University of Groningen Exploring the metabolic potential of Penicillium rubens Viggiano, Annarita

(1)

University of Groningen

Exploring the metabolic potential of Penicillium rubens

Viggiano, Annarita

DOI:

10.33612/diss.126598491

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below.

Document Version

Publisher's PDF, also known as Version of record

Publication date: 2020

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA):

Viggiano, A. (2020). Exploring the metabolic potential of Penicillium rubens. University of Groningen. https://doi.org/10.33612/diss.126598491

Copyright

Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

Take-down policy

If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum.

(2)

CHAPTER 3 A promoter replacement and episomal plasmid

approach for the overexpression of two

low-expressed PKS-NRPS hybrid genes in

Penicillium rubens

Annarita Viggiano1_{, Alka Rao}1_{, Roel A.L. Bovenberg}2,3_, and Arnold J.M. Driessen1

1_{Molecular Microbiology, Groningen Biomolecular Sciences and Biotechnology Institute,} University of Groningen, Groningen, The Netherlands

2_{DSM Biotechnology Centre, Delft, The Netherlands}

3_{Synthetic Biology and Cell Engineering, Groningen Biomolecular Sciences and} Biotechnology Institute, University of Groningen, Groningen, The Netherlands

(3)

ABSTRACT

Filamentous fungi produce a wide range of bioactive molecules, many of which have interesting properties for human applications. Genomic data shows that the metabolic potential of these microorganisms is not fully exploited, as several biosynthetic gene clusters are silent or low-expressed under standard laboratory conditions and therefore their products are not known. A valid strategy to awaken these genes is promoter replacement, which makes the expression less dependent on environmental conditions. Here, we applied this approach to express two low-expressed polyketide synthase – non ribosomal peptide syn-thetase (PKS-NRPS) hybrid genes in Penicillium rubens. To overcome the possible epigenetic regulation in their original chromosomal locus, the genes were placed on an AMA1 (autonomous maintenance in

Aspergil-lus) plasmid. This resulted in a significant overexpression of the target

genes, but no new compounds could be detected in the culture broth and intracellular. Nonetheless, the approach used can be a valid tool for awakening other endogenous or heterologous biosynthetic genes, which could result in the production on novel bioactive metabolites.

(4)

3

INTRODUCTION

Filamentous fungi are an incredible source of bioactive molecules, named secondary metabolites. Secondary metabolites found many applications in medicine, agriculture and the food industry, improving significantly the expectancy and quality of our lives. Some examples include antibiotics (penicillin, cephalosporin) (1, 2), immunosuppressants (cyclosporins) (3), cholesterol-lowering drugs (statins) (4), anti-osteopo-rosis drugs (orsellinic acid derivatives) (5), antifungals (griseofulvin) (6) and food additives (carotenoids) (7). The increasing number of fungal genomes sequenced reveals that several secondary metabolite bio-synthetic genes are silent or low-expressed under standard labora-tory conditions (8, 9). Therefore, many novel compounds with unique chemical structures and with potential important biological activities could be still discovered.

Secondary metabolite genes are tightly regulated. Their activation is mediated by specific transcription factors as well as global and epi-genetics regulators and depends on specific conditions like carbon, nitrogen and other nutrient sources, pH, stimuli from other microor-ganisms and many other factors (10). In order to overcome the complex regulation system, the promoters of the silent genes can be exchanged with known and well characterized promoters for their expression. This approach resulted in the discovery of several new molecules. Replace-ment of the native promoter of the transcription factor apdR with the strong inducible alcohol dehydrogenase alcA promoter induced the ex-pression of a silent gene cluster containing a polyketide synthase – non ribosomal peptide synthetase (PKS-NRPS) hybrid in Aspergillus nidulans. This led to the production of the toxins aspyridones (11). Another new

compound was discovered few years later in the same organism using the same approach. When the native promoter of the regulator scpR was exchanged with the alcA promoter, two silent NRPSs genes and a gene cluster containing a PKS were expressed. The two NRPS genes were located nearby the regulator, while the PKS gene cluster was on another chromosome. When activated, the PKS gene cluster produced a novel compound, the asperfuranone (12).

