Detection of integrated HBV DNA through a nested Alu-PCR protocol

Detection of integrated HBV DNA through a nested Alu-PCR protocol

Abstract

INTRODUCTION: The hepatitis B virus (HBV) infects the human hepatocyte, causing acute or chronic hepatitis B (CHB). During infection, HBV DNA is able to integrate into the genome of the host. While it does not play a role in the viral replication cycle, integrated HBV DNA has been associated with hepatocellular carcinoma and is able to produce viral proteins which attribute to viral replication and persistence. However, the exact role of integrated HBV in the pathogenesis of CHB remains unclear and there is no standardized test for the detection of integrated HBV DNA. This research project sets out to design an Alu-PCR protocol capable of detecting and quantifying integrated HBV DNA.

METHODS: Primers were designed to anneal to ORF S, X and C of HBV and Alu elements, which were used in a nested Alu-PCR to amplify integrated HBV DNA. An additional PCR was performed using a forward and a reverse HBV primer for ORF S, X and C to detect integrated HBV DNA. Additionally, HepG2-NTCP and Huh7-NTCP cells were infected with HBV through the addition of HepG2.2.15 cell supernatant.

RESULTS: Gel electrophoresis of the products from the PCR performed on the nested Alu-PCR products revealed bands at the expected lengths for ORF S, X and C. Furthermore, qPCR of the supernatants of HepG2-NTCP and Huh7-HepG2-NTCP cells revealed that the supernatants of infected HepG2-HepG2-NTCP and Huh7-HepG2-NTCP cells contained 619 and 297 copies of HBV DNA per µl isolated DNA and the supernatants of uninfected HepG2-NTCP and Huh7-HepG2-NTCP cells contained 22 and 0 copies of HBV DNA per µl isolated DNA, respectively. CONCLUSIONS: Our Alu-PCR method detected integrated HBV DNA in HepG2.2.15 cells. Additionally, the HepG2-NTCP and Huh7-NTCP were infected with HBV. Furthermore, several adaptations have been proposed to the current protocol, which should provide quantification of the integrated HBV DNA and increased detection of integrated HBV DNA, as well as additional cell lines to further refine the Alu-PCR protocol.

Introduction

The hepatitis B virus (HBV) infects the human hepatocyte, causing acute or chronic hepatitis B (CHB) infections [1]. In 5 to 10% of infected adults, the HBV infection is not cleared within 6 months, leading to CHB in these patients [1]. It is estimated that 292 million people worldwide are currently infected with CHB [2]. The continuous immune response during CHB causes damage to the liver which contributes to the development of liver cirrhosis and hepatocellular carcinoma (HCC) [3], [4]. This leads to an estimated 306 000 and 165 000 deaths per year for liver cirrhosis and HCC, respectively [5]. Moreover, high HBV viral loads have been found to significantly increase CHB related mortality [6].

HBV infection on a molecular level initiates with the attachment of the HBV virion to the heparan sulfate proteoglycans located on the hepatocyte membrane and subsequent entry into hepatocyte through the sodium taurocholate cotransporting peptide receptor [7], [8]. Next, the nucleocapsid is released into the cytoplasm and transported to the nucleus, where it releases the HBV genome [9]. The genome consists of 3.2 kb partially double-stranded, relaxed circular DNA (rcDNA) [10]. The incomplete plus-strand of HBV is repaired by several host factors [9], [11], forming covalently closed circular DNA (cccDNA) [8]. The cccDNA forms the stable, episomal, transcriptional template of HBV from which all viral RNAs are transcribed using the host’s cellular transcriptional machinery [8], [9]. The cccDNA contains four main open reading frames (ORFs): ORF PreS1/PreS2/S, ORF PreC/C, ORF Pol and ORF X (Figure 1). ORF PreS1/PreS2/S encodes for the hepatitis B surface antigen (HBsAg), which is the viral envelope protein [9]. It has three variants: large, medium and

small HBsAg, encoded by PreS1, PreS2 and S, PreS2 and S, and S, respectively [9], [12]. ORF C encodes for the hepatitis B core antigen (HBcAg), which is the major structural protein of the viral nucleocapsid [13]. Hepatitis B e antigen (HBeAg) is formed by cleavage of the fusion protein encoded by ORF PreC/C [13]. It is the secreted form of HBcAg and [14], although the exact function is still unknown, is thought to induce immune tolerance [15]. ORF Pol spans almost the whole length of the genome and encodes the HBV polymerase, which mediates reverse transcription [8], [9]. ORF X encodes hepatitis B protein X (HBx), which is the only accessory protein of HBV and is linked to many processes, including regulating viral replication and induction of HCC [9], [16], [17]. In addition to these ORFs, the cccDNA contains two direct repeats (DR), which are two domains with a highly similar sequence [9], [18].

Clinically, CHB infection can be categorized into five, not necessarily sequential phases [19]. Phase 1 or HBeAg-positive chronic HBV infection is characterized by the presence of serum HBeAg, very high levels of HBV DNA and normal levels of alanine aminotransferase (ALT) [19]. ALT is widely used as a reliable biomarker for liver injury, with increased levels indicating hepatocyte damage [20]. No to minimal liver necroinflammation and fibrosis are present in the liver [19]. Phase 1 is followed by phase 2 or HBeAg-positive CHB, which is characterized by the presence of serum HBeAg, high levels of HBV DNA and elevated levels of ALT [19]. Moderate to severe liver necroinflammation and accelerated progression of fibrosis are present in the liver during this phase [19]. The majority of patients achieve HBeAg seroconversion and HBV DNA suppression, entering phase 3 or HBeAg-negative chronic HBV infection [19]. Phase 3 or HBeAg-negative chronic HBV infection is characterized by antibodies against HBeAg (anti-HBe), undetectable or low HBV DNA levels and normal levels of ALT. Patients have a low risk of developing liver cirrhosis or HCC [19]. However, some patients fail to control HBV and enter phase 4 or HBeAg-negative CHB [19]. Phase 4 is characterized by a lack of serum HBeAg, usually detectable anti-HBe, moderate to high levels of serum HBV DNA and elevated levels of ALT [19]. Most patients in this phase are infected by a HBV variant producing no or low levels of HBeAg [19]. Necroinflammation and fibrosis are present in the liver and low levels of spontaneous disease remission are associated with this phase [19]. Progression to phase 5 or HBsAg-negative phase occurs in 1-3% of cases per year due to spontaneous HBsAg loss and/or seroconversion [19]. This phase is characterized by serum negative HBsAg, antibodies against HBcAg, possibly antibodies against HBsAg, undetectable serum levels of HBV DNA and normal levels of ALT [19]. Patients have a minimal risk of developing liver cirrhosis, decompensation and HCC, with an improvement of survival, unless liver cirrhosis has occurred before HBsAg loss [19].

