradation), after 72 hours incubation with D3-C22:0. (F) Fold increase of the ratio C26:0/C22:0 after culturing of MEFs at 40°C vs 37°C. (G) Merged immunofluorescence microscopy image of Pex1-G844D MEFs cultured at 37°C and stained with antibodies against the peroxisomal matrix protein catalase (green) and the peroxisomal membrane protein PMP70 (red). (H) Western blot analysis of homogenates (50µg of protein) of Pex1-G844D (n=3) and wild type (n=2) MEFs cultured at 37°C and 40°C and human skin fibroblasts cultured at 37°C using a peroxisomal thiolase antibody. Tubulin was used as equal loading control. ZS, fibroblasts from severe Zellweger syndrome patient; C, human control fibroblasts. All values are shown as mean ±SD
Because the peroxisomal matrix enzyme thiolase is processed from a 44-kDa precursor form to a 41-kDa mature form by the peroxisomal matrix enzyme TYSND1 after its import into peroxisomes 42, this processing can be used as a measure for
functional (i.e. protein import-competent) peroxisomes. Thiolase processing was examined by immunoblot analysis of MEFs cultured at 37°C and 40°C (figure 1H). Compared to wild type MEFs, the amount of processed thiolase (41-kDa) was less intense and a weak 44-kDa band could be observed at 37°C in the homozygous
Pex1-G844D MEFs. After culturing of the MEFs at 40°C, thiolase processing was impaired in the homozygous Pex1-G844D but not in wild type MEFs. These observations are consistent with results in skin fibroblasts of PEX1-p.G843D
patients.
Metabolite analysis of Pex1-G844D mice
Because we observed a critical survival phase between 0 and 20 days, we performed detailed metabolite analysis of liver (Figure 3) and brain, heart, kidney, spleen and plasma (table 1) of homozygous Pex1-G844D and wild type mice aged 0, 5, 10, 15 days, and 3 and 6 months . In summary, we found markedly elevated levels of C26:0-lysophosphatidylcholine (C26:0-lysoPC) in blood spots from the Pex1-G844D mice at day 0. The levels of C26:0 VLCFAs were elevated in liver of the Pex1-G844D mice at all ages, in brain at day 10, and spleen at day 15 and 3 months. Plasmalogen levels were normal in the majority of organs at different ages. The poly-unsaturated fatty acid docosahexaenoic acid (DHA) was reduced at day 10 in all organs, but this did not reach statistical significance in liver. In the mice that survived into adulthood, DHA levels were still decreased in some organs of the Pex1-G844D mice (e.g. spleen and heart at 6 months). The bile acid profile was determined in liver and plasma during the lactation period whereas in adulthood also some other organs were analysed. Overall, mature C24-bile acids were reduced concomitant with an increase in C27-bile acid intermediates, in line with a defective peroxisomal β-oxidation. Tauro-conjugated C24-bile acids (the sum of cholic acid, chenodeoxycholic acid, deoxycholic acid, muricholic acid and ursodeoxycholic acid), the most commonly occurring bile acid species in wild type mice, were markedly decreased in liver during the lactation period but this did not reach significance in adulthood. Likewise, in plasma levels of tauro-C24 were reduced in P10 but not in adult mice. Levels of total unconjugated C24-bile acids were twofold increased at day 0 in liver but were similar in mutants and controls at later ages and also the immature C27-bile acids (i.e. sum of DHCA, OH-THCA and THCA) were barely detectable in liver of wild type mice, but were markedly increased in Pex1-G844D mice. Normally, bile acids are conjugated via the peroxisomal enzyme bile acid-coenzyme A: amino acid N-acyl transferase (BAAT) 43. Similar to patients with a ZSD 44, the C
27-bile
acids in Pex1-G844D mice primarily occurred in the unconjugated form, due to a deficiency in peroxisomal BAAT. These potentially toxic unconjugated C27-bile acid intermediates were also increased in plasma, spleen, heart and kidney but not detectable in brain. The branched-chain fatty acids pristanic and phytanic acid accumulated in liver of 3- (mean: 0.12 and 0.23 µmol/gr protein) and 6-months old (mean: 0.22 and 0.39 µmol/gr protein) Pex1-G844D mice whereas they were undetectable in livers of 3 months old wild type mice. Only in wild type livers of 6 months old mice, small amounts of phytanic acid could be measured (mean: 0.016
4
