University of Groningen Exploring the metabolic potential of Penicillium rubens Viggiano, Annarita

(1)

University of Groningen

Exploring the metabolic potential of Penicillium rubens

Viggiano, Annarita

DOI:

10.33612/diss.126598491

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below.

Document Version

Publisher's PDF, also known as Version of record

Publication date: 2020

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA):

Viggiano, A. (2020). Exploring the metabolic potential of Penicillium rubens. University of Groningen. https://doi.org/10.33612/diss.126598491

Copyright

Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

Take-down policy

If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum.

(2)

CHAPTER 4 Heterologous expression of the early genes from

the clavulanic acid biosynthetic gene cluster into

Penicillium rubens

Annarita Viggiano1_{, László Mózsik}1_{, Luc Z. van Schie}1_{, Wiktor Szymanski}2,3_, Roel A.L. Bovenberg4,5_{, and Arnold J.M. Driessen}1

1_{Molecular Microbiology, Groningen Biomolecular Sciences and Biotechnology Institute,}

University of Groningen, Groningen, The Netherlands

2_{Department of Radiology, University Medical Center Groningen, University of}

Groningen, Groningen, The Netherlands

3_{Centre for Systems Chemistry, Stratingh Institute for Chemistry, University of}

Groningen, Groningen, The Netherlands

4_{DSM Biotechnology Centre, Delft, The Netherlands}

5_{Synthetic Biology and Cell Engineering, Groningen Biomolecular Sciences and}

(3)

ABSTRACT

Filamentous bacteria of the Streptomyces genus produce many diverse bioactive molecules, including several commercially used antibiotics. As many secondary metabolite biosynthetic gene clusters (BGCs) are silent under laboratory conditions, novel valuable compounds could still be discovered. Here, we explore the potential of Penicillium rubens as a screening and production host for silent bacterial BGCs. As a starting point, we chose the BGC responsible for the production of an import-ant bioactive metabolite, the clavulanic acid BGC from S. clavuligerus. Clavulanic acid is a potent inhibitor of β-lactamases. The BGC consists of several genes, but the pathway is not yet fully elucidated. Expression of the first gene of the cluster, i.e., ceaS2 encoding a carboxyethylarginine synthase, resulted in the production of a new compound, identified

as N2_{-(2-carboxyethyl)-arginine. Expression of three further genes in}

the pathway, bls2, cas2 and pah2 resulted in the formation of small amounts of deoxyguanidinoproclavaminate, based on LC-MS identi-fication. These data represent an initial step towards the expression of an entire bacterial BGC in a filamentous fungus and it paves the way for elucidating an uncharacterized pathway of such an important secondary metabolite.

(4)

4

INTRODUCTION

Filamentous bacteria of the Actinomycetales order, commonly known as Actinomycetes, are an incredibly rich source of bioactive secondary me-tabolites. It is estimated that they produce the majority of all microbial- derived bioactive compounds and over two thirds of the commercially used natural-derived antibiotics (1, 2). The Streptomyces genus rep-resents the widest group of Actinomycetes and it produces many of the most used antibiotics, such as streptomycin, chloramphenicol, tetracy-cline and vancomycin (2). Bioinformatics analyses have shown that most biosynthetic gene clusters (BGCs) are silent in laboratory conditions, indicating that the metabolic potential of Streptomyces is even broader (3). Therefore, there is a great need for efficient BGCs characterization in suitable screening and production hosts. The successful heterologous production of secondary metabolites in different Streptomyces has been demonstrated (4–6). For example, a S. coelicolor strain devoid of 4 highly expressed BGCs was engineered to produce the antibiotics chloramphenicol and congocidine from S. venezualae and S. ambofaciens, respectively (7), whereas an industrially optimized S. avermitilis was used as a host for expressing heterologous BGCs involved in the production of streptomycin, cephamycin C and pladienolide (8). On the other hand, the heterologous expression of Streptomyces genes into eukaryotes is limited and so far confined to single genes rather than clusters. Exam-ples are the 3’ hydroxymethylcephem-O-carbamoyl transferase CmcH, the expandase CefE and the hydroxylase CefF from S. clavuligerus, which have been successfully expressed in the filamentous fungus Penicillium

rubens to produce precursors of cephalosporin, together with genes of

the endogenous β-lactam BGC (9, 10).