As of yet, there is no complete cure for CHB, which is defined as the elimination of cccDNA from infected hepatocytes [21]. A functional cure, determined by HBsAg loss, is therefore regarded as the optimal treatment endpoint [19]. This is rarely achieved with current treatment options [19]. The aim of current therapies is therefore sustained suppression of viral replication [8], [19]. Two treatment options are currently approved for treatment of CHB: nucleos(t)ide analogues (NAs), which are the most widely used, and pegylated interferon-α (PegIFNinterferon-α) [19]. NAs are initially converted into nucleoside triphosphates (dNTPs), after which they compete with the natural dNTPs to be incorporated into the viral DNA strand being synthesized [22]. They are specific for the HBV polymerase [22]. As the dNTPs produced from the NAs lack a 3’ hydroxyl group, elongation of the viral DNA strand is terminated [22], [23], thereby reducing viral replication [19]. The exact mechanisms through which PegIFNα functions are currently unknown, although they can be divided into two modes of action: immunomodulatory, which increases the cellular immune response against hepatocytes infected with HBV, and antiviral [24]–[26]. While NAs inhibit viral replication directly and PegIFNα induces immune control [19], both treatment options aim to suppress viral replication, which has been shown to eliminate neuroinflammatory activity and progressive fibrotic liver processes, thereby reducing the risk of liver cirrhosis and HCC [8], [19].

Figure 1: The HBV genome [9], [27]–[29]. The HBV genome contains four main ORFs: ORF PreS1/PreS2/S, ORF PreC/C, ORF Pol and ORF X [9]. ORF PreS1/PreS2/S encodes for HBsAg [9]. HBsAg has three variants: large, medium and small HBsAg, encoded by PreS1, PreS2 and S, PreS2 and S, and S, respectively [9], [12]. ORF C encodes HBcAg [13]. HBeAg is formed by cleavage of the fusion protein encoded by ORF PreC/C [13]. ORF Pol spans almost the whole genome length and encodes the HBV polymerase [9]. ORF X encodes HBx [9]. In addition to these ORFs, the HBV genome contains two DRs, which are two domains with a highly similar sequence [9], [18].

In addition to messenger RNAs encoding viral proteins, pregenomic RNA (pgRNA) is transcribed from cccDNA as well [9]. It forms the template for reverse transcription (Figure 2) [9]. The pgRNA is about 3.5 kb long and contains a duplicated, terminal redundancy, in which the DR1, an ε-region and the beginning of ORF C are repeated [9], [30]. The ε-region located on the pgRNA forms a hairpin-like structure and provides an encapsulation signal [31]. Encapsulation initiates with both HBcAg and the viral polymerase being transcribed from pgRNA, forming a nucleocapsid containing the viral polymerase bound to the pgRNA at the ε-region [8], [30]. The viral polymerase uses the hairpin-like structure located in the ε-region to synthesize a 3 nt oligonucleotide which becomes covalently linked to the polymerase [9], [30], [31]. Next, the synthesized 3 nt oligonucleotide translocates together with the polymerase to the duplicated DR1 region on the 3’ end side of the pgRNA [9], [30]. Using the 3 nt oligonucleotide as a primer, the viral polymerase then reverse transcribes the negative-sense DNA strand from the pgRNA [9]. The pgRNA is simultaneously degraded by the viral

polymerase [9], up to 11-16 nt from the 5’ end of the pgRNA [32]. The 11-16 nt undegraded pgRNA contains 11 nt of the DR1, which is highly similar to the DR2, allowing it to translocate to the DR2 on the newly synthesized negative-sense DNA strand (Figure 3, left side) [30], [32]. Using the undegraded, translocated pgRNA as a primer, the viral polymerase starts the transcription of the positive-sense DNA strand from the DR2 towards the 5’ end of the negative-sense strand [9], [30]. The negative-sense DNA strand contains a small terminal redundancy on both the 5’ and the 3’ end with a similar 8 nt sequence [30]. This, in addition to the proximity of the 5’ and 3’ end, allows the viral polymerase to switch from the 5’ end to the 3’ end of the negative-sense DNA strand, resulting in the formation of rcDNA [30]. The nucleocapsids, now containing rcDNA and the viral polymerase, can either be excreted as virions or transfer back to the nucleus of the hepatocyte, adding to the cccDNA pool inside the cell [9].

Figure 2: Reverse transcription of HBV [9], [30]. The pgRNA is about 3.5 kb long and contains a duplicated, terminal redundancy, in which the DR1, an ε-region and the beginning of ORF C are repeated [9], [30]. The ε-region contains a hairpin-like structure that the viral polymerase uses to synthesize a 3 nt oligonucleotide which becomes covalently linked to the polymerase [9], [30], [31]. Next, the synthesized 3 nt oligonucleotide translocates together with the polymerase to the duplicated DR1 region on the 3’ end side of the pgRNA [9], [30]. Using the 3 nt oligonucleotide as a primer, the viral polymerase then reverse transcribes the negative-sense DNA strand from the pgRNA [9]. The pgRNA is simultaneously degraded by the viral polymerase [9], up to 11-16 nt from the 5’ end of the pgRNA [32]. The 11-16 nt undegraded pgRNA contains 11 nt of the DR1, which is highly similar to the DR2, allowing it to translocate to the DR2 on the newly synthesized negative-sense DNA strand [30], [32]. Using the translocated pgRNA as a primer, the viral polymerase starts the transcription of the positive-sense DNA strand from the DR2 towards the 5’ end of the negative-sense strand [9], [30]. The negative-sense DNA strand contains a small terminal redundancy on both the 5’ and the 3’ end with a similar 8 nt sequence [30]. This, in addition to the proximity of the 5’ and 3’ end, allows the viral polymerase to switch from the 5’ end to the 3’ end of the negative-sense DNA strand, resulting in the formation of rcDNA [30]. In addition to rcDNA, a small proportion of DNA formed is double-stranded linear DNA [33]. It is primarily formed due to failure of the 11-16 nt undegraded pgRNA to translocate to the DR2 [33], resulting in positive-strand synthesis starting from the DR1 and consequently the formation of double-stranded linear DNA [30], [32].

In addition to rcDNA, a small proportion of DNA formed is double-stranded linear DNA (dslDNA) [33]. It is primarily formed due to failure of the 11-16 nt undegraded pgRNA to translocate to the DR2 [33], resulting in positive-strand synthesis starting from the DR1 and consequently the formation of dslDNA (Figure 2, right side) [30], [32]. The mechanisms behind the translocation failure remain unclear [30]. Additionally, it has been suggested that dslDNA could also be formed by denaturation of the attached ends of the rcDNA, although no direct evidence has been found [34].