88 89 Rat io % C 26 :0 /C 22 :0 Ag e D ay 0 D ay 5 D ay 1 0 D ay 1 5 3 M on th s 6 M on th s 0. 0 0. 1 0. 2 0. 3 0. 4 0. 5 D H A Age nm ol/m g p rot ein D ay 0 D ay 5 D ay 1 0 D ay 1 5 3 M on th s 6 M on th s 0 20 40 60 80 10 0 C24 C27 Pl as m al og en s Bile acids PUFA VLCFA **** * *** ** * ** **** * *** ** ** ** *** ** *** * W T P e x1-G844D W T Pex1 -G844D D ay 0 D ay 5 D ay 1 0 D ay 1 5 3 M on th s 6 M on th s 0 75 15 0 22 5 30 0 37 5 45 0 50 0 10 00 15 00 20 00 25 00 Ag e * ** ** ** * pm ol/m g p rot ein D ay 0 D ay 5 D ay 1 0 D ay 1 5 3 M on th s 6 M on th s 0 15 30 45 15 0 20 0 25 0 30 0 35 0 40 0 Ag e Rat io % D ay 0 D ay 5 D ay 1 0 D ay 1 5 3 M on th s 6 M on th s 0 1 2 3 C16 DMA/C16:0 Pe x1-G844D C16 DMA/C16:0 WT C18 DMA/C18:0 Pe x1-G844D C18 DMA/C18:0 WT Ag e (A) (B) (C) (D) Un co nj ug at ed B A Pex1-G844D Un co nj ug at ed B A W T Ta ur o-co nj ug at ed B A Pex1-G844D Ta ur o-co nj ug at ed B A W T pm ol/m g p rot ein Figur e 3Results of metabolite analysis of liver homogenates of wild type and homozygous Pex1-G844D mice (n=3). (A) VLCF
A C26:0/C22:0
ratio in liver
. (B) Levels of the poly-unsaturated fatty acid docosahexaenoic acid (DHA). (C) Levels of unconjugated and taur
o-conjugated C24-
and C27-bile acids. C24-bile acids ar
e the sum of cholic acid, chenodeoxycholic acid, dexoycholic acid, muricholic acid and ursodeoxycholic
acid. C27-bile acids ar
e the sum of dihydr
oxycholestanoic acid, trihydr
oxycholestanoic acid and tetrahydr
oxycholestanoic acid. (D)
Plasmalogens C16DMA/C16:0 and C18DMA/C18:0 levels in liver
. DMA, dimethyl acetal; BA, bile acids. All values ar
e shown as mean ±SD. *P < 0.05, **P < 0.01, ***P <0.001, ****P<0.0001 PUF A (DHA) Day 0 Day 5 Day 10 Day 15 3 months 6 months Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Brain 24.3 (3.4) 22.4 (9.3) 0,691 40.3 (4.1) 39.1 (2.7) 0,693 34.7 (6.9) 48.3 (4.5) 0,046 28.9 (16.2) 72.5 (10.7) 0,004 92.2 (37.6) 116.3 (25.3) 0,410 109.0 (10.8) 119.3 (6.8) 0,210 Spleen nm nm 3.25 (0.6) 11.1 (6.0) 0,179 3.6 (0.6) 7 (1.1) 0,032 3.7 (1.3) 11.5 (1.7) 0,003 9,1 4,5 8.3 (4.4) 14.2 (1.6) 0,012 Heart 11.3 (0.6) 9.6 (2.2) 0,183 19.2 (3.1) 23.5 (2.1) 0,151 9.2 (2.7) 31.3 (2.9) 0,001 12.9 (4.8) 22.7 (13.0) 0,284 57.7 (7.8) 81.2 (20.6) 0,237 40.6 (4.3) 61.9 (14.7) 0,037 Kidney 12.2 (3.3) 12.0 (1.8) 0,940 15.7 (3.1) 21.4 (5.3) 0,181 17.6 (1.2) 23.1 (1.8) 0,012 23.6 (7.6) 49.3 (44.1) 0,376 33.5 (12.9) 44.2 (5.6) 0,258 31.0 (8.1) 52.0 (10.8) 0,031 VLCF A (C26:0/C22:0) Day 0 Day 5 Day 10 Day 15 3 months 6 months Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Brain 0.18 (0.04) 0.11 (0.03) 0,014 0.15 (0.03) 0.15 (0.05) 0,865 0.15 (0.07) 0.13 (0.00) 0,619 0.32 (0.2) 0.08 (0.05) 0,229 0.04 (0.01) 0.04 (0.01) 0,805 0.03 (0.01) 0.02 (0.01) 0,406 Spleen nm nm 0.19 (0.00) 0.10 (0.01) 0,001 0.15 (0.04) 0.08 (0.01) 0,066 0.26 (0.08) 0.05 (0.01) 0,012 nm 0.05 (0.00) 0.27 (0.07) 0.07 (0.03) 0,005 Heart 0.15 (0.04) 0.07 (0.01) 0,013 0.08 (0.01) 0.22 (0.2) 0,484 0.07 (0.01) 0.06 (0.01) 0,078 0.07 (0.01) 0.08 (0.05) 0,786 0.06 (0.01) 0.03 (0.00) 0,003 0.04 (0.01) 0.03 (0.00) 0,458 Kidney 0.08 (0.02) 0.09 (0.07) 0,947 0.03 (0.00) 0.02 (0.00) 0,030 0.04 (0.02) 0.02 (0.01) 0,226 0.06 (0.03) 0.01 (0.00) 0,070 0.04 (0.02) 0.02 (0.00) 0,207 0.03 (0.02) 0.02 (0.01) 0,492 Table 1
Results of biochemical analysis in brain, spleen, heart and kidney homogenates and plasma of wild type and homozygous Pex1-G8
44D mice
(n=3), except for some data of spleen of 3 months old mice (n=1). Because of the small size of the spleen, some metabolites c
ould not be determined
at certain ages. Concentrations of DHA ar
e stated in nmol/mg pr
otein, VLCF
A in µmol/gr pr
otein, plasmalogens in ratio, bile acids in pmol/mg pr
otein
in organs and µmol/l in plasma, and C26:0-lysoPC in nmol/l. All values ar
e shown as mean, SD is give between brackets and significant p values
(<0.05) ar
e displayed in
red.
nd= not detected, nm= not measur
4
VLCF A (C26:0) Day 0 Day 5 Day 10 Day 15 3 months 6 months Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value 0.02 (0.01) 0.02 (0.00) 0,095 0.02 (0.00) 0.02 (0.00) 0,519 0.04 (0.01) 0.02 (0.00) 0,003 0.08 (0.06) 0.05 (0.00) 0,530 0.07 (0.06) 0.03 (0.01) 0,293 0.04 (0.04) 0.04 (0.03) 0,887 nm nm 0.03 (0.00) 0.02 (0.00) 0,058 0.04 (0.01) 0.02 (0.00) 0,071 0.09 (0.04) 0.02 (0.00) 0,045 nm nm 0.13 (0.02) 0.05 (0.03) 0,005 0.04 (0.02) 0.02 (0.00) 0,087 0.02 (0.00) 0.06 (0.06) 0,434 0.01 (0.00) 0.02 (0.00) 0,158 0.01 (0.00) 0.01 (0.00) 1,000 0.03 (0.02) 0.01 (0.00) 0,322 0.02 (0.01) 0.01 (0.00) 0,305 0.04 (0.04) 0.04 (0.02) 1,000 0.02 (0.00) 0.02 (0.00) 0,219 0.03 (0.02) 0.02 (0.00) 0,270 0.09 (0.08) 0.04 (0.02) 0,288 0.07 (0.04) 0.03 (0.01) 0,176 0.07 (0.05) 0.05 (0.03) 0,653 0.31 (0.06) 0.06 (0.04) 0,000 0.12 (0.05) 0.03 (0.01) 0,038 0.06 (0.00) 0.03 (0.00) 0,000 0.07 (0.01) 0.04 (0.01) 0,010 0.09 (0.01) 0.02 (0.00) 0,001 0.09 (0.01) 0.01 (0.00) 0,000 Plasmalogens (C16 DMA/C16:0) Day 0 Day 5 Day 10 Day 15 3 months 6 months Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value 5.9 (0.6) 5.5 (0.2) 0,294 5.2 (0.3) 5.8 (0.1) 0,021 6.0 (1.2) 5.8 (0.4) 0,837 6.2 (0.9) 7.7 (1.0) 0,170 8.0 (4.8) 7.8 (0.4) 0,881 6.8 (0.7) 7.4 (0.6) 0,298 nm nm 5.15 (1.3) 4.8 (1.7) 0,719 6.0 (1.1) 7.6 (1.2) 0,239 6.1 (0.4) 7.0 (1.0) 0,245 7,3 6,7 5.3 (2.8) 4.8 (3.2) 0,837 11.5 (0.5) 11.6 (1.2) 0,970 8.0 (1.0) 5.2 (0.6) 0,645 7.3 (0.9) 8.4 (0.9) 0,192 7.4 (3.6) 10.3 (1.3) 0,251 6.7 (7.2) 12.8 (1.2) 0,591 7.1 (3.1) 8.4 (0.8) 0,530 5.8 (0.4) 5.8 (0.5) 1,000 6.2 (1.0) 4.1 (1.1) 0,076 4.7 (0.5) 4.1 (2.1) 0,667 6.1 (1.8) 3.6 (1.5) 0,137 2.1 (1.5) 5.0 (1.6) 0,085 2.4 (2.0) 1.9 (1.3) 0,723 Continued Plasmalogens (C18 DMA/C18:0) Day 0 Day 5 Day 10 Day 15 3 months 6 months Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value 6.0 (0.7) 6.6 (0.4) 0,182 7.2 (0.8) 7.8 (1.2) 0,502 8.5 (1.2) 6.9 (0.9) 0,135 8.4 (1.4) 9.5 (2.4) 0,519 19.2 (11.3) 15.7 (2.7) 0,283 15.3 (2.1) 16.6 (4.4) 0,619 nm nm 3.7 (0.9) 3.7 (0.6) 0,425 4.1 (1.3) 5.2 (0.4) 0,365 4.4 (0.4) 5.4 (1.1) 0,229 5,9 5,8 5.2 (2.6) 4.5 (1.7) 0,585 2.9 (0.2) 3.2 (0.5) 0,310 2.0 (0.5) 1.8 (0.2) 0,220 1.3 (0.2) 1.3 (0.1) 0,768 1.3 (0.3) 1.4 (0.1) 0,442 2.7 (1.5) 5.7 (0.3) 0,357 3.4 (0.3) 4.6 (0.3) 0,002 6.0 (0.7) 6.3 (0.5) 0,545 6.6 (3.8) 6.3 (0.5) 0,464 5.9 (0.2) 7.0 (0.6) 0,048 5.3 (0.4) 6.5 (1.5) 0,245 3.4 (1.80 6.5 (0.4) 0,044 3.7 (1.4) 5.6 (3.2) 0,133 Unconjugated C 24 -bile acids Day 0 Day 5 Day 10 Day 15 3 months 6 months Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value nd nd nd nd nd nd nd nd nd nd nd nd nm nm nm nm nm nm nm nm nm nm 7.80 (5.09) 2.17 (2.31) 0,139 nm nm nm nm nm nm nm nm 6.0 (6.8) 77.0 (118) 0,357 nm nm nm nm nm nm nm nm nm nm 3.47 (4.23) 15.05 (18.9) 0,360 35.60 (30.29) 2.43 (2.43) 0,124 nm nm nm nm 0.08 (0.03) 0.06 (0.00) 0,392 nm nm 1.79 (1.22) 1.13 (0.93) 0,493 4.55 (4.60) 0.63 (0.32) 0,210 Continued4
92 93 Taur o-conjugated C 24 -bile acids Day 0 Day 5 Day 10 Day 15 3 months 6 months Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Brain nd nd nd nd nd nd nd nd nd nd nd nd Spleen nm nm nm nm nm nm nm nm nm nm 5.54 (8.71) 47.83 (62.7) 0,227 Heart nm nm nm nm nm nm nm nm 17.1 (6.9) 14.6 (12.8) 0,783 nm nm Kidney nm nm nm nm nm nm nm nm 45.32 (22.7) 22.5 (22.8) 0,287 23.94 (12.58) 73.25 (95.9) 0,341 Plasma nm nm nm nm 0.95 (0.59) 8.44 (1.57) 0,013 nm nm 6.93 (8.84) 3.42 (3.11) 0,552 4.43 (4.16) 1.53 (1.69) 0,314 Unconjugated C 27 -bile acids Day 0 Day 5 Day 10 Day 15 3 months 6 months Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Brain nd nd nd nd nd nd nd nd nd nd nd nd Spleen nm nm nm nm nm nm nm nm nm nm 13.41 (7.95) nd 0,036 Heart nm nm nm nm nm nm nm nm 30.7 (11.5) nd 0,010 nm nm Kidney nm nm nm nm nm nm nm nm 57.1 (21.4) nd 0,010 52.71 (24.5) nd 0,015 Plasma nm nm nm nm 1.80 (0.56) 0.34 (0.11) 0,040 nm nm 17.52 (5.13) 0.23 (0.02) 0,004 20.41 (7.69) 0.44 (0.05) 0,007 Table 1 Continued Taur o-conjugated C 27 -bile acids Day 0 Day 5 Day 10 Day 15 3 months 6 months Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Pex1- G844D WT p-value Brain nd nd nd nd nd nd nd nd nd nd nd nd Spleen nm nm nm nm nm nm nm nm nm nm nd nd Heart nm nm nm nm nm nm nm nm nd nd nm nm Kidney nm nm nm nm nm nm nm nm nd nd nd nd Plasma nm nm nm nm nd nd nm nm nd nd nd nd VLCF A (C26:0-lysoPC) Day 0 Pex1- G844D WT p-value Bloodspot 1458 (340) 87 (22) 0,000 Table 1 Continued4
µmol/gr protein). When organs of 15 days old Pex1-G844D mice were examined for the ability to process peroxisomal thiolase, we observed a complete absence of processed thiolase (i.e. 41-kDa) in liver while in spleen, heart, kidney and brain a weak band could be observed (data now shown, n=2).
Macroscopic and microscopic analyses of Pex1-G844D mice
For histological analysis we used tissues from mice aged 0, 5, 10 and 15 days, 3 and 6 months. After sacrificing the mice, all organs were examined macroscopically, and microscopically with hematoxylin and eosin (H&E) staining.
Macroscopic examinations revealed hepatomegaly in homozygous Pex1-G844D mice at 3 months of age and even more pronounced at 6 months (figure 4A, B). In addition, nearly all homozygous Pex1-G844D mice showed unilateral hydronephrosis at all ages.