Penicillium rubens produces many diverse secondary metabolites (13,

14). Besides the well-known β-lactam antibiotics (1), several other mole-cules have been isolated, including the mycotoxins roquefortines (15) and

(5)

3: A pr omo ter replac emen

t and episomal plasmid appr

oach f or the o ver expr ession o f tw o lo w-e xpr essed PKS-NRPS h ybrid g enes in Penicillium rubens

the pigments chrysogine (16) and sorbicillinoids (17). Although P. rubens has been exploited in industry for more than seventy years, its metabolic potential was revealed only one decade ago when the genome of the industrial strain Wisconsin 54-1255 was sequenced (13). The genome sequencing showed the presence of 10 NRPSs, 20 PKSs and 2 PKS-NRPS hybrid genes. Many of these secondary metabolite biosynthetic genes appeared to be silent or low expressed under the laboratory conditions tested and therefore new valuable molecules could still be uncovered in this organism (13). This situation was even more preeminent in indus-trial strains of P. rubens, as the classical strain improvement program has led to the mutational inactivation of various gene clusters as well as transcriptional down-regulation (18). Among the very low-expressed genes, the PKS-NRPS hybrids represent an intriguing class of enzymes, considering their capacity for novel and complex chemistry.

PKS-NRPS hybrids are found in many filamentous fungi and have been likely acquired from bacteria through horizontal gene transfer (19). The PKS component of these enzymes has the typical organization of a highly reducing PKS (HR-PKS), having the acyl carrier protein (ACP), ketosynthase (KS), acyltransferase (AT), dehydratase (DH), methyl-transferase (MT) and ketoreductase (KR) domains. If present, the enoyl reductase (ER) domain is not active. Its function is not essential for the formation of the molecule or can be complemented by ER proteins present in the same biosynthetic gene cluster or somewhere else in the genome (20). Interestingly, the PKS part of the hybrids shows high homology with the nonaketide synthase involved in the biosynthesis of the cholesterol-lowering agent lovastatin, suggesting they could have a common ancestor (20, 21). The PKS portion works by an iterative mechanism using acetyl coenzyme A (CoA) and malonyl-CoA as building blocks. The condensation (C) domain of the NRPS fuses the polyketide chain to a specific amino acid activated by the adenylation (A) domain of the NRPS moiety (20).

The mycotoxin fusarin C is the first fungal PK-NRP molecule discov-ered (22). Since then, several other hybrids have been investigated, including the toxin aspyridone (11), the immunosuppressive agent pseu-rotin A (23), the insecticidal tenellin (24). The PK-NRP metabolites have complex and unique chemical structures, which show a wide range of biological activities, making them highly attractive for human applications. In this work, we overexpressed the two low-expressed

(6)

3

PKS-NRPS hybrid genes of P. rubens. A previous attempt of

overex-pression of these genes was performed by using the Q-system based transcription control device, which was proved to regulate efficiently the penicillin biosynthetic gene cluster (BGC) (25). However, this strat-egy led to an insignificant overexpression of the two PKS-NRPS hybrid genes. Therefore, we chose a strong promoter from the penicillin BGC to drive their expression and opted for an episomal plasmid approach, in order to overcome the possible epigenetic regulation. The results of the study are described in this chapter. The episomal overexpression driven by a strong promoter represents a valid approach for awakening other endogenous or heterologous secondary metabolite genes, which could lead to the discovery of novel bioactive molecules.

MATERIAL AND METHODS

Bioinformatics tools

AntiSMASH version 4.1.0 (26) was used to identify the domain orga-nization of Pc14g00080 and Pc16g13930 and predict the substrate specificity. The protein sequences of the two PKS-NRPS hybrids were blasted against a database of 19 Penicillium species using MultiGene-Blast (27) (P. rubens Wisconsin 54-1255, P. antarcticum strain IBT 31811,

P. arizonense strain CBS 141311, P. brasilianum, P. camemberti str. FM013, P. coprophilum strain IBT 31321, P. decumbens strain IBT 11843, P. digitatum Pd1, P. expansum strain MD-8, P. flavigenum strain IBT 14082, P. freii strain DAOM 242723, P. griseofulvum strain PG3, P. italicum strain PHI-1, P. nal-giovense strain IBT 13039, P. oxalicum 114-2, P. polonicum strain IBT 4502, P. roqueforti FM164, P. steckii strain IBT 24891, P. vulpinum strain IBT 29486).

Fungal strains, media and culture conditions

P. rubens ΔpenΔchryΔroqΔhcpA (named as 4KO from now on, Pohl

et al., submitted) was used for the overexpression of Pc14g00080 and

Pc16g13930 genes. Conidiospores immobilized on rice were grown in

YGG (28) for 48 h to obtain protoplasts (29). Transformants were se-lected and purified on acetamide agar medium (28), while secondary metabolite production (SMP) agar medium (15) was used for prepar-ing long-term storage rice batches. In the case of the overexpressprepar-ing strains, the SMP medium lacked urea and CH3COONH4 and it was

(7)

supplemented with 2 g/L acetamide, in order to maintain the plasmids. For RNA extraction and metabolite analysis, the parental and the over-expression strains were inoculated in the respective SMP medium and samples were collected as indicated. All cultivations were performed as 25 ml cultures in 100 ml erlenmeyer flasks shaken at 200 rpm and 25°C. Strains were grown in biological triplicates for gene expression and metabolite analysis.