While dslDNA is unable to replicate, it has been proposed that dslDNA can integrate into the genome of the host cell [9], although other, possibly unknown forms of HBV DNA may be involved as well [35]. Integration occurs at the site of double-stranded breaks in the host genome at a rate of at least one viral genome per 103 to 104 cells in the first days following infection [9], [33], [36]. In HCC-positive patients, the integration frequency is estimated at 0.844 per diploid genome [37], suggesting that the integration frequency increases over the course of a CHB infection or that integration could play a role in the development of HCC. This is corroborated by the finding that the proportion of dslDNA in sera increases significantly in CHB patients who have developed liver cirrhosis or HCC compared to CHB patients without either condition [33]. Furthermore, integrated HBV DNA has been found to express HBsAg in HBV infected chimpanzees [38]. In this study, chimpanzees were treated with RNA interference therapy, which targets HBV transcripts [38]. HBV transcripts transcribed from cccDNA were targeted, but not HBV transcripts originating from integrated DNA [38]. It was found that in HBeAg negative chimpanzees, integrated HBV DNA formed the dominant source of HBsAg [38]. Furthermore, HBsAg was expressed from integrated HBV DNA in HCC-positive patients [37]. It was estimated that 80% of HBsAg transcripts originate from integrated HBV DNA in these patients [37]. The production of HBsAg is of interest since HBsAg contributes to the impaired innate and adaptive immune response as well as the T-cell and B-cell exhaustion seen in CHB [39]. Consequently, reduced HBsAg serum levels might contribute to the restoration of the immune response of the host [39], [40]. To illustrate, it has been reported that B-cells are unable to produce anti-HBsAg during CHB, but this effect was restored following HBsAg loss [39]. Additionally, reduces HBsAg serum levels increase the host’s T-cell response against HBV [40]. It has been hypothesized that HBsAg, which greatly exceeds the number of virions, inhibits the immune response against HBV [40], thus leading to viral persistence. However, the exact role of integrated HBV DNA in the pathogenesis of CHB remains unclear [9].

To research the role of integrated HBV DNA in the pathogenesis of CHB, and possibly other related phenomena, it is important to detect integrated HBV DNA in the genome of host cells. Several methods to detect HBV DNA integration have been described over the past decades [35]. These methods will be briefly discussed below, including their advantages, disadvantages and applications:

- Southern blotting is a technique that first transfers DNA fragments separated through gel electrophoresis from an electrophoresis gel to a membrane, followed by the addition of labeled probes [41]. This allows for the identification of DNA fragments with a similar sequence to the probe [41], in this case, HBV. Integrated HBV DNA and non-integrated HBV DNA can be differentiated through different patterns on the gel electrophoresis after digestion with restriction enzymes that do not have a restriction site located on the HBV genome [42]. While the technique is inexpensive, it is also time-consuming, has a low sensitivity and only limited quantification is possible through densitometry measurements [35]. Therefore it is commonly used to detect the presence of integrated HBV DNA in highly clonal samples [35], like HCC samples [43], but may be a less favorable technique for analyzing non-HCC patient samples.

- The human genome contains well over 1 million Alu elements, a 280 bp, non-autonomous mobile element [44], [45]. Alu-PCR is a PCR method that uses a primer specific for HBV DNA and a primer specific for these Alu elements [35], allowing for the amplification of integrated HBV DNA sequences near Alu elements [46]. It is a simple and inexpensive technique, but it depends on the vicinity of Alu elements [35]. It has been reported that Alu-PCR requires multiple copies to detect integrated HBV

DNA in a sample [35], [47], [48], making it unsuitable to detect rare integrations. It can, however, be used to detect integrated HBV DNA in patient samples [48], [49].

- Inverse-nested PCR operates as follows: First, DNA fragments containing integrated HBV DNA are formed using restriction enzymes and circularized using DNA ligase [50], [51]. The circularized DNA, containing integrated HBV DNA, can now be amplified using PCR, as both primers can anneal to the known HBV DNA sequence [50], [51]. It is a very sensitive and specific technique, allowing for the detection of single integrations as well as absolute quantification [35]. However, it does greatly depend on the vicinity of suitable restriction sites near the integrated HBV DNA [35], [51], [52], with some studies likely missing close to 90% of integrations [52].

- Next-generation sequencing (NGS) describes several techniques that employ the same principles to sequence large amounts of DNA [53]. Millions of small DNA fragments are sequenced simultaneously and mapped to a reference genome, providing the sequence of interest [53]. Since multiple reads must be aligned to the reference genome to provide accurate results, this method is not suitable to detect integrations in patient samples without clonal expansion [35], [51]. Another limitation of NGS is the lack of absolute quantification [35], [51], as the DNA is often amplified in a non-linear fashion prior to sequencing [51]. A major advantage of NGS is that it provides the sequence of the integrated HBV DNA as well as surrounding regions. It is possible to sequence the whole genome, the exome or the RNA transcripts, which provides additional information on the expression levels of integrated HBV DNA [35], [37]. However, to properly detect integrated HBV DNA in the RNA, it requires high levels of expression or a highly clonal sample [35].

The goal of this research project is to detect integrated HBV DNA in the liver of CHB patients. The Alu-PCR would be the most suitable technique, as it is simple, inexpensive, allows for the detection of integrated HBV DNA in patient samples and allows for the quantification of the integrated HBV DNA. This research project sets out to design an Alu-PCR protocol capable of detecting and quantifying integrated HBV DNA.

Materials and methods

Cell lines

HepG2-NTCP, Huh7-NTCP and HepG2.2.15 cell lines were used during this project. HepG2-NTCP cells are hepatoblastoma cells and Huh7-NTCP cells are hepatoma-derived cells that are both transduced with an NTCP overexpression plasmid, causing them to be susceptible to HBV infection [54], [55]. HepG2.2.15 cells are HepG2 cells stably transfected with an 1,2 overlength subtype ayw HBV construct [56], resulting in chromosomal integration of HBV and secretion of HBV virions [57]. Both the HepG2-NTCP and HepG2.2.15 cells were cultured in William’s E medium (Lonza, Switzerland) supplemented with 10% (v/v) heat-inactivated Fetal Calf Serum (FCS), 2 mM L-Glutamine, 5mM Dexamethasone, penicillin (100 U/mL) and streptomycin (100 µg/mL) at 37°C and 5% CO2. Huh7-NTCP cells were cultured in Dulbecco’s Modified

Eagle’s Medium (Gibco, United States) containing 10% (v/v) heat-inactivated FCS, penicillin (100 U/mL) and streptomycin (100 µg/mL) at 37°C and 5% CO2.

Primer and probe design

Primer sets were designed to anneal to HBV DNA and the Alu element in the human genome, allowing for the amplification of integrated HBV DNA (Table 1 and Figure 3). Primers were designed for ORF S, X or C of HBV to amplify each separate ORF. The primers for the amplification of ORF S and X consisted of a forward primer, a downstream nested primer, and a reverse primer that is reverse complement. The primers for ORF C consist of a forward primer and an upstream nested primer, both reverse complement. This was done because the breakpoint of the HBV DNA during integration is commonly located between 1600 nt and 1800 nt on the HBV genome [37], [58]–[61], therefore the nearest Alu element will likely be located upstream

of ORF C. All HBV primers were complementary to conserved regions of the HBV genome, as to amplify all strains. Three Alu primers were used: the Alu sense and antisense primer including tags were taken from literature and the Alu278 sense primer including tag had been previously designed by Dr. Kootstra [62]. Using both a sense and an antisense primers captures both possible orientations of the Alu element.

Table 1 Overview of the sequences of the primers and probes for the nested Alu-PCR. Sequences are given from

5’ end side to 3’ end side. Underlined sequences are tags. Location on the HBV genome is given relative to NC_003977.2 on NCBI [27].