No major defects in the skin, skeleton, brain, heart, lungs, spleen, stomach, intestine, pancreas and testis were found upon gross microscopic examination. Microscopic analysis revealed the presence of venous vascular wall inflammation, intravascular coagulation, the formation of thrombi with complete occlusion of the veins at different sites of the body in the homozygous Pex1-G844D at different ages (figure 4G). H&E sections of livers from 15 days old homozygous Pex1-G844D mice showed many inflammatory cells, single cell necrosis and bile duct proliferation (figure 4C). The livers of 3 months old Pex1-G844D mice showed early stages of cellular dysplasia while the 6 months old mice showed a transition of normal hepatocytes to a focus of cellular alternation with increased nucleus-cytoplasm ratio (i.e. hepatic adenoma). Furthermore, we observed accumulation of small vesicles at 3/6 months, which by Oil Red O staining were shown to be composed of triglycerides/cholesterol esters (figure 4F). Positive Fouchet staining revealed the accumulation of bile pigment in livers of Pex1-G844D mice at day 0 (figure 4E), whereas this was not found at later ages. Sirius Red staining, used to determine liver fibrosis, was positive in Pex1-G844D livers of 3 months old mice which became more pronounced at 6 months of age (figure 4D).
Because most biochemical/histological abnormalities were found in the liver of the homozygous Pex1-G844D mice and previously reported PEX mice 16 38 45 and
because Zellweger spectrum patients 3 have an altered mitochondrial morphology,
we performed electron microscopy analysis on livers of 5 days old Pex1-G844D mice. As shown in figure 5A, no morphologically recognizable peroxisomes were observed in the Pex1-G844D livers, although they contained tiny vesicles (black arrows), which may represent microperoxisomes. In addition, we observed aberrant mitochondria such as swollen mitochondria with abnormal cristae in the
Age
Day 0 Day 5 Day 15 3 months 6 months 0 5 10 15 ** ** * Liver weight WT Pex1-G844D (F) PEX1-G844D (A) (B) (C) (D) (E) (F) Pex1-G844D WT WT WT Pex1-G844D Pex1-G844D Pex1-G844D Birth 3 Months 3 Months 6 Months 15 days 3 Months 6 Months (G) Pex1-G844D
Figure 4 Light-microscopy images of liver sections of wild type and homozygous Pex1-G844D mice. (A) Gross anatomy of formalin-fixed livers of 6 months old mice. (B) Percentage liver of total body weight at different ages. (C) H&E staining (bars 50µm). Wild type 3 months: Normal hepatic architecture with components of basic liver lobules, with portal area and central venule. Pex1-G844D 15 days: Change in liver morphology with a lack of portal triads, inflammatory processes (black arrows), single cell necrosis (red arrow) and bile duct proliferation. Pex1-G844D 3 months: Inflammatory processes (black arrows), single cell necrosis (dashed arrows) with early stage of liver cell dysplasia (upper part) and large necrotic process (astrix). Pex1-G844D 6 months: Transition of normal hepatocytes to a focus of cellular alternation with increased nucleus-cytoplasma ratio. (D) Development of hepatic fibrosis in 3 and 6 months old Pex1-G844D mice as illustrated by positive Sirius Red staining (black arrows). (E) Positive Fouchet staining in livers of Pex1-G844D mice at birth showed clear accumulation of bile pigment (black arrows). (F) More pronounced Oil Red O staining in Pex1-G844D of 3 months old mice (n=2). Wild type (n=1) and Pex1-G844D heterozygotes (n=2) were used as a control (bars 20µm). (G) Venous vascular wall inflammation and intravascular coagulation with complete occlusion of the vein in a cross section of spine from a 3 months old Pex1-G844D mice. Image is representative for other intravascular coagulation at different sites of the body, such as hepatic veins. All images, except for (F) and (G), are representative of 3 mice per genotype
4
96 97
Pex1-G844D mice that were not observed in wild type mice of the same age. To determine if the tiny vesicles represented functional microperoxisomes that were still able to import matrix proteins, we performed immunogold labelling with antibodies against peroxisomal thiolase. No gold particles could be found within these vesicles, in contrast to peroxisomes in livers of wild type mice (figure 5B). Labelling of peroxisomes with antibodies against peroxisomal membrane proteins was not successful (data not shown).
Pex1-G844D WT (A) (B) M P ER ER P M M M ER ER
Figure 5 Electron micrograph images of liver sections of 5 days old wild type and homozygous Pex1-G844D mice. (A) Tissue embedded in epon 812. Note the absence of identifiable peroxisomes (P), the presence of multiple tiny vesicles (black arrows) and abnormal mitochondria (M) in the Pex1-G844D liver in contrast to wild type. (B) Immunogold labelling with peroxisomal thiolase. Multiple gold particles are located in peroxisomes of wild type liver but absent in liver of the Pex1-G844D mice. ER, endoplasmic reticulum. Scale bars 1µm (A and B-Pex1G844D) and 500nm (B-WT)
Activity of mitochondrial complexes
Because other PEX mouse models with a severe phenotype showed a similar
abnormal mitochondrial morphology as observed in the Pex1-G844D mice, as
well as mitochondrial dysfunction 38, we measured some mitochondrial enzymatic
activities. The activity levels of the mitochondrial matrix enzymes, citrate synthase (not shown) and glutamate dehydrogenase (figure 6B), were unchanged. This is in line with preserved mitochondrial β-oxidation of palmitate (figure 2B). In contrast, a selective decrease of the activity of complexes of the respiratory chain residing in the inner membrane was found. Similar to findings in Pex5 knockout livers, complex
I and complex III were impaired whereas complex II and IV were unaffected in livers of Pex1-G844D mice. (figure 6A). These data corroborates the notion that primary peroxisomal dysfunction perturbs the structure and function of the inner mitochondrial membrane. Complex C I/C S ra tio I II III IV 0 1 2 3 4 Pex1-G844D WT **** ** GDH U /m g of p ro te in 0 10 20 30 (A) (B) (C) Pex1-G844D WT Pex1-G844D WT m R N A ex pr es si on (f ol d ch an ge ) 0 1 2 3 4 5 10 15 20 25
CD36 Acot1 Cpt1bCYP4A10 c-myc PCG-1α
* *
*
Figure 6 Mitochondrial function in liver homogenates of 6 months old mice . (A) Activities of the respiratory chain complexes were expressed as relative to the activity of citrate synthase (CS) in order to correct for the recovery of mitochondria. (B) Activity measurement of glutamate dehydrogenase (GDH). (C) qRT-PCR analysis of regulators of mitochondrial biogenesis and PPARα target genes. All values are shown as mean ±SD. *P <0.05, **P <0.01, ****P < 0.0001
4
Transcriptional changes
In other Pex knockout models, it was previously shown that the inactivity of
peroxisomal β-oxidation can give rise to the accumulation of ligands that activate PPARα4647. Several established PPARα target genes were also strongly elevated in
Pex1-G844D mice including Acot1, CPT1b and c-myc (a regulator of mitochondrial biogenesis and proto-oncogene) but, surprisingly, others such as CYP4A10 and CD36 were unaltered (figure 6C). The aberrant mitochondrial morphology and proliferation in hepatocyte-specific Pex5 knockout mice, was previously shown to
be accompanied with a reduced expression of PGC-1α, the master regulator of mitochondrial biogenesis. However, we did not observe such decrease in PGC-1α expression in the Pex1-G844D mice. These data indicate that besides several similarities, also differences in secondary changes occur in Pex deficient livers.