Construction and validation of the overexpressing strains

The plasmids carrying the Pc14g00080 or Pc16g13930 genes were built by in vivo homologous recombination in P. rubens, by using 100 bp homologous regions. A construct containing the marker amdS and the strong pcbC promoter was amplified from pAV2_5. The PKS-NRPS genes were amplified into two parts from genomic DNA (gDNA) of

P. rubens DS68530. All PCR products were transformed together with

the AMA1 (autonomous maintenance in Aspergillus) (30) based vector pDSM-JAK-108 (31), previously linearized with BglII and NotI restriction enzymes. 1 µg of the fragment containing amdS and the pcbC promoter was delivered during the transformation, while 2 µg were used for all the other parts and plasmid backbone. The fungal transformation was performed following a standard protocol (29).

To validate the strains, DNA from colonies on SMP plates was isolated using the E.Z.N.A. Fungal DNA Mini Kit (Omega). The correct recom-bination of the parts was checked by PCR, by amplifying the overlap regions. This was done by using a forward primer binding in one genetic part and the reverse primer binding in another genetic part, which was designed to recombine with the previous one. Therefore only a suc-cessful recombination could result in a PCR amplification. All primers used are listed in table 1.

RNA extraction, cDNA amplification and qPCR analysis

Total RNA was isolated from the 4KO and the overexpression strains after 48 h of growth in the respective SMP medium, by using the Trizol™ (Invitrogen) extraction method with additional DNAse treatment (Turbo DNA-free™ kit, Ambion). For the cDNA synthesis, 1 µg of RNA was used (MaximaTM_{H Minus, Thermo Scientific). The}

γ

_{-actin gene was used}

for normalization. The expression levels were measured in technical duplicates with a MiniOpticon™ system (Bio-Rad) using the Bio-Rad

(8)

3

Table 1. Oligonucleotide primers used for amplification, validation of the constructs and qPCR.

Primer name Sequence (5’-3’) Cloning Pc14_part1_fw ATGACAGGTGATCTTCAGCACAC Pc14_part1_rv TTTCGCTAGCGTATTTCGTAAGGACGGGTGACAGGGAGAAATC AGGGTCCAACACAGCCAATGTCGTTCCCGATCGAAGCTGTTC CAGCATAGAGAGAGCAAGGAAATGGAAATAGAGGGTGAACATC Pc14_part2_fw GCTCTCTCTATGCTGGAACAGC Pc14_part2_rv CCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGT GAGCGCGCGTAATACGACTCACTATAGGGCGAATTGGAGCTC CACCGCGGTGGCGGCCGTGCATCAACCAAGTGTATCCTTCTTAC Pc16_part1_fw ATGAGTGGGACAAACGAGCCC Pc16_part1_rv ACTAAGAGAAATCTTGAGTATCATAAAATGCTTACAGAAAACAA TCACGTACCTGATTGGCTGAGGCGTAGTTCGCTTGTCCGGGAT TACCTAGTGAGGGTGAGGGTGAACATTAAGGTTCTCACTG Pc16_part2_fw CCTCACTAGGTAATCCCGGACAAG Pc16_part2_rv CCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGT GAGCGCGCGTAATACGACTCACTATAGGGCGAATTGGAGCTC CACCGCGGTGGCGGCCCATCCTCTGAGTGACACGAACTGG amdS_pPcbC_fw CTTATTAATTTGATGTAGGTAAGCCCGCCACAAATATATATTTTT ACAAGATACCGTGGAAAAACTTCGTGCTATCACAAAACAGTAT ACAAAAAATAAGTGGATCCCCCGGGCTGCAGG amdS_pPcbC_Pc14_rv GATCCCATAGCTTGGAAGGTGTTGTTGCATCACCAGGAAAGCG GCAAGCACTTCCCACAATGGCAATCGGCTCCCCGGTGTGCTGA AGATCACCTGTCATGGTGTCTAGAAAAATAATGGTGAAAAC amdS_pPcbC_Pc16_rv GGTGGTGCAAAAGATCCCATAGCCTGGAAGGAGAGCTGGCG TTGCCTGGGAATCGACAGCCAGTTCCAATGATGGCAATGGGC TCGTTTGTCCCACTCATGGTGTCTAGAAAAATAATGGTGAA Validation PCR pDSM-JAK-108_1 ACTTTTACCCTAAAGTAGCTTGCTTGTG pDSM-JAK-108_2 TGAAGACAATACCTGAACCATCACCCTAATCAAGTTT amdS_pPcbC_check_1 TGAAGACAAGTCATCCGCAGGCAGCGTCTG amdS_pPcbC_check_2 ACAGCGGAAGACAACATTGGTGTCTAGAAAAATAATGGTGAA Pc14_check_1 CCCTGTTCGTTATGTCACTGGATC Pc14_check_2 CCGTTCACCAATCCGGTACTGC Pc16_check_1 GAGCAGCAAGGCCAACCATAAAC Pc16_check_2 GTTATGCCGCGACTGATGAAGG qPCR Pc14_qPCR_fw ACGTACGCTCGAGCTGGACT Pc14_qPCR_rv GCCGTCGCGTTGATAATTGG Pc16_qPCR_fw CCACCCTTGTTCAGCCGCTGAATTCC Pc16_qPCR_rv GGACGAGGCGAACAACATCGGAC Actin_fw CGACTACCTGATGAAGATCCTCGC Actin_rv GTTGAAGGTGGTGACGTGGATACC