Nested Alu PCR

A nested Alu PCR was performed on the isolated DNA of HepG2.2.15 cells (provided by V. Loukachov) using the HBV primers for ORF S, X and C, and the Alu primers (Figure 3). The PCR mix contained 1 µl isolated HepG2.2.15 DNA, 1 µM of each forward HBV primer, 0.2 µM of each Alu primer, 5X GoTaq® Flexi buffer (Promega Corporation, United States), 1.5 mM MgCl2 (Promega Corporation, United States), 0.2 mM

dNTPs (Promega Corporation, United States) and 1 u GoTaq® G2 Flexi DNA polymerase (Promega Corporation, United States). The PCR program consisted of 15 cycles of 30 seconds of denaturation at 95°C, 30 seconds of annealing at 58°C and 3 minutes of elongation at 72°C. Following this initial amplification, a nested PCR was carried out using the nested primers for HBV S, HBV X and HBV C and the primers for the tags of the Alu primers. The PCR mix contained 2.5 µl amplified PCR product, 0.2 µM of each HBV primer, 0.2 µM of each Alu primer, 5X GoTaq® Flexi buffer, 1.5 mM MgCl2, 0.2 mM dNTPs and 1 u GoTaq® G2

Flexi DNA polymerase. The PCR program consisted of 20 cycles of 30 seconds of denaturation at 95°C, 30 seconds of annealing at 55°C and 3 minutes of elongation at 72°C. The nested PCR products were run on a 1% agarose gel at 50 V for 30 minutes.

Description Sequence Location on HBV

HBV S forward CAGAGTCTAGACTCGTGGTGGACTTC 244 – 269 nt HBV S nested TGGCCAAAATTCGCAGTCCC 303 – 322 nt HBV S reverse GGACAAACGGGCAACATACCTTG 479 – 457 nt HBV X forward GGGACGTCCTTTGTTTACGTCCC 1413 – 1435 nt HBV X nested GCACCTCTCTTTACGCGGTCTC 1528 – 1549 nt HBV X reverse CCAATTTGTGCCTACAGCCTCC 1799 – 1778 nt HBV C forward GATAAGATAGGGGCATTTGGTGGTC 2324 – 2300 nt HBV C nested GAGGAGTGCGAATCCACACTCC 2290 – 2269 nt HBV C reverse CACCAGCACCATGCAACTTT 1812 – 1825 nt

Alu278 (sense) TGTAAAACGACGGCCAGTCCAAAGTGCTGGGATTACAG -

Alu278 (sense) tag TGTAAAACGACGGCCAGT -

Alu sense CAGTGCCAAGTGTTTGCTGACGCCAAAGTGCTGGGATT

ACAG

-

Alu sense tag CAAGTGTTTGCTGACGCCAAAG -

Alu antisense AGTGCCAAGTGTTTGCTGACGACTGCACTCCAGCCTGG

GCGAC

-

Figure 3: Overview of the experimental design of the nested Alu-PCR and additional PCR. Primer sets were designed to anneal to HBV DNA and the Alu element in the human genome, allowing for the amplification of integrated HBD DNA. Primers were designed for ORF S, X or C of HBV to capture each separate ORF. The forward primer and upstream nested primers for ORF C were both in reverse complement. This was done because the HBV breakpoint is commonly located between 1600 nt and 1800 nt on the HBV genome during integration [37], [58]–[61], therefore the nearest Alu element will likely be located upstream of ORF C. A nested Alu PCR was performed using the HBV primers of ORF S, X and C, and the Alu primers. The initial amplification used the forward HBV primers and the Alu primers. Following this initial amplification, a nested PCR was carried out using the nested HBV primers and the primers for the tags of the Alu primers. Next, another PCR was performed on the products of the nested Alu PCR using the nested HBV primers and reverse HBV primers.

HBV integration PCR

A PCR was performed on the products of the nested Alu PCR using the nested HBV primers and reverse HBV primers (Figure 3). ORF S, X and C were amplified separately. The PCR mix contained 1:10 diluted nested Alu PCR product, 0.2 µM of the nested HBV primer for either ORF S, X or C, 0.2 µM of the reverse HBV primer for either ORF S, X or C, 5X GoTaq® Flexi buffer, 1.5 mM MgCl2, 0.2 mM dNTPs and 1 u GoTaq®

G2 Flexi DNA polymerase. The PCR program consisted of 20 cycles of 30 seconds of denaturation at 95°C, 30 seconds of annealing at 54°C and 1 minute of elongation at 72°C. The nested PCR products were run on a 2% agarose gel at 50 V for 30 minutes.

Infection of HepG2 and Huh7 cells with HBV

Prior to this experiment, HepG2.2.15 cells were cultured in a T75 flask and after 6 days the supernatant containing HBV particles was harvested. HepG2-NTCP and Huh7-NTCP cells were seeded at a concentration of 35 000 cells per well in a 6-well plate. The following day, either 1 mL of HepG2.2.15 cell supernatant or 1 mL of virus-free fresh media was added to the wells and the cells were incubated overnight. After 24 hours, the medium was removed and the cells were washed three times with 1 ml of PBS. The cells were harvested on day 1, 3 and 6 post-infection and the DNA was isolated. Additionally, on day 6 post-infection the supernatant was harvested and DNA was isolated (Figure 4).

Figure 4: Overview of the experimental design of the infection of HepG2 and Huh7 cells with HBV. HepG2-NTCP

and Huh7-NTCP cells were seeded at a concentration of 35 000 cells per well in a 6-well plate. 1 mL of HepG2.2.15 cell supernatant was added to the A row. 1 mL of virus-free fresh media was added to the B row. The cells were harvested on day 1, 3 and 6 post-infection and the DNA was isolated. Additionally, on day 6 post-infection the supernatant was harvested and DNA was isolated.

DNA isolation

1 mL L6 lysis buffer was added to cells or 1 mL supernatant [63], after which the samples were incubated for 30 minutes at 37°C. Next, 1 mL isopropanol was added and the samples were centrifuged for 15 minutes at 22.187 g. Subsequently, the pellet was washed with 1 mL of 70% ethanol and centrifuged for 5 minutes at 22.187 g, which was repeated three times. The pellet was airdried for 30 minutes and dissolved in water overnight at 4°C. The isolated DNA was stored at -20°C until further use.

HBV infection qPCR

A qPCR was performed on the isolated DNA of the infected and uninfected HepG2-NTCP and Huh7-NTCP supernatants to detect HBV DNA. The forward primer PG3 5’-CAAGCCTCCAAGCTGTGCCTTG-3’

(Sigma-Aldrich Corporation, United States) and reverse primer BC1long

5’-CGTTTTTGCCTTCTGACTTCTTTCC-3’ (Sigma-Aldrich Corporation, United States) were used. A standard curve of 1, 10, 100, 1000 and 10 000 copies of HBV DNA was used. The qPCR mix contained 2 µl isolated DNA, 0.2 µM of PG3 primer, 0.2 µM of BC1long primer and 5 µl 2x PROMEGA Mastermix (Promega Corporation, United States). The qPCR program consisted of 30 cycles of 10 seconds of denaturation at 95°C, 20 seconds of annealing at 50°C and 30 seconds of elongation at 72°C. The results were analyzed using the LightCycler® 480 software.