Discussion
We have generated and characterized a hypomorphic mouse model for ZSDs, containing a homozygous Pex1-p.G844D allele, which is the equivalent of the
most commonly found mutant allele in the human PEX1 gene 21. ZSD patients
homozygous for this PEX1-p.G843D allele present with a relatively mild phenotype,
characterized mainly by neurological abnormalities, developmental delay, visual and hearing impairment. Our studies revealed that the homozygous Pex1-G844D mutation in mice also allows survival into adulthood, provided that they overcome a critical phase during the lactation period. This is in contrast to several previously reported Pex knock-out mice, which showed severe early-lethal phenotypes.
We observed that at birth, wild type and Pex1-G844D littermates are indistinguishable in size and weight, suggesting normal embryonic development. However, after birth the Pex1-G844D mice displayed a clear delay in growth resulting in a marked difference in size observed from P3. The first 20 days of life appeared to be critical in the survival of Pex1-G844D mice, as 80% of the mice died before P20. Several causes may contribute to this high mortality rate. First, we noted that already few hours after birth the Pex1-G844D mice had very low plasma glucose levels and no glycogen stored in their livers, indicating a severe hypoglycemic state. Mitochondrial dysfunction, which we observed in the mice, could be responsible for these low glucose levels, since this may result in a higher demand of glucose via glycolysis, as hypothesized previously by Peeters et al 47. Second, due to hypotonia with
decreased motility, the Pex1-G844D mice may have difficulty in feeding, causing reduced food intake. Third, due to the absence of C24 bile acids, such as cholic acid, and the occurrence of liver cholestasis, the Pex1-G844D mice will have problems in degrading the fat that is present in the fatty mother milk, causing further
malabsorption 48. Finally, in some mice we observed venous thrombi, especially in
the liver, with complete occlusion of veins and intravascular wall inflammation, which may also be a cause of death. The formation of these venous thrombi could be a consequence of liver failure and subsequent disseminated intravascular coagulation
4950 and needs to be addressed in future studies. Notably beyond P20, when the
Pex1-G844D mice switch to normal chow, containing primarily carbohydrates, survival was nearly 100%.
Biochemically, we observed consistently elevated levels of C26:0 only in liver at all ages, while these levels fluctuated in kidney, spleen and heart. Also other peroxisomal metabolites fluctuated in liver, kidney, spleen and heart (table 1). Remarkably, the levels of C26:0, DHA and plasmalogens were normal in brain at most ages. This contrasts with findings in generalized Pex knockout mice (Pex2, Pex5 and Pex13) in
which reduced levels of plasmalogens were found in brain and liver 121316. Overall,
the most pronounced abnormal metabolites were the bile acids intermediates in all organs except brain, and C26:0-lysoPC in bloodspots. We also detected small amounts of accumulated phytanic and pristanic acid in livers of Pex1-G844D mice surviving ≥6 months.
The most prominent histological abnormalities were unilateral hydronephrosis observed in almost all mice analysed at the different ages and liver abnormalities, which were already present at birth. At later ages, the mice presented with hepatomegaly, bile duct proliferation with inflammation leading to liver fibrosis and even the formation of a hepatic adenoma in adulthood. The upregulation of c-myc could be responsible for the hepatomegaly, as suggested by Peeters et al 40. Surprisingly,
only a subset of PPARα target genes (Cpt1b, Acot1 and c-Myc) were induced in livers of 6 months old Pex1-G844D mice whereas others (CD36,CYP4A10) were normally expressed. Mice lacking fatty acyl-CoA oxidase (Acox) develop severe
microvesicular steatohepatitis with hepatomegaly and eventually focal hepatocellular regeneration, as a consequence of sustained activation of PPARα46. Notably, mice
deficient in both Acox and PPARα do not develop these liver abnormalities 51.
Electron microscopy (EM) studies in livers of 5 days old mice indicated a total absence of functional peroxisomes in the Pex1-G844Dlivers, as thiolase appeared not to be imported in peroxisomes. In MEFs from these mice, however, we observed peroxisomal mosaicism. This difference in peroxisomal phenotype between fibroblasts and liver EM studies, has also been reported previously for ZSD patients
52. In addition, we observed altered morphology of the mitochondria, including a
swollen appearance and loss of cristae, which is associated with altered activities of some mitochondrial complexes. Similar mitochondrial alterations were also reported in patients with Zellweger syndrome 34. The underlying cause of this mitochondrial
4
100 101
Recently, the generation and characterization of a genetically similar mouse model was reported 53. This mouse model showed several similarities to the here described
mouse model including, growth retardation, elevated C26:0-lysoPC in bloodspots and bile acid intermediates in liver and plasma, and bile duct proliferation on H&E liver histology at day 15. Overall, however, the previously described model appears to have a milder presentation than our model with a survival rate of 100% until P12. After P12, 20 out of 49 mice died with a median survival of 22 days. This could relate to the fact that our model is in a pure C57Bl/6N genetic background, whereas the previously reported model had a mixed genetic background.
When we compare our mice findings to those in human PEX1 patients, homozygous
for the PEX1-p.G843D mutation, some important similarities are noted. First, the
mice showed a critical survival phase and, when they survived this phase, they showed growth retardation. Failure to thrive is also an important clinical symptom in new-born ZSD babies. The mouse findings suggest that this might be related to low levels of glucose and absence of glycogen in the liver. As far as we know this has not been studied in patients. Second, it was recently shown that peroxisomal metabolites measured in plasma, may show marked fluctuations in mild human ZSD patients during life, with some patients even showing an almost completely normal biochemical profile 22. In the mice, we observed similar fluctuations at
the organ level. Third, similar to the findings in the MEFs, skin fibroblasts of mild ZSD patients may show peroxisomal mosaicism. When skin fibroblasts of PEX1
patients with peroxisomal mosaicism are cultured at 40°C, the peroxisomal defects become more evident 41, a phenomenon we also observed in the MEFs. Last,
besides neurological dysfunction, liver disease is an important aspect of the human disease 54. Liver cirrhosis has been described in ZS patients and even in young IRD
patients 8. Because we observed liver fibrosis in all mice after 3 months of age, it
could be important to regularly check mild patients reaching adolescence and/or adulthood for the development of liver fibrosis/hepatic adenoma, through Fibroscan measurements 55, a non-invasive method to determine the elasticity of the liver, or
through ultrasound.