P. rubens is a good candidate for heterologous secondary metabolite

production. This organism produces the antibiotic penicillin and several other secondary metabolites, such as the pigments sorbicillinoids and chrysogine (11, 12), roquefortines (13) and siderophores (14, 15). Indus-trial P. rubens strains have been optimized for the production of β-lactam antibiotics and show excellent fermentation capabilities and metabolic features. Recently, a strain deleted of the high expressed BGC responsible for the biosynthesis of penicillin, chrysogine, roquefortine and hydropho-bic cyclic tetrapeptides has been created, allowing an easier detection of novel compounds (Pohl et al., submitted). Moreover, genetic engineering

(5)

4: H et er olo gous e xpr ession o f the early g enes fr om t he cla vu lanic acid bios yn the tic g ene clust er in to Penicillium rubens

of filamentous fungi has been facilitated by the introduction of new tools for genome editing (16) and gene expression, including constitutive and inducible promoters and a novel transcription control device (17, 18) (Buttel et al., unpublished). These features make P. rubens an ideal host for the heterologous biosynthesis of secondary metabolites of industrial inter-est. The heterologous production of precursors of cephalosporin and the cholesterol-lowering drug pravastatin show that this fungus is extremely versatile in generating chemically diverse molecules and expressing fungal and bacterial genes, even without codon optimization (9, 19). For these reasons, we chose P. rubens for expressing the genes of a BGC from

S. clavuligerus, that is responsible for the production of clavulanic acid.

Clavulanic acid is a potent inhibitor of β-lactamases, which are pro-duced by several bacteria as defense mechanism towards β-lactam antibiotics (20, 21). Clavulanic acid was discovered in S. clavuligerus, which is also able to produce the β-lactams penicillin N, cephalosporins and cephamycin C (22, 23). The combined production of β-lactams and inhibitors of β-lactamases allows S. clavuligerus to overcome the resistance of the target organism. Clavulanic acid inhibits β-lactamases by binding irreversibly a conserved serine residue in the active site, al-lowing the β-lactam to inhibit cell wall biosynthesis (24). This successful mode of action has also inspired the pharmaceutical industry, resulting in the fortunate drug Augmentin, a combination of clavulanic acid and amoxicillin, used against a wide range of bacterial infections (25, 26). Although clavulanic acid is produced by many Streptomyces species, its biosynthesis has been extensively studied and improved in S. clavuligerus, which has become the industrial standard. The BGC is located down-stream the cephamycin C BGC and together they form a supercluster of about 60 kb (27, 28). In the first step of the pathway, arginine and glycer-aldehyde 3-phosphate (G3P) are condensed by the carboxyethylarginine

synthase (ceaS2) to form N2_{-(2-carboxyethyl)- arginine (29) (Fig.1). Next,}

the β-lactam synthase Bls2 forms deoxyguanidinoproclavaminate (30), which is subsequently hydroxylated into guanidinoproclavaminate by the clavaminate synthase Cas2 (31, 32). Guanidinoproclavaminate is hydrolyzed by the proclavaminate amidino-hydrolase Pah2 to form proclavaminate (33). The following reaction is catalyzed again by Cas2, resulting in clavaminic acid. CeaS2, bls2, pah2, cas2 and the ornithine acetyltransferase oat2, which increases the pool of the precursor argi-nine (34), are the “early genes” of the cluster. Interestingly, these genes

(6)

4

3 2 OH 1 O P O O OH OH glyceraldehyde 3-phosphate NH 2 2 N H NH H2 N O OH arginine N H 2 H N NH H2 N O OH 1 2 O OH N2-(2-carboxyethyl)-arginine 1 2 3 4 5 O OH N1 2 3 4 O N 1 H2 N NH2 deoxyguanidinoproclavaminic acid 1 2 3 4 5 O OH N1 2 3 4 O OH N 1 H2 N NH 2 guanidinoproclavaminic acid 1 2 3 4 5 O OH N 1 2 3 4 O OH H2 N proclavaminic acid N 1 2 3 O 4 5 6 7 O HO O 1 2 H2 N H clavaminic acid N 1 2 3 O 4 5 6 7 O HO O 1 2 H2 N H dihydroclavaminic acid N 1 2 3 O 4 5 6 7 O HO O 1 2 HN H O H2 N N-glycyl-clavaminic acid N 1 2 3 O 4 5 6 7 O HO ₁ 2 O O H clavaldehyde N 1 2 3 O 4 5 6 7 O HO O 1 2 HO H clavulanic acid + 5S clavams ceaS2 bls2 cas2 cas2 cas2 pah2 gcas cad Fig. 1 Cla vulanic acid bio -syn the tic pa th w ay fr om S. clavulig erus .

(7)

have paralogs in other regions of the genome, together with the clavams biosynthetic genes. CeaS1, bls1, pah1 and oat1 are located on a linear plasmid, while cas1 is situated in the chromosome, far from the clavu-lanic acid BGC (35, 36). The paralogs are regulated differently: ceaS1,

bls1, pah1, oat1 and cas1 are expressed only on soy medium, whereas

the genes in the clavulanic acid cluster are expressed both in soy and synthetic media (36, 37).