Results

Detection of integrated HBV DNA in HepG2.2.15 cells

To detect integrated HBV DNA in the human genome, a nested Alu-PCR followed by an additional PCR separate for ORF S, X and C was performed on the isolated DNA of HepG2.2.15 cells (Figure 4). Different Alu primer combinations were tested to determine which combination is the most efficient at amplifying the integrated HBV DNA. Gel electrophoresis of the products of the nested Alu-PCR showed a smear and several bands of varying lengths in all samples, except the negative control lacking GoTaq® G2 Flexi DNA polymerase (Figure 5a). The sample containing primers for ORF S, X and C of HBV and the Alu278 and the Alu antisense primer showed a thicker smear and bands, therefore this primer combination was used for further experiments.

To determine whether the amplification of integrated HBV DNA was successful and which ORFs were integrated, an additional PCR was performed on the nested Alu-PCR products. ORF S, X and C were amplified separately. Gel electrophoresis of the products showed a band for ORF S, X and C at the expected length of 177 bp, 277 bp and 485 bp, respectively (Figure 5b).

Figure 5a (left) and 5b (right): Gel electrophoresis of the products from the nested Alu-PCR (left) and the gel electrophoresis performed on the products from the PCR performed on the products from the nested Alu-PCR (right). Gel electrophoresis of the products of the nested Alu-PCR (left) showed a smear and several bands of varying lengths in all samples, except the negative control lacking GoTaq® G2 Flexi DNA polymerase. The sample containing primers for ORF S, X and C of HBV and the Alu278 and the Alu antisense primer showed a thicker smear and bands.

Gel electrophoresis of the products from the PCR performed on the products from the nested Alu-PCR (right) showed a band for ORF S, X and C at the expected length of 177 bp, 277 bp and 485 bp, respectively.

Alu sense + Alu antisense Alu sense + Alu antisense + Alu278 - Alu278 + Alu antisense ORF S product - + ORF C product - + ORF X product - + 100 kb ladder 100 kb ladder

Detection of HBV infection in HepG2-NTCP and Huh7-NTCP cells

To determine whether HepG2-NTCP and Huh7-NTCP cells were successfully infected with HBV, a qPCR specific for HBV DNA was performed on the DNA isolated from the supernatants of these cells after infection with HepG2.2.15 supernatant. At 6 days post-infection, the infected HepG2-NTCP supernatant contained 619 copies of HBV DNA per µl isolated DNA and the uninfected HepG2-NTCP supernatant contained 22 copies of HBV DNA per µl isolated DNA. The infected Huh7-NTCP supernatant contained 297 copies of HBV DNA per µl isolated DNA and the uninfected Huh7-NTCP supernatant contained 0 copies of HBV DNA per µl isolated DNA (Figure 6).

Figure 6: Copies of HBV per µl isolated DNA of the supernatants of HepG2-NTCP and Huh7-NTCP cells 6 days post-infection. 22 and 0 copies of HBV DNA per µl isolated DNA were measured in the supernatants of uninfected

HepG2-NTCP and Huh7-NTCP cells, respectively, while 619 and 297 copies of HBV DNA per µl isolated DNA were measured in the supernatants of infected HepG2-NTCP and Huh7-NTCP cells, respectively.

Discussion

This research project aimed to develop a method for the detection of integrated HBV DNA in the human genome. This is clinically important because integrated HBV DNA has been linked to HCC development and could attribute to viral persistence. However, the exact role of integrated HBV DNA in the pathogenesis of CHB remains unclear. To research the role of integrated HBV DNA in the pathogenesis of CHB, and possibly other related phenomena, it is important to detect and quantify integrated HBV DNA in the host genome. The first part of this research project set out to design an Alu-PCR protocol capable of detecting and quantifying integrated HBV DNA. To do so, a nested Alu-PCR was performed on the isolated DNA of HepG2.2.15 cells. Gel electrophoresis of the nested Alu-PCR products showed a smear with several bands of varying lengths (see figure 5a), likely caused by the HBV-Alu and Alu-Alu amplicons of varying lengths. To determine whether the integrated HBV DNA was amplified and which ORFs were integrated, an additional PCR was performed on the nested Alu-PCR products. Gel electrophoresis of the products showed a band for ORF S, X and C at the expected length of 177 bp, 277 bp and 485 bp, respectively (see figure 5b), which is assumed to originate from integrated HBV DNA. It could be argued that these bands originate from cccDNA instead of integrated HBV DNA, as two HBV specific primers were used and the isolated DNA of the HepG2.2.15 cells still contains some cccDNA. However, the sample was greatly enriched for HBV-Alu and Alu-Alu amplicons and subsequently diluted, therefore the amount of cccDNA present in the sample is

0 100 200 300 400 500 600 700

HepG2 uninfected HepG2 infected Huh7 uninfected Huh7 infected

Co pi es o f H B V D N A pe r µ l is o la te d D N A

presumed negligible. Thus, it could be concluded that the Alu-PCR was able to detect integrated HBV DNA in HepG2.2.15 cells.

Next, HepG2-NTCP and Huh7-NTCP were infected with HBV. To determine whether the cells could be infected and subsequently produce HBV, supernatants were harvested after 6 days of infection and the HBV DNA in the supernatants was measured using qPCR. The supernatants of infected HepG2-NTCP and Huh7-NTCP cells contained a higher concentration of HBV DNA compared to supernatants of uninfected HepG2-NTCP and Huh7-HepG2-NTCP cells, indicating that the HepG2-HepG2-NTCP and Huh7-HepG2-NTCP were infected with HBV (Figure 6). However, some HBV copies were measured in the supernatants of uninfected HepG2-NTCP cells, whereas these cells should not produce HBV particles. Therefore, it would be advisable to repeat this experiment. In future research, the Alu-PCR could be performed on isolated DNA of the infected HepG2-NTCP and Huh7-HepG2-NTCP to detect integrated HBV DNA.

The main limitation of the Alu-PCR is the dependency on nearby Alu elements [49]. Alu-PCRs are able to detect integrations up to approximately 1500 bp from Alu elements [49]. However, using whole-genome sequencing a large part of HBV integrations were detected more than 5000 bp from Alu elements [64]. Therefore, a proportion of integrated HBV DNA could be missed using the current method. Another frequently mentioned limitation of Alu-PCR is the limited sensitivity [35], [49], requiring several copies of integrated HBV DNA for detection [35], [47], [48]. Despite these limitations, previous studies have reported Alu-PCRs detecting as few as 10 to 100 cells containing integrated HBV DNA [47], [48]. This likely makes the current Alu-PCR protocol suitable to be used in CHB patients.