(9)

CFX™ manager software, which determines the threshold cycle (Ct) values automatically by regression. The SensiMix™ SYBR Hi-ROX kit (Bioline) was used as mastermix for qPCR. The reactions were run as follows: 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec, 58°C for 30 sec and 72°C for 30 sec.

Metabolite profiling

Colonies of the 4KO and overexpression strains were transferred from the acetamide agar medium to SMP medium plates and grown for 9 days. For the extraction of the extracellular metabolites, the protocol from Guzmán-Chávez et al. (32) was followed. The intracellular metabolites were extracted following a modified protocol from Vrabl et al. (33). The parental and overexpressing strains were also grown in liquid culture and samples were taken after 96 h. In order to collect the extracellular metabolites, 2 ml of culture were centrifuged at full speed for 10 min and the supernatant was filtered with 0.2 µm polytetrafluorethylene (PTFE) syringe filters and stored at -80°C. The analysis of secondary metabolites was performed with an Accella1250™ HPLC system cou-pled with the ES-MS Orbitrap Exactive™ (Thermo Fisher Scientific, CA), following the method described by Salo et al. (17).

RESULTS

Bioinformatics analysis of the PKS-NRPS hybrids

The PKS-NRPS hybrids Pc14g00080 and Pc16g13930 of P. rubens are large enzymes of about 429 and 435 kDa, respectively. While the PKS part has the domain organization of a HR-PKS, the NRPS component consists of the condensation (C), adenylation (A), peptidyl carrier protein (PCP) and thioesterase (TE) domains. The software antiSMASH (26) predicts that the A domain of Pc14g00080 utilizes leucine, while no reliable prediction is available for Pc16g13930.

We blasted the protein sequences of the two hybrids against a da-tabase of 19 Penicillium species. Pc14g00080 is highly conserved in 9 organisms, while Pc16g13930 shows >80% homology only with ho-mologs from P. expansum and P. coprophilum (Fig.1). The function of the homologous proteins is not known. Furthermore, the results of the blast show that the genes flanking Pc16g13930 are also conserved in

(10)

3

P. expansum and P. coprophilum. AntiSMASH predicts that these genes

codify for an alcohol dehydrogenase (light green), a hydrolase (dark green) and a putative transporter (red). No function is suggested for the other genes. More variety is evident in the case of Pc14g00080. Some genes flanking Pc14g00080 are unique of P. rubens (no function is predicted), while extra genes are present in P. vulpinum, P. expansum and P. griseofulvum. P. roquerforti, P. italicum and P. digitatum have only few highly homologous neighboring genes. The gene depicted in light green is a putative transporter, while the gene in violet is a putative enoyl-transferase.

Expression of the PKS-NRPS hybrid genes

The PKS-NRPS hybrid Pc14g00080 and Pc16g13930 genes are ex-pressed at low levels and are not associated with any secondary me-tabolite in P. rubens Wisconsin 54-1255 and the industrial DS17690 strain (13). qPCR confirmed the low gene expression level in the 4KO strain (Fig.2, Pohl et al., submitted). This strain is deleted of the four highest expressed secondary metabolite gene clusters, responsible for the biosynthesis of penicillin, roquefortine, chrysogine and hydrophobic cyclic tetrapeptides. Since its metabolic profile is devoid of the these

P. chrysogenum P. coprophilum P. expansum Pc14g00080 P. chrysogenum P. polonicum P. roqueforti P. coprophilum P. vulpinum P. expansum P. griseofulvum P. italicum P. digitatum P. flavigenum Pc16g13930

Fig.1 Hybrid PKS-NRPS in P. rubens and other Penicillium species, showing >80% homol-ogy in the protein sequence. Flanking genes are also represented. Homologous genes are

(11)

oach f or the o ver expr ession o f tw o lo w-e xpr essed PKS-NRPS h ybrid g enes in

Penicillium rubens abundantly produced compounds, the detection of novel molecules is _{facilitated when analyzing the culture broth of the 4KO strain.}

There-fore, this strain was chosen for the overexpression strategy.