Clavaminic acid represents a branching point in the pathway, as it can be converted into clavam or clavulanic acid. In the branch leading to the production of clavulanic acid, the stereochemistry of the molecules is inverted from 3S, 5S to 3R, 5R, a feature that confers the β-lactamase inhibitory activity (26). Many enzymes seem to be involved in the late steps, as the deletion of their genes affects the biosynthesis of clavu-lanic acid, but their role is not understood. Among the late enzymes, there are the glycylclavaminate synthase GcaS and the clavaldehyde dehydrogenase Cad (26, 38, 39). The clavulanic acid biosynthetic path-way is tightly regulated. The transcription factor CcaR, located in the cephamycin C gene cluster, controls the production of cephamycin C and clavulanic acid (40). CcaR positively regulates the expression of the “early genes” and the cluster-specific factor ClaR, which is a positive regulator of the late genes (41). CcaR binding sequences have been also found upstream ccaR, indicating that the expression of the transcription factor is autoregulated (41). Furthermore, the transcription factors are subjected to complex global regulatory mechanisms responding to metabolic and environmental signals (26, 42).

Due to the application of clavulanic acid in the pharmaceutical industry,

S. clavuligerus has undergone a process of strain improvement, aimed at

increasing the production of the β-lactamase inhibitor. While the wild-type strain produces 25–120 mg/l, the industrial strains are able to make about 3 g/l (26). Besides this classical process of random mutagenesis and selection of best performant strains, a considerable increase in production has been realized through rational engineering, once the mechanisms of biosynthesis and regulation became more clear. For example, an increased flux of the precursor G3P into the pathway was achieved by disruption of gap-1, encoding for the G3P dehydrogenase which conveys G3P into glycolysis (43). Furthermore, the overexpres-sion of the biosynthetic genes and regulators as well as the deletion of the competing pathway branch leading to clavams also increased the

(8)

4

production of clavulanic acid (43). The combination of these approaches, together with feeding of precursors and particular conditions and media during fermentation, further contributed to higher yields (44–50).

In this work, we express the first genes of the clavulanic acid BGC in two P. rubens strains, one deleted of the sole penicillin BGC and the other deleted of the penicillin, chrysogine, roquefortine and cyclic tetrapeptides BGCs (Pohl et al., submitted), to test the potential of this fungus for bacterial BGC expression. This resulted in the production of early intermediates in the clavulanic acid biosynthesis pathway. The project represents an initial step in the expression of an entire bacterial BGC in a filamentous fungus and it lays the basis for elucidating the uncharacterized parts of this important pathway.

MATERIAL AND METHODS

Fungal strains, media and culture conditions

P. rubens DS68530 (DSM Centrient Pharmaceuticals) and

ΔpenΔchry-ΔroqΔhcpA (Pohl et al., submitted) (named as 4KO from now on) were used as hosts for the overexpression of ceaS2 (D1794_08095). DS68530 lacks the penicillin gene cluster and the hdfA gene (51, 52), while its de-rivative 4KO is deleted of four highly expressed non ribosomal peptide synthetases (NRPSs) gene clusters. The DS68530_OE_ceaS2_strain2 mutant was chosen for the expression of bls2 (D1794_08100), cas2 (D1794_08110) and pah2 (D1794_08105) genes. CeaS2, bls2, cas2 and

pah2 were also transformed into 4KO. The strains were grown in YGG

medium (53) for 48 h to obtain protoplasts (54). Transformants were selected and purified on acetamide or terbinafine agar medium (53, 55, 56), while a sporulation medium (53) was used for preparing long-term storage rice batches. For RNA extraction and metabolite analysis, the parental and overexpression strains were pre-grown in YGG medium for 24 h and later 3 ml were transferred in a secondary metabolite production (SMP) medium (13). Samples were collected as indicated. All cultivations were performed as 25 ml cultures in 100 ml Erlenmeyer flasks shaken at 200 rpm and 25°C. CeaS2 overexpression strains were grown in triplicates for gene expression and metabolite analysis, while the strains overexpressing the further biosynthetic genes were grown in different replicates as indicated.