In order to further answer the research question, additional experiments should be added and several adjustments should be made to the current method:

- A standard curve containing a plasmid with full-length HBV DNA and an Alu element should be included at the start and throughout the whole protocol. Then, by performing a qPCR using probes for ORF S, X and C on the nested Alu-PCR product as well as the standard curve, the absolute amount of integrated HBV DNA in the sample can be determined for each ORF. Furthermore, the detection limit of the Alu-PCR protocol will be simultaneously determined. A negative control containing no HBV DNA and a positive control containing HBV DNA should be included in the qPCR, to minimize the chance of false positives and false negatives, respectively.

- A large part of HBV DNA integrations currently go undetected since they are located too far away from the Alu elements [48], [64]. If, for example, GoTaq Long PCR Master Mix by PROMEGA would be used, DNA could be amplified up to 30 kb [65]. This would capture the large majority of integrated HBV DNA, as most of the integrated HBV DNA is located less than 10 kb away from Alu elements [64].

- The protocol should be tested in a cell infection system by performing the nested Alu-PCR and additional PCR on cells infected with HBV. The isolated DNA of the HBV infected HepG2-NTCP cells and Huh7-NTCP cells or the isolated DNA of HBV infected primary human hepatocytes would provide a model system that more closely resembles the CHB infection in the human liver [66]. The primary human hepatocytes could be infected with HBV through the same method as the HepG2-NTCP and Huh7-HepG2-NTCP cells. The addition of DMSO to the maintenance medium of the primary human hepatocytes might be necessary, as this is beneficial to the infection process [66], [67]. To conclude, this research project has designed an Alu-PCR protocol capable of detecting integrated HBV DNA in HepG2.2.15 cells. Several adaptations have been proposed, which should provide quantification and increased detection of integrated HBV DNA, as well as additional cell lines to further refine the Alu-PCR protocol for its application in hepatocytes derived from CHB patients. This Alu-PCR protocol can then be used to detect and quantify integrated HBV DNA in the liver biopsies of CHB patients for research into the role of integrated HBV DNA in the pathogenesis of CHB, which currently remains unclear.

References

[1] C. Seeger and W. S. Mason, “Hepatitis B Virus Biology,” Microbiol. Mol. Biol. Rev., vol. 64, no. 1, pp. 51–68, Mar. 2000, doi: 10.1128/mmbr.64.1.51-68.2000.

[2] D. Razavi-Shearer et al., “Global prevalence, treatment, and prevention of hepatitis B virus infection in 2016: a modelling study,” Lancet Gastroenterol. Hepatol., vol. 3, no. 6, pp. 383–403, Mar. 2018, doi: 10.1016/S2468-1253(18)30056-6. [3] D. Lavanchy, “Worldwide epidemiology of HBV infection, disease burden, and vaccine prevention,” J. Clin. Virol., vol.

24, pp. S1–S3, 2005, doi: 10.1016/S1386-6532(05)00384-7.

[4] L. G. Guidotti and F. V Chisari, “Immunobiology and Pathogenesis of Viral Hepatitis,” Annu. Rev. Pathol. Mech. Dis., vol. 1, pp. 23–61, 2006, doi: 10.1146/annurev.pathol.1.110304.100230.

[5] G. A. Roth et al., “Global, regional, and national age-sex-specific mortality for 282 causes of death in 195 countries and territories, 1980–2017: a systematic analysis for the Global Burden of Disease Study 2017,” Lancet, vol. 392, no. 10159, pp. 1736–1788, Nov. 2018, doi: 10.1016/S0140-6736(18)32203-7.

[6] G. Chen, W. Lin, F. Shen, U. H. Iloeje, W. T. London, and A. A. Evans, “Past HBV viral load as predictor of mortality and morbidity from HCC and chronic liver disease in a prospective study,” Am. J. Gastroenterol., vol. 101, no. 8, pp. 1797–1803, Aug. 2006, doi: 10.1111/j.1572-0241.2006.00647.x.

[7] H. Yan et al., “Viral entry of hepatitis B and D viruses and bile salts transportation share common molecular determinants on sodium taurocholate cotransporting polypeptide.,” J. Virol., vol. 88, no. 6, p. 3284, Jan. 2014, doi: 10.1128/JVI.03478-13.

[8] D. Grimm, R. Thimme, and H. E. Blum, “HBV life cycle and novel drug targets,” Hepatol. Int., vol. 5, pp. 644–653, Mar. 2011, doi: 10.1007/s12072-011-9261-3.

[9] T. Tu, M. A. Budzinska, N. A. Shackel, and S. Urban, “HBV DNA integration: Molecular mechanisms and clinical implications,” Viruses, vol. 9, no. 4, p. 75, Apr. 2017, doi: 10.3390/v9040075.

[10] A. L. McNaughton et al., “Insights From Deep Sequencing of the HBV Genome—Unique, Tiny, and Misunderstood,”

Gastroenterology, vol. 156, no. 2, pp. 384–399, Jan. 2019, doi: 10.1053/j.gastro.2018.07.058.

[11] L. Wei and A. Ploss, “Core components of DNA lagging strand synthesis machinery are essential for hepatitis B virus cccDNA formation,” Nat. Microbiol., vol. 5, pp. 715–726, Mar. 2020, doi: 10.1038/s41564-020-0678-0.

[12] T. F. Baumert, J. Köck, and H. E. Blum, “A novel target of hepatitis B virus mutations: Splicing of surface RNA,”

Hepatology, vol. 42, no. 1, pp. 21–23, Jul. 2005, doi: 10.1002/hep.20791.

[13] H. Kim, S. A. Lee, S. Y. Do, and B. J. Kim, “Precore/core region mutations of hepatitis B virus related to clinical severity,” World J. Gastroenterol., vol. 22, no. 17, pp. 4287–4296, May 2016, doi: 10.3748/wjg.v22.i17.4287. [14] M. T. Chen et al., “A function of the hepatitis B virus precore protein is to regulate the immune response to the core

antigen,” Proc. Natl. Acad. Sci. U. S. A., vol. 101, no. 41, pp. 14913–14918, Oct. 2004, doi: 10.1073/pnas.0406282101. [15] A. Kramvis, E. G. Kostaki, A. Hatzakis, and D. Paraskevis, “Immunomodulatory function of HBeAg related to

short-sighted evolution, transmissibility, and clinical manifestation of Hepatitis B virus,” Front. Microbiol., vol. 9, p. 2521, Oct. 2018, doi: 10.3389/fmicb.2018.02521.

[16] B. L. Slagle and M. J. Bouchard, “Role of HBx in hepatitis B virus persistence and its therapeutic implications,” Curr.

Opin. Virol., vol. 30, pp. 32–38, Jun. 2018, doi: 10.1016/j.coviro.2018.01.007.

[17] M. Geng, X. Xin, L. Q. Bi, L. T. Zhou, and X. H. Liu, “Molecular mechanism of hepatitis B virus X protein function in hepatocarcinogenesis,” World J. Gastroenterol., vol. 21, no. 38, pp. 10732–10738, Oct. 2015, doi:

10.3748/wjg.v21.i38.10732.