In summary, the hypomorphic Pex1-G844D mouse model shows many aspects of disease observed in mild ZSD patients. This model can be used to study the pathogenesis, especially the liver phenotype in more detail and can be used to test newly developed therapies, such arginine 39, betaine 56 or cholic acid 57
supplementation. Further research has to be conducted to examine if these mice also develop neurological abnormalities, such as polyneuropathy and leukoencephalopathy.
Acknowledgements
We thank Merel Ebberink for helpful discussions and Petra Mooijer and Wicky Tigchelaar for valuable contribution to the paper. This work was supported by grants from foundation “Stichting Steun Emma” and “Metakids”, “Hersenstichting”, the Netherlands and partly supported by “The Royal Netherlands Academy of Arts and Sciences”, The Netherlands.
4
References
1. Opitz, J. M., ZuRhein, G. M., Vitale, L., Shahidi, N. T., Howe, J. J., Chou, S. M., Shanklin, D.
R., Sybers, H. D., Dood, A. R., Gerritsen, T. The Zellweger syndrome (cerebro-hepato-renal
syndrome). Birth Defects Orig. Art. Ser 2, 144–160 (1969).
2. Kelley, R. I. Review: the cerebrohepatorenal syndrome of Zellweger, morphologic and
metabolic aspects. Am. J. Med. Genet. 16, 503–17 (1983).
3. Goldfischer, S.,Moore, C. L.,Johnson, A. B.,Spiro, A. J.,Valsamis, M. P.,Wisniewski, H.
K.,Ritch, R. H.,Norton, W. T.,Rapin, I. & Gartner, L. M. Peroxisomal and Mitochondrial Defects
in the Cerebro-Hepato-Renal Syndrome. Science. 182, 62–64 (1973).
4. Salpietro, V.,Phadke, R.,Saggar, A.,Hargreaves, I. P.,Yates, R.,Fokoloros, C.,Mankad,
K.,Hertecant, J.,Ruggieri, M.,McCormick, D. & Kinali, M. Zellweger syndrome and secondary
mitochondrial myopathy. Eur. J. Pediatr. 174, 557–63 (2015).
5. Kelley, R. I.,Datta, N. S.,Dobyns, W. B.,Hajra, A. K.,Moser, A. B.,Noetzel, M. J.,Zackai, E.
H. & Moser, H. W. Neonatal adrenoleukodystrophy: new cases, biochemical studies, and
differentiation from Zellweger and related peroxisomal polydystrophy syndromes. Am. J. Med.
Genet. 23, 869–901 (1986).
6. Poll-The, B. T.,Saudubray, J. M.,Ogier, H. A.,Odièvre, M.,Scotto, J. M.,Monnens,
L.,Govaerts, L. C.,Roels, F.,Cornelis, A. & Schutgens, R. B. Infantile Refsum disease: an inherited peroxisomal disorder. Comparison with Zellweger syndrome and neonatal
adrenoleukodystrophy. Eur. J. Pediatr. 146, 477–83 (1987).
7. Braverman, N. E.,D’Agostino, M. D. & Maclean, G. E. Peroxisome biogenesis disorders:
Biological, clinical and pathophysiological perspectives. Dev. Disabil. Res. Rev. 17, 187–96
(2013).
8. Chow, C. W.,Poulos, A.,Fellenberg, A. J.,Christodoulou, J. & Danks, D. M. Autopsy findings in
two siblings with infantile Refsum disease. Acta Neuropathol. 83, 190–195 (1992).
9. Torvik, A. I.,Torp, S.,Kase, B. F.,Ek, J.,Skjeldal, O. & Stokke, O. Infantile Refsum ’ s disease :
a generalized peroxisomal disorder Case report with postmortem examination. 85, 39–53 (1988).
10. Roels, F.,Espeel, M. & De Craemer, D. Liver pathology and immunocytochemistry in
congenital peroxisomal diseases: a review. J. Inherit. Metab. Dis. 14, 853–875 (1991).
11. Ferdinandusse, S.,Denis, S.,Dacremont, G. & Wanders, R. J. A. Toxicity of peroxisomal
C27-bile acid intermediates. Mol. Genet. Metab. 96, 121–8 (2009).
12. Faust, P. L. & Hatten, M. E. Targeted deletion of the PEX2 peroxisome assembly gene in mice
provides a model for Zellweger syndrome, a human neuronal migration disorder. J. Cell Biol.
139, 1293–305 (1997).
13. Baes, M.,Gressens, P.,Baumgart, E.,Carmeliet, P.,Casteels, M.,Fransen, M.,Evrard, P.,Fahimi,
D.,Declercq, P. E.,Collen, D.,van Veldhoven, P. P. & Mannaerts, G. P. A mouse model for
Zellweger syndrome. Nat. Genet. 17, 49–57 (1997).
14. Hanson, M. G.,Fregoso, V. L.,Vrana, J. D.,Tucker, C. L. & Niswander, L. A. Peripheral nervous
system defects in a mouse model for peroxisomal biogenesis disorders. Dev. Biol. 395, 84–95
(2014).
15. Li, X.,Baumgart, E.,Morrell, J. C.,Valle, D.,Gould, S. J. & Jimenez-sanchez, G. PEX11
beta deficiency is lethal and impairs neuronal migration but does not abrogate peroxisome
function. Mol Cell Biol 22, 4358–4365 (2002).
16. Maxwell, M.,Bjorkman, J.,Nguyen, T.,Finnie, J.,Paterson, C.,Tonks, I.,Barbara, C.,Kay, G.
F.,Crane, D. I.,Sharp, P. & Paton, B. C. Pex13 inactivation in the mouse disrupts peroxisome
biogenesis and leads to a Zellweger syndrome phenotype. Mol Cell Biol 23, 5947–5957
(2003).