(9)

Construction and validation of the overexpressing strains

The ceaS2, bls2, cas2 and pah2 genes from S. clavuligerus were ordered as synthetic genes (Invitrogen, Thermo Fisher Scientific). The over-expression plasmids were built in Escherichia coli DH5α by using the Modular Cloning (MoClo) system (57). All the genetic parts necessary for building the final constructs were available in the MoClo library of the research group. The pcbC and tif35 promoters from P. rubens and the p40S and gndA promoters from Aspergillus nidulans were chosen to drive the expression of ceaS2, bls2, cas2 and pah2, respectively. To express the ceaS2 gene, the plasmid pAV2_5 was built, containing the selection marker amdS and 1 kb flanking regions homologous to the penicillin gene cluster locus. pAV2_5 (2.5 µg) was linearized with SdaI enzyme and transformed into P. rubens DS68530 and 4KO protoplasts, together with a purified cas9 protein and 2 single guide RNA (sgRNA) targeting the penicillin gene cluster locus (58). The strains carrying the other biosynthetic genes were built by in vivo homologous recombi-nation, by amplifying the bls2, cas2, pah2 and when specified ceaS2 expression cassettes with primers having 100 bp overlap flanks. The PCR products (2.5 µg) were transformed together with the amdS or ergA expression cassette (1.5 µg), which confers resistance to terbinafine, a purified cas9 protein and 2 sgRNA targeting the region between the

Pc20g07090 and Pc20g07100 genes of 4KO or the region downstream

the penicillin gene cluster locus of DS68530_OE_ceaS2_strain2, accord-ing to the protocol described by Pohl et al. (58). The correct integration of the constructs was checked by colony PCR or PCR on genomic DNA (gDNA), after isolation with the E.Z.N.A. kit (Omega). All primers and sgRNA used in this study are listed in table 1.

RNA extraction, cDNA amplification and qPCR analysis

Total RNA was isolated from the parental and expression strains after 48 h of growth in the SMP medium, by using the Trizol™ (Invitrogen) extraction method with additional DNAse treatment (Turbo DNA-free™ kit, Ambion). For the cDNA synthesis, 1 µg of RNA was used (Maxima Reverse Transcriptase, Thermo Scientific). The γ-actin gene was used for normalization. The expression levels were measured in technical duplicates with a MiniOpticon™ system (Bio-Rad) using the Bio-Rad CFX™ manager software, which determines the threshold cycle (Ct) values automatically by regression. The SensiMix™ SYBR Hi-ROX kit

(10)

4

(Bioline) was used as mastermix for qPCR. The reactions were run as follows: 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec, 58°C for 30 sec and 72°C for 30 sec.

Metabolite profiling

Samples were taken after 72 h from the expression and the parental strains. In order to collect the extracellular metabolites, 2 ml of culture were centrifuged at full speed for 10 min and the supernatant was filtered with 0.2 µm polytetrafluorethylene (PTFE) syringe filters. The intracellular metabolites were extracted following a modified protocol from Vrabl et al. (59). The analysis of secondary metabolites was per-formed with an Accella1250™ HPLC system coupled with the ES-MS Orbitrap Exactive™ (Thermo Fisher Scientific, CA), following the method described by Salo et al. (11). As standard, the chemically synthesized

compound N2_{-(2-carboxyethyl)-}_L_{-arginine was used. The synthesis}

pro-cedure is described in SI.

RESULTS

Production of N2_{-(2-carboxyethyl)-L-arginine, the precursor for} clavulanic acid biosynthesis in Penicillium rubens

To investigate the possibility to produce clavulanic acid in the fila-mentous fungus P. rubens, the first gene of the respective BGC of

S. clavuligerus was expressed in two industrially improved strains:

DS68530, deleted for the amplified penicillin BGC and its derivative 4KO, in which the highly expressed BGCs responsible for the biosyn-thesis of penicillin, roquefortine, chrysogine and hydrophobic cyclic tetrapeptides were removed to allow improved detection of novel molecules. The expression of the ceaS2 gene from S. clavuligerus was driven by the strong endogenous pcbC promoter. A construct con-taining the expression cassette and the selection marker amdS was integrated into the genome of P. rubens by homologous recombination. Hereto, the penicillin gene cluster locus was chosen as integration site, as it is known to be highly transcribed in the growth conditions used (14). After transformation, the protoplasts were selected on acetamide medium. Colony PCRs were performed to confirm the correct integra-tion of the construct by using a primer binding in the target genomic

(11)

Table 1. Oligonucleotide primers used for amplification, validation of the constructs, qPCR and synthesis of sgRNA.