[18] J. W. Habig and D. D. Loeb, “Sequence Identity of the Direct Repeats, DR1 and DR2, Contributes to the Discrimination between Primer Translocation and in Situ Priming During Replication of the Duck Hepatitis B Virus,” J. Mol. Biol., vol. 364, no. 1, pp. 32–43, Nov. 2006, doi: 10.1016/j.jmb.2006.08.095.

[19] European Association for the Study of the Liver, “EASL 2017 Clinical Practice Guidelines on the management of hepatitis B virus infection q,” J. Hepatol., vol. 67, pp. 370–398, 2016.

[20] J. Ozer, M. Ratner, M. Shaw, W. Bailey, and S. Schomaker, “The current state of serum biomarkers of hepatotoxicity,”

Toxicology, vol. 245, no. 3, pp. 194–205, Mar. 2008, doi: 10.1016/j.tox.2007.11.021.

[21] E. Loggi, G. Vitale, F. Conti, M. Bernardi, and P. Andreone, “Chronic hepatitis B: Are we close to a cure?,” Dig. Liver

Dis., vol. 47, no. 10, pp. 836–841, Oct. 2015, doi: 10.1016/j.dld.2015.05.019.

[22] G. V. Papatheodoridis, E. Dimou, and V. Papadimitropoulos, “Nucleoside analogues for chronic hepatitis B: antiviral efficacy and viral resistance,” Am. J. Gastroenterol., vol. 97, no. 7, pp. 1618–1628, Jul. 2002, doi: 10.1111/j.1572-0241.2002.05819.x.

[23] S. B. Bhise, “HBV polymerase as a target for development of anti-HBV drugs,” in Viral Polymerases: Structures,

Functions and Roles as Antiviral Drug Targets, Elsevier, 2019, pp. 237–270.

[24] W. C. Li, M. R. Wang, L. B. Kong, W. G. Ren, Y. G. Zhang, and Y. M. Nan, “Peginterferon alpha-based therapy for chronic hepatitis b focusing on hbsag clearance or seroconversion: A meta-analysis of controlled clinical trials,” BMC

Infect. Dis., vol. 11, p. 165, Jun. 2011, doi: 10.1186/1471-2334-11-165.

[25] A. S. J. Woo, R. Kwok, and T. Ahmed, “Alpha-interferon treatment in hepatitis B,” Ann. Transl. Med., vol. 5, no. 7, p. 159, Apr. 2017, doi: 10.21037/atm.2017.03.69.

[26] V. Rijckborst and H. L. A. Janssen, “The role of interferon in hepatitis B therapy,” Curr. Hepat. Rep., vol. 9, no. 4, pp. 231–238, Nov. 2010, doi: 10.1007/s11901-010-0055-1.

[27] N. C. for B. I. Bethesda (MD): National Library of Medicine (US), “Accesion no. NC_003977.2, Hepatitis B virus (strain ayw) genome,” 1988. [Online]. Available: https://www.ncbi.nlm.nih.gov/nuccore/NC_003977.2?report=graph. [Accessed: 17-Feb-2020].

no. 2, p. 343, Aug. 1983.

[29] C. Seeger and W. S. Mason, “Molecular biology of hepatitis B virus infection,” Virology, vol. 479–480, pp. 672–686, 2015, doi: 10.1016/j.virol.2015.02.031.

[30] M. Nassal, “Hepatitis B viruses: Reverse transcription a different way,” Virus Res., vol. 134, no. 1–2, pp. 235–249, Jun. 2008, doi: 10.1016/j.virusres.2007.12.024.

[31] A. Kramvis and M. C. Kew, “Structure and function of the encapsidation signal of hepadnaviridae,” J. Viral Hepat., vol. 5, pp. 357–367, 1998, doi: 10.1046/j.1365-2893.1998.00124.x.

[32] K. M. Haines and D. D. Loeb, “The Sequence of the RNA Primer and the DNA Template Influence the Initiation of Plus-strand DNA Synthesis in Hepatitis B Virus,” J. Mol. Biol., vol. 370, no. 3, pp. 471–480, Jul. 2007, doi:

10.1016/j.jmb.2007.04.057.

[33] X. L. Zhao et al., “Serum viral duplex-linear DNA proportion increases with the progression of liver disease in patients infected with HBV,” Gut, vol. 65, no. 3, pp. 502–511, Jun. 2015, doi: 10.1136/gutjnl-2014-308989.

[34] W. Yang, W. S. Mason, and J. Summers, “Covalently Closed Circular Viral DNA Formed from Two Types of Linear DNA in Woodchuck Hepatitis Virus-Infected Liver,” J. Virol., vol. 70, no. 7, pp. 4567–4575, Jul. 1996.

[35] M. A. Budzinska, N. A. Shackel, S. Urban, and T. Tu, “Cellular Genomic Sites of Hepatitis B Virus DNA Integration,”

Genes (Basel)., vol. 9, no. 7, p. 365, Jul. 2018, doi: 10.3390/genes9070365.

[36] C. A. Bill and J. Summers, “Genomic DNA double-strand breaks are targets for hepadnaviral DNA integration,” Proc.

Natl. Acad. Sci. U. S. A., vol. 101, no. 30, pp. 11135–11140, Jul. 2004, doi: 10.1073/pnas.0403925101.

[37] O. Podlaha et al., “Genomic modeling of hepatitis B virus integration frequency in the human genome,” PLoS One, vol. 14, no. 7, Jul. 2019, doi: 10.1371/journal.pone.0220376.

[38] C. I. Wooddell et al., “Rnai-based treatment of chronically infected patients and chimpanzees reveals that integrated hepatitis b virus DNA is a source of hbsag,” Sci. Transl. Med., vol. 9, no. 409, Sep. 2017, doi:

10.1126/scitranslmed.aan0241.

[39] I. Tout, D. Loureiro, A. Mansouri, V. Soumelis, N. Boyer, and T. Asselah, “Journal Pre-proof Hepatitis B Surface Antigen Seroclearance: Immune Mechanisms, Clinical Impact, Importance for Drug Development,” J. Hepatol., 2020, doi: 10.1016/j.jhep.2020.04.013.

[40] E. Loggi et al., “Virus-Specific Immune Response in HBeAg-Negative Chronic Hepatitis B: Relationship with Clinical Profile and HBsAg Serum Levels,” PLoS One, vol. 8, no. 6, p. e65327, Jun. 2013, doi: 10.1371/journal.pone.0065327. [41] T. Brown, “Southern Blotting,” Curr. Protoc. Immunol., vol. 6, no. 1, pp. 10.6.1-10.6.13, Jun. 1993, doi:

10.1002/0471142735.im1006as06.

[42] D. A. Shafritz, D. Shouval, H. I. Sherman, S. J. Hadziyannis, and M. C. Kew, “Integration of Hepatitis B Virus DNA into the Genome of Liver Cells in Chronic Liver Disease and Hepatocellular Carcinoma: Studies in Percutaneous Liver Biopsies and Post-Mortem Tissue Specimens,” N. Engl. J. Med., vol. 305, no. 18, pp. 1067–1073, 1981, doi: 10.1056/NEJM198110293051807.

[43] F. G. Gao et al., “HBx-DNA probe preparation and its application in study of hepatocarcinogenesis,” World J.