Pc14g00080 and Pc16g13930 were cloned into an episomal

AMA1-based plasmid, under the control of the strong pcbC promoter. The plasmids were built by in vivo homologous recombination (Fig.3a–b). The marker amdS and the pcbC promoter were amplified as a single PCR product, using pAV2_5 as template. The forward primer contained 100 bp homologous to the backbone plasmid and the reverse primer had homology to the 5’ flank of the target gene. Due to their size (about 12 kb), Pc14g00080 and Pc16g13930 were amplified in two fragments, including the original terminator. In this case, only the reverse primers had 100 bp homology with the downstream part. The homologous re-gions allowed an efficient recombination when transformed together with the linearized pDSM-JAK-108 backbone vector.

The transformants carrying the plasmids appeared as red colonies, due to the presence of the DsRed gene on the vector. The correct assembly was checked by PCR amplification of the overlap regions, where the recombination occurred. The presence of PCR products of the expected size indicated a correct recombination of the genetic parts. By using a primer binding the backbone plasmid and a primer

0 50 100 150 200 250 300 350 400 450 500 Pc14g00080 Pc16g13930 parental strain OE_strain 1 OE_strain 2 OE_strain 3

fold change relative to the parental strain

Fig.2 Expression of Pc14g00080 and Pc16g13630 genes in the overexpression strains. Three

different biological replicates are represented (OE_Pc14 and OE_Pc16). Data are shown as fold change compared to the parental 4KO strain.

(12)

3

Fi g. 3 Cons tructi on and va lida tion of t he ov er ex pr es si on st ra ins . R ep resen ta tion of t he D N A fr agm en ts deliv er ed du ring the fu ngal tr ansf orm ation (A) and in viv o rec ombined plasmid (B). PCR analy sis to check the corr ect assembly o f the gene tic parts in thr ee biolo gical replica tes: lane 1, actin gene; lane 2, o verlap be tw

een plasmid and

amd

S; lane 3, o

verlap be

tw

een h

ybrid part 2 and plasmid; lane 4, o

verlap be tw een pcb C pr omo ter and h ybrid part 2 ( C). A m dS H yb rid p1 H yb rid p2

+

AMA1 DsRed Cam pP cb C tCam pCam Cam DsRed AmdS Hybrid pAn045 pGpdA tAct AMA1 tAmdS pPcbC tHybrid ori 1 2 3 4 1 2 3 4 1 2 3 4 1 2 3 4 1 2 3 4 1 2 3 4 Pc14g00080 transformants Pc16g13930 transformants 1 kb 1 kb 3 kb 3 kb 6 kb 6 kb 1 2 3 1 2 3 A B C

(13)

binding amdS, the recombination between the vector and the fragment carrying amdS and the pcbC promoter could be confirmed. PCR on the other genetic parts proved that the recombination was successful. Three biological replicates showed the expected recombination pattern

(Fig.3c). After purification, rice batches were prepared to store the spores. The parental and overexpression strains were inoculated and grown for 48 h in a SMP medium to analyze the gene expression. In the case of the transformant strains, the medium was supplemented with acetamide as a sole nitrogen source for plasmid maintenance. qPCR showed that the expression of both the Pc14g00080 and

Pc16g13930 genes was higher in the transformant strains compared

to the parental strain (Fig.2). Since the level of expression in the pa-rental strain was extremely low for both the genes, any small increase in mRNA production in the mutants resulted in a large fold change.

Pc14g00080 was expressed up to 450 times more, while Pc16g13930

was upregulated to 30 times. However, the expression of Pc14g00080 and Pc16g13930 was still very low when compared to the constitutive actin gene used as a reference.

Metabolite analysis of the overexpression strains

In order to identify the metabolites produced by the two PKS-NRPS hybrid genes, the overexpression strains were transferred from acet-amide agar plate to SMP medium plates. Intracellular and extracellular metabolites were collected after 9 days of growth. All the strains were also grown in liquid culture. Conidia immobilized on rice were inoculated in SMP medium and intracellular and extracellular samples were taken after 96 h. However, no new compounds were detected compared to the parental strain, when all the samples were analyzed by LC-MS.

DISCUSSION

Novel bioactive secondary metabolites could be discovered by acti-vating the gene clusters that are silent under laboratory conditions. In this work, we used a strong promoter and an AMA1 plasmid-based expression for upregulating the two low-expressed PKS-NRPS hybrid genes in P. rubens.