Primer name Sequence (5’-3’) Cloning ceaS2_fw TTGAAGACAAAATGTCCCGTGTATCGACCGCCC ceaS2_rv TTGAAGACAAAAGCTCAGATGCTCAGGGCGCCGAAG bls2_fw TTGAAGACAAAATGGGGGCACCGGTTCTTCCGGCTGC bls2_rv TTGAAGACAAAAGCCTAGGCCGCCCCCCGCGCG cas2_fw TTGAAGACAAAATGGCCTCTCCGATCGTTGACTGC cas2_rv TTGAAGACAAAAGCTCAGCGGCGCGGCGAGAACG pah2_fw TTGAAGACAAAATGGAGCGCATCGACTCGC pah2_rv TTGAAGACAAAAGCTCACAACTGGGTGCGGTGG PCR for transformation PCR1_fw_IGR ATTAAATACTAAAGCTATAATAAGAAAGGATATTACACTAATTCG TATCTAAAGAACTAGAGGGGACTATAATAGTAAGTCGCTACTTAT ACTGCATTGGTCTGCCATTGCAG PCR1_rv_IGR GTCCGAGAGAGATGCAACCTGACAGGTCCTTGAAGCTTCCAAG GGTTCTTCAGCTTGACGAATCGGCATTGCTGTCTGAAACATCGA TACACTCACATTTGTGCTTGGGATGTTCCATGGTAGC PCR2_fw_IGR ACAGCGGAAGACAAGGAGAAATGTGAGTGTATCGATGT PCR2_rv TTACTCAGCCCTTCTCTCTGCGTCCGTCCGTCTCTCCGCATGCC AGAAAGAGTCACCGGTCACTGTACAGAGCTCGAATTCCTGCAG CCCGGGGGATCCACGCAGGGTTTGAGAACTCCGATC PCR3_fw AGAATATTGGCTGGGTTGATGGCTGCTTCGAGTGCAGTCTCATG CTGCCACAGGTGACTCTGGATGGCCCCATACCACTCAACCCAT GGTACGAGCGGTATCTTGCGTTACGGGCGTATTTTG PCR3_rv_IGR TTATAAGGGTCCCCCGGTTAGTTCGAACGTATACCCTATCTAAAT AGGGGTGGTTCTTAGGGGTAGTTAGAAACCCTTCTAATCGGAG AGTTCTCCTGCAGCAGTGCGAGTTC PCR1_fw_pen CGTGAAGTAACGTAGGGAACCGACGGAAACTGTAGAGCTATAG GAATTTAGTATATCAGAAGTCAATTGAGAGAAGTGTATAGTTAG TAACTCACTTGTGAAATGTGAGTGTATCGATGTTTCAGAC PCR2_rv TTACTCAGCCCTTCTCTCTGCGTCCGTCCGTCTCTCCGCATGCC AGAAAGAGTCACCGGTCACTGTACAGAGCTCGAATTCCTGCAG CCCGGGGGATCCACGCAGGGTTTGAGAACTCCGATC PCR2_fw AGAATATTGGCTGGGTTGATGGCTGCTTCGAGTGCAGTCTCATG CTGCCACAGGTGACTCTGGATGGCCCCATACCACTCAACCCAT GGTACGAGCGGTATCTTGCGTTACGGGCGTATTTTG PCR3_rv_pen GCCAAGAATACGTCATACTTATTCTCTGAATCAAGGTGGAACCT GGTTTGGATTCCCCCTGGACAACCGATCCTGATACCTTACCTGT TTTGAGGCGTTCTCCTGCAGCAGTGCGAGTTC amdS_ergA_fw AGCTCTTCATGTTGGATCCCCCGGGCTGCAG amdS_ergA_rv CGCAGGAATTCGAGCTCTGTA Validation PCR 5flank_ceaS2_int_fw GGCTATCGCGCTAATGGCAT 5flank_ceaS2_int_rv TGAAGACAAGGTGTCTTGTGCTTTGCGTAGTATTCA

(12)

4

Primer name Sequence (5’-3’) Validation PCR

3flank_ ceaS2_int_fw CGACACCACCGTCCCCAACCC 3flank_ ceaS2_int_rv CAGAGCATGCAGATGCGGAT

overlap1_fw_IGR TTGAAGACTTGGAGTAGGCTAAGGTCCGTTATCTAAAGG overlap1_rv_IGR ACAGCGGAAGACAACATTGGTGTCTAGAAAAATAATGGTGAA overlap2_fw_IGR ACAGCGGAAGACAAGCTTGTGCTTCTAAGGTATGAGTCGCA overlap2_rv_IGR ACAGCGGAAGACAACATTCAAGCTGCGATGAAGTGGGA overlap3_fw_IGR ACAGCGGAAGACAAGCTTCTAATAAGTGTCAGATAGCAAT overlap3_rv_IGR TTGAAGACAACATTGTGGGGGGTATGAACTCTGGAG overlap4_fw_IGR TTGAAGACAAGGAGTCTTGCGTTACGGGCGTATTTTG overlap4_rv_IGR GCGAAGACAATTTTATCTTTCTCTAGCAGAATTATTATCGTATAA ATATC qPCR ceaS2_qPCR_fw CGAGAAGAAAACCGTCCGTA ceaS2_qPCR_rv CATGCCGTCCTCGTAAGTCT bls2_qPCR_fw CTGCTGGAACGCTATGACCT bls2_qPCR_rv ACCTGGTAGACACCGGTCAG cas2_qPCR_fw AGGACGGTTATCTGCTGCTG cas2_qPCR_rv ACGGGTAGACGTCGTGGTAG pah2_qPCR_fw TGTACGTCTCGGTCGACATC pah2_qPCR_rv ACACCTCCATCACGTCGAA actin_fw CGACTACCTGATGAAGATCCTCGC actin_rv GTTGAAGGTGGTGACGTGGATACC Oligos for sgRNA