17. Müller, C. C.,Nguyen, T. H.,Ahlemeyer, B.,Meshram, M.,Santrampurwala, N.,Cao, S.,Sharp,
P.,Fietz, P. B.,Baumgart-Vogt, E. & Crane, D. I. PEX13 deficiency in mouse brain as a model of Zellweger syndrome: abnormal cerebellum formation, reactive gliosis and oxidative stress. Dis. Model. Mech. 4, 104–19 (2011).
18. Dirkx, R.,Vanhorebeek, I.,Martens, K.,Schad, A.,Grabenbauer, M.,Fahimi, D.,Declercq,
P.,Van Veldhoven, P. P. & Baes, M. Absence of peroxisomes in mouse hepatocytes causes
mitochondrial and ER abnormalities. Hepatology 41, 868–78 (2005).
19. Bottelbergs, A.,Verheijden, S.,Van Veldhoven, P. P.,Just, W.,Devos, R. & Baes, M. Peroxisome
deficiency but not the defect in ether lipid synthesis causes activation of the innate immune
system and axonal loss in the central nervous system. J. Neuroinflammation 9, 61 (2012).
20. Weng, H.,Ji, X.,Naito, Y.,Endo, K.,Ma, X.,Takahashi, R.,Shen, C.,Hirokawa, G.,Fukushima, Y.
& Iwai, N. Pex11α deficiency impairs peroxisome elongation and division and contributes to
nonalcoholic fatty liver in mice. Am. J. Physiol. Endocrinol. Metab. 304, E187–96 (2013).
21. Ebberink, M. S.,Mooijer, P. A. W.,Gootjes, J.,Koster, J.,Wanders, R. J. A. & Waterham, H. R.
Genetic classification and mutational spectrum of more than 600 patients with a Zellweger
syndrome spectrum disorder. Hum. Mutat. 32, 59–69 (2011).
22. Berendse, K.,Engelen, M.,Ferdinandusse, S.,Majoie, C. B. L. M.,Waterham, H. R.,Vaz, F.
M.,Koelman, J. H. T. M.,Barth, P. G.,Wanders, R. J. A. & Poll-The, B. T. Zellweger spectrum
disorders: clinical manifestations in patients surviving into adulthood. J. Inherit. Metab. Dis.
39, 93–106 (2016).
23. Tymms, M. J. & Kola, I. in Gene Knockout protocols (volume 158) 205–215 (2001).
24. Todaro, G. J. Quantitative studies of the growth of mouse embryo cells in culture and their
development into established lines. J. Cell Biol. 17, 299–313 (1963).
25. Wanders, R. J. A.,Wiemer, E. A.,Brul, S.,Schutgens, R. B.,van den Bosch, H. & Tager, J. M.
Prenatal diagnosis of Zellweger syndrome by direct visualization of peroxisomes in chorionic
villus fibroblasts by immunofluorescence microscopy. J. Inherit. Metab. Dis. 12 Suppl 2, 301–4
(1989).
26. Wanders, R. J. A.,Dekker, C.,Ofman, R.,Schutgens, R. B. & Mooijer, P. Immunoblot analysis
of peroxisomal proteins in liver and fibroblasts from patients. J. Inherit. Metab. Dis. 18 Suppl 1,
101–12 (1995).
27. Dacremont, G.,Cocquyt, G. & Vincent, G. Measurement of very long-chain fatty acids,
phytanic and pristanic acid in plasma and cultured fibroblasts by gas chromatography. J.
Inherit. Metab. Dis. 18 Suppl 1, 76–83 (1995).
28. Wanders, R. J. A. & Van Roermund, C. W. Studies on phytanic acid alpha-oxidation in rat liver
and cultured human skin fibroblasts. Biochim. Biophys. Acta 1167, 345–50 (1993).
29. Wanders, R. J. A.,Denis, S.,Ruiter, J. P.,Schutgens, R. B.,van Roermund, C. W. & Jacobs, B.
S. Measurement of peroxisomal fatty acid beta-oxidation in cultured human skin fibroblasts. J.
Inherit. Metab. Dis. 18 Suppl 1, 113–24 (1995).
30. Kemp, S.,Valianpour, F.,Mooyer, P. A. W.,Kulik, W. & Wanders, R. J. A. Method for
measurement of peroxisomal very-long-chain fatty acid beta-oxidation in human skin
fibroblasts using stable-isotope-labeled tetracosanoic acid. Clin. Chem. 50, 1824–6 (2004).
31. Wanders, R. J. A.,Ofman, R.,Romeijn, G. J. & Schutgens, R. B. H. Measurement of
dihydroxyacetone-phosphate acyltransferase ( DHAPAT ) in chorionic villous samples , blood cells and cultured cells. 1, 90–100 (1995).
32. Transgenic Mouse: Methods and Protocols. (Springer Science & Business Media, 2002).
33. van der Wel, N.,Hava, D.,Houben, D.,Fluitsma, D.,van Zon, M.,Pierson, J.,Brenner, M. &
Peters, P. J. M. tuberculosis and M. leprae translocate from the phagolysosome to the cytosol
in myeloid cells. Cell 129, 1287–98 (2007).
34. Vreken, P.,van Lint, A. E.,Bootsma, A. H.,Overmars, H.,Wanders, R. J. A. & van Gennip, A.
H. Rapid stable isotope dilution analysis of very-long-chain fatty acids, pristanic acid and
phytanic acid using gas chromatography-electron impact mass spectrometry. J. Chromatogr.
B. Biomed. Sci. Appl. 713, 281–7 (1998).
35. Bootsma, A. H.,Overmars, H.,Rooij, A. van,Lint, A. E. M. van,Wanders, R. J. A.,Gennip, A. H.
van & Vreken, P. Rapid analysis of conjugated bile acids in plasma using electrospray tandem
mass spectrometry: Application for selective screening of peroxisomal disorders. J. Inherit.
Metab. Dis. 22, 307–310 (1999).
36. Dacremont, G. & Vincent, G. Assay of plasmalogens and polyunsaturated fatty acids (PUFA)
4
104 105
37. Hubbard, W. C.,Moser, A. B.,Liu, A. C.,Jones, R. O.,Steinberg, S. J.,Lorey, F.,Panny, S.
R.,Vogt, R. F.,Macaya, D.,Turgeon, C. T.,Tortorelli, S. & Raymond, G. V. Newborn screening for X-linked adrenoleukodystrophy (X-ALD): validation of a combined liquid
chromatography-tandem mass spectrometric (LC-MS/MS) method. Mol. Genet. Metab. 97, 212–20 (2009).