(14)

3

Pc14g00080 and Pc16g13930 show high homology with hybrids

from other Penicillium species. Many neighboring genes have also homologs, but for most of them no prediction of their function is available. Therefore, it is difficult to define if the hybrids belong to a biosynthetic gene cluster. For this reason, we chose to investigate only the role of the PKS-NRPS, planning to overexpress the flanking genes in a later stage, if any novel compounds would be produced by awakening the hybrids.

In a previous study, we attempted to overexpress Pc14g00080 and

Pc16g13930 genes in their native chromosomal loci, using the Q- system

based transcription control device (25). In this system, the native pro-moter of the target gene is replaced by short palindromic repeated sequences (Upstream Activation Sequences, UAS) followed by a core promoter. The UAS recruit the synthetic transcription factor, which brings the RNA polymerase on the core promoter, driving the expres-sion of the gene of interest. A construct containing the transcription factor, the amdS marker and 5 times repeated UAS followed by the

pcbC core promoter was correctly integrated in front of Pc14g00080

and Pc16g13930, by homologous recombination. However, no significant overexpression could be observed when 4 different replicates per over-expression strains were checked by qPCR: the changes in over-expression were between 1.5 and 4 times, with very low values relative to the actin gene (data not shown).

It has been shown that the Q-system regulates efficiently the ex-pression of the penicillin gene cluster in P. rubens (25). Therefore, we speculate that it failed to overexpress the two PKS-NRPS hybrid genes because of their location on the chromosome, which could be highly condensed in a state of heterochromatin and therefore not accessible to the transcription machinery. Pc14g00080 and Pc16g13930 are located in the telomeric and subtelomeric regions of chromosome 1, respec-tively. Guzman-Chavez et al. showed that the deletion of the histone deacetylase gene hdaA had a broad impact on the secondary metab-olism of P. rubens, but not significant on the hybrid genes (32). While

Pc14g00080 was slightly upregulated in the ΔhdaA strain (2 times more

than the parental strain), there was no effect on Pc16g13930. This could still suggest that the epigenetic regulation of the hybrids is mediated by other factors. Therefore, we decided to express the genes outside of their original locus in the genome, by choosing an episomal strategy.

(15)

Moreover, the use of a strong promoter together with the occurrence of the AMA1 plasmids in multiple copies (34) should guarantee a high expression of the gene of interest. When three biological replicates were selected for qPCR analysis, we could observe that both Pc14g00080 and

Pc16g13930 genes were expressed significantly more than in the parental

strain (Fig.2). The variety of expression among the samples could be due to the occurrence of different copy numbers of the pAMA plasmids in the cells. Although we can consider the strategy to awaken silent genes successful, it is important to stress that the expression of Pc14g00080 and Pc16g13930 is remarkably low as compared to the constitutive actin gene. Moreover, in other projects where the pcbC promoter was used to drive homologous or heterologous genes in P. rubens, the gene expression level was high when compared to actin (data not shown). The low expression of Pc14g00080 and Pc16g13930 in the transformant

strains could be caused by mRNA instability, as these are large genes. Furthermore, it is possible that the overexpression plasmids themselves are unstable. Being present in multiple copies in a strain with a highly efficient homologous recombination system, the homologous DNA sequences on the vectors could recombine with each other and modify the open reading frames. The plasmids were validated from colonies on plate, but we cannot exclude they underwent modifications during the several days of the fermentation.

The intermediate compounds in a biosynthetic pathway might be retained inside the cells and only the final metabolites might be trans-ported through the membrane. In this work, we overexpressed only the PKS-NRPS hybrid genes, and not the other genes of the potential cluster. Therefore, we could not anticipate where the possible products of the hybrids could be localized. For this reason, we analyzed both intracellular and extracellular samples. However, no new compounds were detected. The absence of novel metabolites could be due to an insufficient gene expression and/or incorrect protein folding. Moreover, the new metabolites could be instable and therefore not detected by LC-MS analyses. Pc14g00080 and Pc16g13930 were not mutated during the process of industrial strain improvement (18), but we could speculate that long ago they have undergone mutations which resulted in unstable mRNA or protein. In this case, it would not be possible to produce any active PKS-NRPS hybrids and therefore new compounds, independently of the gene overexpression approach used.