Target_pen1 ATGTAATACGACTCACTATAGGGAACCAACATCATTAAGCAGGT TTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTAT CAACTTGAAAAAGTGGCACCGAGTCGGTGCT Target_pen2 ATGTAATACGACTCACTATAGGGCTGTACGCCGAGTGGTCGGGT TTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTAT CAACTTGAAAAAGTGGCACCGAGTCGGTGCT Target_IGR1 ATGTAATACGACTCACTATAGTAGGGCAATAACTCCTAGGGTTT CAGAGCTATGCTGGAAA Target_IGR2 ATGTAATACGACTCACTATAGATCGACGATAATAACGTCGGTTTC AGAGCTATGCTGGAAA Target_pen_side1 ATGTAATACGACTCACTATAGAACGGTTGGAAATACCTGTGTTTT AGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAA CTTGAAAAAGTGGCACCGAGTCGGTGCTTT Target_pen_side2 ATGTAATACGACTCACTATAGTCAAGGGACACAGACGGAAGTTT TAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCA ACTTGAAAAAGTGGCACCGAGTCGGTGCTTT

(13)

4: H et er olo gous e xpr ession o f the early g enes fr om t he cla vu lanic acid bios yn the tic g ene clust er in to Penicillium rubens Kana amdS ceaS2 5’ flank 3’ flank Kana amdS ceaS2 5’ flank 3’

flank _plasmid genome

A

1 2 3 4 1 2 3 4 DS68530_OE_ceaS2 4KO_OE_ceaS2 3 kb 3 kb

B

Fig.2 Construction and valida tion of the str ains expr essing cea S2 gene. Repr esen ta tion of the dig est ed plasmid deliv er ed during the fungal tr ans -forma tion and in viv o rec ombina tion in to the genome of DS68530 and 4K O str ains (A). PCR analy sis to check the corr ect in tegr ation of the gene tic part in f our biolo gical r eplica tes (lanes 1 to 4 ): upper g el, in tegr ation o f 5’ flank; lo w er g el, in tegr ation o f 3’ flank (B).

(14)

4

locus and one primer binding in the transformed expression cassette (Fig. 2). Rice batches were made to store the spores of the biological replicates. The gene expression was checked by qPCR after 48 h of growth in a SMP medium (Fig. 3): in all the mutant strains tested, ceaS2 was highly expressed, ranging from 0.5 to 4 times higher expression than the constitutive actin gene, which was used as a reference.

To examine the production of N2_{-(2-carboxyethyl)-}_L_{-arginine, the first}

compound in the biosynthetic pathway, samples were taken after 72 h of growth. As it was unknown where the expected molecule could be located, extracellular and intracellular fractions were analyzed by LC-MS,

using a chemically synthesized N2_{-(2-carboxyethyl)-L-arginine as a}

stan-dard. In the intracellular samples of all the expression strains, a molecule showing the same m/z and retention time (RT) of the standard was detected. The compound was not present in the parental strains that did not express the ceaS2 gene, suggesting it was indeed the product of

the N2_{-(2-carboxyethyl)-L-arginine synthase from S. clavuligerus (Fig. 4).}

Expression of additional genes in the clavulanic acid biosynthetic gene cluster

The high expression of ceaS2 gene and the successful production of

N2_{-(2-carboxyethyl)-L-arginine proved the versatility of P. rubens as}

host for the production of bacterial secondary metabolites. Next, we investigated the production of further metabolites of the pathway. Since

0 1 2 3 4 Fo ld c ha ng e co m pa re d to a ct in parental strain OE_ceaS2_strain 1 OE_ceaS2_strain 2 OE_ceaS2_strain 3 DS68530 4KO 0 1 2 3 4 Fo ld c ha ng e co m pa re d to a ct in parental strain OE_ceaS2_strain 1 OE_ceaS2_strain 2 OE_ceaS2_strain 3 DS68530 4KO

Fig.3 Expression of ceaS2 gene in the parental and expression strains. The parental DS68530 and 4KO strains and three biological replicates expressing ceaS2 gene are rep-resented (OE_ceaS2_strain). Data are shown as fold change compared to actin gene.