38. Baumgart, E.,Vanhorebeek, I.,Grabenbauer, M.,Borgers, M.,Declercq, P. E.,Fahimi, H. D. &
Baes, M. Mitochondrial alterations caused by defective peroxisomal biogenesis in a mouse
model for Zellweger syndrome (PEX5 knockout mouse). Am. J. Pathol. 159, 1477–94 (2001).
39. Berendse, K.,Ebberink, M. S.,Ijlst, L.,Poll-The, B. T.,Wanders, R. J. A. & Waterham, H. R.
Arginine improves peroxisome functioning in cells from patients with a mild peroxisome
biogenesis disorder. Orphanet J. Rare Dis. 8, 138 (2013).
40. Peeters, A.,Shinde, A. B.,Dirkx, R.,Smet, J.,De Bock, K.,Marc, E.,Ilse, V.,Vanlander, A.,Van
Coster, R.,Carmeliet, P.,Fransen, M.,Van Veldhoven, P. P. & Baes, M. Mitochondria in
peroxisome-deficient hepatocytes exhibit impaired respiration, depleted DNA, and PGC-1α
independent proliferation. Biochim. Biophys. Acta - Mol. Cell Res. 1853, 285–98 (2015).
41. Imamura, A.,Tamura, S.,Shimozawa, N.,Suzuki, Y.,Zhang, Z.,Tsukamoto, T.,Orii, T.,Kondo,
N.,Osumi, T. & Fujiki, Y. Temperature-sensitive mutation in PEX1 moderates the phenotypes of
peroxisome deficiency disorders. Hum. Mol. Genet. 7, 2089–94 (1998).
42. Kurochkin, I. V,Mizuno, Y.,Konagaya, A.,Sakaki, Y.,Schönbach, C. & Okazaki, Y. Novel
peroxisomal protease Tysnd1 processes PTS1- and PTS2-containing enzymes involved in
beta-oxidation of fatty acids. EMBO J. 26, 835–45 (2007).
43. Pircher, P. C.,Kitto, J. L.,Petrowski, M. L.,Tangirala, R. K.,Bischoff, E. D.,Schulman, I. G. &
Westin, S. K. Farnesoid X receptor regulates bile acid-amino acid conjugation. J. Biol. Chem.
278, 27703–11 (2003).
44. Solaas, K.,Ulvestad, A.,Soreide, O. & Kase, B. F. Subcellular organization of bile acid
amidation in human liver: a key issue in regulating the biosynthesis of bile salts. J. Lipid Res.
41, 1154–1162 (2000).
45. Keane, M. H.,Overmars, H.,Wikander, T. M.,Ferdinandusse, S.,Duran, M.,Wanders, R. J. A. &
Faust, P. L. Bile acid treatment alters hepatic disease and bile acid transport in
peroxisome-deficient PEX2 Zellweger mice. Hepatology 45, 982–97 (2007).
46. Fan, C. Y.,Pan, J.,Usuda, N.,Yeldandi, A. V,Rao, M. S. & Reddy, J. K. Steatohepatitis,
spontaneous peroxisome proliferation and liver tumors in mice lacking peroxisomal fatty acyl-CoA oxidase. Implications for peroxisome proliferator-activated receptor alpha natural ligand
metabolism. J. Biol. Chem. 273, 15639–45 (1998).
47. Peeters, A.,Swinnen, J. V,Van Veldhoven, P. P. & Baes, M. Hepatosteatosis in peroxisome
deficient liver despite increased β-oxidation capacity and impaired lipogenesis. Biochimie 93,
1828–38 (2011).
48. Knight, C. H.,Maltz, E. & Docherty, A. H. Milk yield and composition in mice: effects of litter
size and lactation number. Comp. Biochem. Physiol. A. Comp. Physiol. 84, 127–133 (1986).
49. Levi, M. Disseminated intravascular coagulation: What’s new? Crit. Care Clin. 21, 449–67
(2005).
50. Bakker, C. M.,Knot, E. A.,Stibbe, J. & Wilson, J. H. Disseminated intravascular coagulation in
liver cirrhosis. J. Hepatol. 15, 330–5 (1992).
51. Hashimoto, T.,Fujita, T.,Usuda, N.,Cook, W.,Qi, C.,Peters, J. M.,Gonzalez, F. J.,Yeldandi,
A. V,Rao, M. S. & Reddy, J. K. Peroxisomal and mitochondrial fatty acid beta-oxidation in mice nullizygous for both peroxisome proliferator-activated receptor alpha and peroxisomal
fatty acyl-CoA oxidase. Genotype correlation with fatty liver phenotype. J. Biol. Chem. 274,
19228–36 (1999).
52. Espeel, M.,Mandel, H.,Poggi, F.,Smeitink, J. A.,Wanders, R. J.,Kerckaert, I.,Schutgens,
R. B.,Saudubray, J. M.,Poll-The, B. T. & Roels, F. Peroxisome mosaicism in the livers of
peroxisomal deficiency patients. Hepatology 22, 497–504 (1995).
53. Hiebler, S.,Masuda, T.,Hacia, J. G.,Moser, A. B.,Faust, P. L.,Liu, A.,Chowdhury, N.,Huang,
N.,Lauer, A.,Bennett, J.,Watkins, P. a,Zack, D. J.,Braverman, N. E.,Raymond, G. V & Steinberg, S. J. The Pex1-G844D mouse: a model for mild human Zellweger spectrum
disorder. Mol. Genet. Metab. 111, 522–32 (2014).
54. Wanders, R. J. A. & Ferdinandusse, S. Peroxisomes, peroxisomal diseases, and the
hepatotoxicity induced by peroxisomal metabolites. Curr. Drug Metab. (2012).
55. Chang, P. E.,Goh, G. B.-B.,Ngu, J. H.,Tan, H. K. & Tan, C. K. Clinical applications, limitations
and future role of transient elastography in the management of liver disease. World J.
Gastrointest. Pharmacol. Ther. 7, 91–106 (2016).
56. Zhang, R.,Chen, L.,Jiralerspong, S.,Snowden, A.,Steinberg, S. & Braverman, N. Recovery of
PEX1-Gly843Asp peroxisome dysfunction by small-molecule compounds. Proc. Natl. Acad.
Sci. U. S. A. 107, 5569–74 (2010).
57. Maeda, K.,Kimura, A.,Yamato, Y.,Nittono, H.,Takei, H.,Sato, T.,Mitsubuchi, H.,Murai, T. &
Kurosawa, T. Oral Bile Acid Treatment in Two Japanese Patients With Zellweger Syndrome. J.