(16)

3

In conclusion, building constructs on a plasmid by homologous

re-combination is highly efficient and does not require clustered regularly interspaced short palindromic repeats (CRISPR)-associated RNA-guided DNA endonucleases (Cas9) genome editing, as the plasmid can be lin-earized before transformation. Here, we chose a host strain deleted of the hdfA gene, which is involved in the non-homologous end joining (NHEJ) DNA repair pathway. This favors the homologous recombination (HR) system, allowing a more efficient in vivo assembly of the genetic constructs. In fact, we successfully built the overexpression cassettes by co-transforming the backbone vector with 3 DNA fragments having only 100 bp overlap regions. The episomal plasmid approach allows to overcome the possible epigenetic regulation, as the target genes are not overexpressed in the native chromosomal locus, which could be in a state of heterochromatin. The usage of a strong promoter com-bined with the presence of the plasmid in multiple copies results in the overexpression of the genes of interest. Here, the two hybrids showed very low expression when compared with the constitutive actin gene – which might be due to instable mRNA. Nonetheless, this strategy could be used for the overexpression of other endogenous or heterologous secondary metabolite genes, which could be responsible for the production of novel bioactive molecules.

ACKNOWLEDGEMENTS

The research was supported by a grant from the People Programme (Marie Curie Actions) of the European Union’s Seventh Framework Programme FP7/2007-2013, under grant 607332. We thank Milda Atkocaityte for her contribution in building and analyzing the overex-pression strains carrying the Q-system.

(17)

REFERENCES

1. Fleming A. 1929. On the antibacterial action of cultures of a Penicillium, with special reference to their use in the isolation of B. influenzae. Br J Exp Pathol 10:226–236. 2. Perlman D, Bodanszky M. 1971. Biosynthesis of peptide antibiotics. Annu Rev

Biochem 40:449–464.

3. Tedesco D, Haragsim L. 2012. Cyclosporine: A Review. J Transplant 2012. 4. Manzoni M, Rollini M. 2002. Biosynthesis and biotechnological production of

statins by filamentous fungi and application of these cholesterol-lowering drugs. Appl Microbiol Biotechnol 58:555–564.

5. Bok JW, Chiang YM, Szewczyk E, Reyes-Domingez Y, Davidson AD, Sanchez JF, Lo HC, Watanabe K, Strauss J, Oakley BR, Wang CCC, Keller NP. 2009. Chroma-tin-level regulation of biosynthetic gene clusters. Nat Chem Biol 5:462–464. 6. Bills GF, Gloer JB. 2016. Biologically Active Secondary Metabolites from the Fungi.

Microbiol Spectr 4.

7. Gmoser R, Ferreira JA, Lennartsson PR, Taherzadeh MJ. 2017. Filamentous Asco-mycetes fungi as a source of natural pigments. Fungal Biol Biotechnol 4. 8. Brakhage AA, Schroeckh V. 2011. Fungal secondary metabolites - Strategies to

activate silent gene clusters. Fungal Genet Biol 48:15–22.

9. Hertweck C. 2009. Hidden biosynthetic treasures brought to light. Nat Chem Biol 5:450–452.

10. Brakhage AA. 2013. Regulation of fungal secondary metabolism. Nat Rev Microbiol 23:21–32.

11. Bergmann S, Schümann J, Scherlach K, Lange C, Brakhage AA, Hertweck C. 2007. Genomics-driven discovery of PKS-NRPS hybrid metabolites from Aspergillus nidulans. Nat Chem Biol 3:213–217.

12. Bergmann S, Funk AN, Scherlach K, Schroeckh V, Shelest E, Horn U, Hertweck C, Brakhage AA. 2010. Activation of a silent fungal polyketide biosynthesis pathway through regulatory cross talk with a cryptic nonribosomal peptide synthetase gene cluster. Appl Environ Microbiol 76:8143–8149.

13. van den Berg M, Albang R, Albermann K, Badger J, Daran J, Driessen A, Garcia-Es-trada C, Fedorova N, Harris D, Heijne W, Joardar V, Kiel J, Kovalchuk A, Martín J, Nierman W, Nijland J, Pronk J, Roubos J, van der Klei I, van Peij N, Veenhuis M, von Döhren H, Wagner C, Wortman J, Bovenberg R. 2008. Genome sequencing and analysis of the filamentous fungus Penicillium chrysogenum. Nat Biotechnol 26:1161–1168.

14. Frisvad JC, Smedsgaard J, Larsen TO, Samson RA. 2004. Mycotoxins , drugs and other extrolites produced by species in Penicillium subgenus Penicillium. Stud Mycol 49:201–241.

15. Ali H, Ries MI, Nijland JG, Lankhorst PP, Hankemeier T, Bovenberg RAL, Vreeken RJ, Driessen AJM. 2013. A Branched Biosynthetic Pathway Is Involved in Production of Roquefortine and Related Compounds in Penicillium chrysogenum. PLoS One 8. 16. Viggiano A, Salo O, Ali H, Szymanski W, Lankhorst PP, Nygård Y, Bovenberg RAL, Driessen AJM. 2018. Pathway for the Biosynthesis of the Pigment Chrysogine by Penicillium chrysogenum. Appl Environ Microbiol 84.