(15)

4: H et er olo gous e xpr ession o f the early g enes fr om t he cla vu lanic acid bios yn the tic g ene clust er in to Penicillium rubens 24 7, 14 24 3, 09 24 6, 18 24 7, 04 24 8, 14 24 5, 09 24 4 24 5 24 6 24 7 24 8 24 9 25 0 m /z 0 10 20 30 40 50 60 70 80 90 10 0 Rel ativ e A bun dan ce 24 7, 10 24 7, 94 24 4 24 5 24 6 24 7 24 8 24 9 25 0 m /z 24 7, 14 24 4, 08 24 7, 56 24 5, 08 24 8, 15 24 6, 21 24 3, 68 24 8, 06 24 7, 06 24 3, 22 24 4 24 5 24 6 24 7 24 8 24 9 25 0 m /z 24 4, 08 24 7, 10 24 5, 08 24 7, 56 25 0, 13 0 10 20 30 40 50 60 70 80 90 10 0 Rel ativ e A bun dan ce 24 4 24 5 24 6 24 7 24 8 24 9 25 0 m /z 0 10 20 30 40 50 60 70 80 90 10 0 Rel ativ e A bun dan ce 0 10 20 30 40 50 60 70 80 90 10 0 Rel ativ e A bun dan ce A B C D Fig.4 M ass spectr a of in tr ac ellular samples fr om cea S2 e xpr essing str ains and the par en tal str ains. Samples fr om DS68530_OE_ cea S2 (A) and 4K O_OE_ cea S2 (C) str ains ha ve N 2-(2-carbo xy eth yl)-L -ar ginine ( m/ z 2 47 .14 [M+H]+ , R T 1.25), while samples fr om DS68530 (B) and 4K O (D ) str ains do no t c on tain it.

(16)

4

the last steps of the pathway are not fully elucidated, only the first four characterized genes were chosen to be expressed, which would lead to the biosynthesis of clavaminic acid. The expression cassettes of bls2,

cas2 and pah2 genes were built in E. coli, choosing promoters and

termi-nators from P. rubens, Aspergillus or Saccharomyces cerevisiae. Afterwards, the cassettes were amplified by PCR with primers containing 100 bp homologous flanks and transformed into P. rubens. In this way, the genetic parts could recombine and the genes resulted to be integrated one after the other into the genome. Initially, ceaS2, bls2, cas2 and pah2 were transformed together with the marker amdS into the pen locus of the 4KO strain. However, just few transformants appeared on plate and these did not present the correct assembly. Therefore, we tried to assemble the genes into a new locus, which was previously used for the integration and expression of the penicillin BGC (Pohl, Polli et al., submitted). PCR on gDNA proved the successful integration of all the genetic parts in 12 colonies (Fig.5). Following the preparation of long-term storage rice batches for 8 of the transformants and pre-growth in a sporulation medium, RNA was extracted after 48 h of growth in a SMP medium. qPCR showed a low expression for ceaS2, cas2 and pah2, while no signal was detected for the bls2 gene (data not shown). The

metabolite analysis showed that nor N2_{-(2-carboxyethyl)-L-arginine}

neither other new compounds were produced in the expression strains compared to the parental (data not shown).

Since the genes were very low expressed and none of the expected compounds could be detected, another approach was carried on. DS68530_OE_ceaS2_strain showed the highest ceaS2 expression and

production of N2_{-(2-carboxyethyl)-L-arginine, therefore it was chosen}

for integrating bls2, cas2 and pah2. The expression cassettes were intro-duced by homologous recombination into the penicillin BGC locus, at the 3’ site of ceaS2. Since the strain already contained amdS, the ergA gene was used, allowing the growth on a medium containing terbina-fine. A PCR analysis on gDNA showed that several transformants did not integrate the genes as expected (data not shown). In one mutant strain, bls2 and cas2 genes recombined in the expected locus but pah2 gene was missing (DS68530_OE_ceaS2_bls2_cas2), while in another transformant pah2 gene was present but it integrated somewhere else into the genome (DS68530_OE_ceaS2_bls2_cas2_pah2, Fig. 6). Although the DNA fragments delivered during the fungal transformation did not

(17)