Gastroenterol., vol. 4, no. 4, pp. 320–322, Aug. 1998, doi: 10.3748/wjg.v4.i4.320.

[44] P. Deininger, “Alu elements,” in Genomic Disorders: The Genomic Basis of Disease, J. R. Lupski and P. Stankiewicz, Eds. Humana Press, 2006, pp. 21–34.

[45] P. Deininger, “Alu elements: Know the SINEs,” Genome Biol., vol. 12, Dec. 2011, doi: 10.1186/gb-2011-12-12-236. [46] M. Minami, K. Poussin, C. Brechot, and P. Paterlini, “A novel PCR technique using alu-specific primers to identify

unknown flanking sequences from the human genome,” Genomics, vol. 29, no. 2, pp. 403–408, Sep. 1995, doi: 10.1006/geno.1995.9004.

[47] S. Kawai, O. Yokosuka, F. Imazeki, Y. Maru, and H. Saisho, “State of HBV DNA in HBsAg-negative, anti-HCV-positive hepatocellular carcinoma: Existence of HBV DNA possibly as nonintegrated form with analysis by Alu-HBV DNA PCR and conventional HBV PCR,” J. Med. Virol., vol. 64, no. 4, pp. 410–418, 2001, doi: 10.1002/jmv.1066.

[48] Y. Murakami, M. Minami, Y. Daimon, and T. Okanoue, “Hepatitis B Virus DNA in Liver, Serum, and Peripheral Blood Mononuclear Cells after the Clearance of Serum Hepatitis B Virus Surface Antigen,” J. Med. Virol., vol. 72, no. 2, pp. 203–214, Feb. 2004, doi: 10.1002/jmv.10547.

[49] S. B. Larsson et al., “Integration of hepatitis B virus DNA in chronically infected patients assessed by Alu-PCR,” J. Med.

Virol., vol. 90, no. 10, pp. 1568–1575, Oct. 2018, doi: 10.1002/jmv.25227.

[50] A. Pavlopoulos, “Identification of DNA sequences that flank a known region by inverse PCR.,” in Methods in molecular

biology, vol. 772, V. Orgogozo and M. Rockman, Eds. Humana Press, 2011, pp. 267–275.

[51] T. Tu and A. R. Jilbert, “Detection of hepatocyte clones containing integrated hepatitis B virus DNA using inverse nested PCR,” in Methods in Molecular Biology, vol. 1540, H. Guo and A. Cuconati, Eds. Humana Press Inc., 2017, pp. 97–118. [52] T. Tu, M. A. Budzinska, F. W. R. Vondran, N. A. Shackel, and S. Urban, “Hepatitis B Virus DNA Integration Occurs

Early in the Viral Life Cycle in an In Vitro Infection Model via Sodium Taurocholate Cotransporting Polypeptide-Dependent Uptake of Enveloped Virus Particles,” J. Virol., vol. 92, no. 11, pp. e02007-e2017, 2018, doi:

10.1128/jvi.02007-17.

[53] S. Behjati and P. S. Tarpey, “What is next generation sequencing?,” Arch. Dis. Child. Educ. Pract. Ed., vol. 98, no. 6, pp. 236–238, Dec. 2013, doi: 10.1136/archdischild-2013-304340.

[54] Y. Sun, Y. Qi, B. Peng, and W. Li, “NTCP-reconstituted in vitro HBV infection system,” in Methods in Molecular

Biology, Hepatitis., vol. 1540, H. Guo and A. Cuconati, Eds. New York: Humana Press, 2017, pp. 1–14.

[55] M. Zhou et al., “Productive HBV infection of well-differentiated, hNTCP-expressing human hepatoma-derived (Huh7) cells,” Virol. Sin., vol. 32, pp. 465–475, Sep. 2017, doi: 10.1007/s12250-017-3983-x.

[56] S. Z. Hirschman, P. Price, E. Garfinkel, J. Christman, and G. Acs, “Expression of cloned hepatitis B virus DNA in human cell cultures,” Proc. Natl. Acad. Sci. U. S. A., vol. 77, no. 9, pp. 5507–5511, Sep. 1980, doi: 10.1073/pnas.77.9.5507.

[57] M. A. Sells, M. L. Chen, and G. Acs, “Production of hepatitis B virus particles in Hep G2 cells transfected with cloned hepatitis B virus DNA,” Proc. Natl. Acad. Sci. U. S. A., vol. 84, no. 4, pp. 1005–1009, 1987, doi: 10.1073/pnas.84.4.1005. [58] P. Ruan et al., “Different types of viral-host junction found in HBV integration breakpoints in HBV-infected patients,”

Mol. Med. Rep., vol. 19, no. 2, pp. 1410–1416, Feb. 2019, doi: 10.3892/mmr.2018.9709.

[59] X. Hu et al., “HBV integration-mediated cell apoptosis in HepG2.2.15,” J. Cancer, vol. 10, no. 17, pp. 4142–4150, Jul. 2019, doi: 10.7150/jca.30493.

[60] M. Furuta et al., “Characterization of HBV integration patterns and timing in liver cancer and HBV-infected livers,”

Oncotarget, vol. 9, no. 38, pp. 25075–25088, May 2018, doi: 10.18632/oncotarget.25308.

[61] L. H. Zhao et al., “Genomic and oncogenic preference of HBV integration in hepatocellular carcinoma,” Nat. Commun., vol. 7, pp. 1–10, Oct. 2016, doi: 10.1038/ncomms12992.

[62] Y. Murakami, M. Minami, Y. Daimon, and T. Okanoue, “Hepatitis B Virus DNA in Liver, Serum, and Peripheral Blood Mononuclear Cells after the Clearance of Serum Hepatitis B Virus Surface Antigen,” J. Med. Virol., vol. 72, no. 2, pp. 203–214, Feb. 2004, doi: 10.1002/jmv.10547.

[63] R. Boom, C. J. A. Sol, M. M. M. Salimans, C. L. Jansen, P. M. E. Wertheim-Van Dillen, and J. Van Der Noordaa, “Rapid and simple method for purification of nucleic acids,” J. Clin. Microbiol., vol. 28, no. 3, pp. 495–503, Mar. 1990, doi: 10.1128/jcm.28.3.495-503.1990.

[64] W. K. Sung et al., “Genome-wide survey of recurrent HBV integration in hepatocellular carcinoma,” Nat. Genet., vol. 44, no. 7, pp. 765–769, Jul. 2012, doi: 10.1038/ng.2295.

[65] Promega, “GoTaq ® Long PCR Master Mix Instructions for Use of Product M4021,” May 2017.

[66] P. R. Galle, J. Hagelstein, B. Kommerell, M. Volkmann, P. Schranz, and H. Zentgraf+, “In Vitro Experimental Infection of Primary Human Hepatocytes With Hepatitis B Virus,” Gastroenterology, vol. 109, no. 3, p. 664, Mar. 1994.

[67] P. Gripon et al., “Hepatitis B virus infection of adult human hepatocytes cultured in the presence of dimethyl sulfoxide.,”