17. Salo O, Guzmán-Chávez F, Ries MI, Lankhorst PP, Bovenberg RAL, Vreeken RJ, Driessen AJM. 2016. Identification of a polyketide synthase involved in sorbicillin biosynthesis by Penicillium chrysogenum. Appl Environ Microbiol 82:3971–3978.

(18)

3

18. Salo O, Ries M, Medema MH, Lankhorst PP, Vreeken RJ, Bovenberg RAL, Dries-sen AJM. 2015. Genomic mutational analysis of the impact of the classical strain improvement program on β–lactam producing Penicillium chrysogenum. BMC Genomics 16.

19. Lawrence DP, Kroken S, Pryor BM, Arnold AE. 2011. Interkingdom gene transfer of a hybrid NPS/PKS from bacteria to filamentous Ascomycota. PLoS One 6. 20. Boettger D, Hertweck C. 2013. Molecular Diversity Sculpted by Fungal PKS-NRPS

Hybrids. ChemBioChem 14:28–42.

21. Hendrickson L, Davis CR, Roach C, Nguyen DK, Aldrich T, McAda PC, Reeves CD. 1999. Lovastatin biosynthesis in Aspergillus terreus: characterization of blocked mutants, enzyme activities and a multifunctional polyketide synthase gene. Chem Biol 6:429–439.

22. Song Z, Cox RJ, Lazarus CM, Simpson TJ. 2004. Fusarin C biosynthesis in Fusarium moniliforme and Fusarium venenatum. ChemBioChem 5:1196–1203.

23. Komagata D, Fujita S, Yamashita N, Saito S, Morino T. 1996. Novel Neuritogenic Activities of Pseurotin A and Penicillin Acid. J Antibiot N 49:958–959.

24. Eley KL, Halo LM, Song Z, Powles H, Cox RJ, Bailey AM, Lazarus CM, Simpson TJ. 2007. Biosynthesis of the 2-pyridone tenellin in the insect pathogenic fungus Beauveria bassiana. ChemBioChem 8:289–297.

25. Mózsik L, Büttel Z, Bovenberg RAL, Driessen AJM, Nygård Y. 2019. Synthetic control devices for gene regulation in Penicillium chrysogenum. Microb Cell Fact 18.

26. Blin K, Wolf T, Chevrette MG, Lu X, Schwalen CJ, Kautsar SA, Suarez Duran HG, De Los Santos ELC, Kim HU, Nave M, Dickschat JS, Mitchell DA, Shelest E, Breitling R, Takano E, Lee SY, Weber T, Medema MH. 2017. AntiSMASH 4.0 - improvements in chemistry prediction and gene cluster boundary identification. Nucleic Acids Res 45:W36–W41.

27. Medema MH, Takano E, Breitling R. 2013. Detecting sequence homology at the gene cluster level with multigeneblast. Mol Biol Evol 30:1218–1223.

28. Kovalchuk A, Weber SS, Nijland JG, Bovenberg RAL, Driessen AJM. 2012. Chapter 1 Fungal ABC Transporter Deletion and Localization Analysis. Methods Mol Biol 835:1–16.

29. Weber SS, Kovalchuk A, Bovenberg RAL, Driessen AJM. 2012. The ABC transporter ABC40 encodes a phenylacetic acid export system in Penicillium chrysogenum. Fungal Genet Biol 49:915–921.

30. Gems D, Johnstone IL, Clutterhuck AJ. 1991. An autonomously replicating plasmid transforms Aspergillus nidulans at high frequency. Gene 98:61–67.

31. Bovenberg RAL, Kiel JAKW, Wenzel TJ, Los AP. 2014. US 2014/0106398 A1. 32. Guzman-Chavez F, Salo O, Samol M, Ries M, Kuipers J, Bovenberg RAL, Vreeken

RJ, Driessen AJM. 2018. Deregulation of secondary metabolism in a histone deacetylase mutant of Penicillium chrysogenum. Microbiologyopen.

33. Vrabl P, Artmann DJ, Schinagl CW, Burgstaller W. 2016. Rapid sample processing for intracellular metabolite studies in Penicillium ochrochloron CBS 123.824: the FiltRes-device combines cold filtration of methanol quenched biomass with resuspension in extraction solution. Springerplus 5.

34. Fierro F, Kosalková K, Gutiérrez S, Martín JF. 1996. Autonomously replicating plas-mids carrying the AMA1 region in Penicillium chrysogenum. Curr Genet 29:482–489.

(19)