4: H et er olo gous e xpr ession o f the early g enes fr om t he cla vu lanic acid bios yn the tic g ene clust er in to Penicillium rubens amdS ceaS2 bls2 cas2 pah2 ceaS2 amdS bls2 cas2 pah2 genome A B 1 kb 1 kb 1 kb 1 kb * * * * * a) b) c) d) e) Fig.5 Construction and valida tion of the 4K O str ains carrying cea S2 , bls2 , c as2 and pah2 g enes. Repr esen ta tion of the DNA fr agmen ts deliv er ed during the fungal tr ansf orma tion and in viv o rec ombina tion in to the genome of 4K O str ain. Primer s used for checking the rec ombina tion of the parts ar e repr esen ted in black and gr ey (A). PCR analy sis to check the corr ect assembly o f the gene tic parts in tw elv e biolo gical replica tes (diff er en t lanes ). The lanes mark ed with (*) ar e the con tr ol PCR on the par en tal str ain. a) in tegr ation of c ea S2 in to the genome; b) ov erlap be tw een cea S2 and bls2 genes; c) ov erlap be tw een cas2 and amd S g enes; d) o verlap be tw een amd S and pah2 g enes; e ) in tegr ation o f pah2 in to the g enome (B).

(18)

4

amdS ergA bls2 cas2 pah2 ceaS2 ergA bls2 cas2 pah2 genome amdS A 1 kb 3 kb 1 2 3 4 1 2 3 4 strain 1 strain 2 B Fig.6 Construction and valida tion of the DS68530_OE_ cea S2_ str ain2 r eplica tes carrying cea S2 , bls2 , c as2 and pah2 g enes. Repr esen ta tion of the DNA fr agmen ts deliv er ed during the fungal tr ansf orma tion and expect ed in viv o rec ombina tion in to the genome of DS68530_OE_ cea S2_ str ain2. Primer s used for checking the rec ombina tion of the parts ar e repr esen ted in black and gr ey (A). PCR analy sis to check the corr ect assembly o f the gene tic parts in tw o biolo gical replica tes. Lane 1, in tegr ation of bls2_c as2 fr agmen t in to the g enome, do wnstr eam cea S2 gene; lane 2, ov erlap be tw een bls2_c as2 fr agmen t and er gA g ene; lane 3, in tegr ation of er gA and pah2 genes in to the genome; lane 4, PCR on pah2 g ene, with primer s binding in the pr omo ter and t ermina tor (B). The absenc e of amplifica tion in lane 3 indica tes tha t pah2 g ene is no t in tegr at ed in the expect ed locus. H ow ev er , the corr ect amplifi ca tion in lane 4 of str ain 1 sho w s tha t pah2 gene is pr esen t some wher e else in to the g enome. S tr ain 2 does no t carry pah2 gene.

(19)

recombine as expected, these two strains were fermented for

metab-olite analysis. Besides N2_{-(2-carboxyethyl)-arginine, in the intracellular}

samples from both the engineered strains, a new compound appeared to be detected, which was absent in the control strains DS68530 and DS68530_OE_ceaS2_strain2 (Fig. 7). The m/z of this molecule is the same as the β-lactam deoxyguanidinoproclavaminate, the compound

formed by Bls2 starting from N2_{-(2-carboxyethyl)-arginine. The other}

expected molecules from the pathway (guanidinoproclavaminate, pro-clavaminate and clavaminic acid) were not detected in any of the samples. A B 227.4 227.8 228.2 228.6 229.0 229.4 229.8 230.2 230.6 m/z 0 10 20 30 40 50 60 70 80 90 100 R el at iv e A bu nd an ce 229.13 230.12 230.19 230.05 228.11 229.15 229.55 227.4 227.8 228.2 228.6 229.0 229.4 229.8 230.2 230.6 m/z 230.10 230.12 229.12 228.14 0 10 20 30 40 50 60 70 80 90 100 R el at iv e A bu nd an ce A B 227.4 227.8 228.2 228.6 229.0 229.4 229.8 230.2 230.6 m/z 0 10 20 30 40 50 60 70 80 90 100 R el at iv e A bu nd an ce 229.13 230.12 230.19 230.05 228.11 _{229.15 229.55} 227.4 227.8 228.2 228.6 229.0 229.4 229.8 230.2 230.6 m/z 230.10 230.12 229.12 228.14 0 10 20 30 40 50 60 70 80 90 100 R el at iv e A bu nd an ce

Fig.7 Mass spectra of intracellular samples from the strains engineered with the first genes of the clavulanic acid BGC and the parental strains. Samples from DS68530_OE_ceaS2_bls2_

cas2_pah2 and DS68530_OE_ceaS2_bls2_cas2 strains have deoxyguanidinoproclavaminate

(229.13 m/z [M+H]+ , RT=1.25) (A), while samples from DS68530_OE_ceaS2_strain2 strain do not contain it (B).

(20)

4

DISCUSSION

In this work we engineered industrially improved P. rubens strains with multiple genes from the clavulanic acid BGC of S. clavuligerus, chal-lenging this fungus to express bacterial genes and translate these into functional enzymes. This ambitious project represents the initial step in the expression of an entire bacterial BGC in filamentous fungi and it paves the way for elucidating the complex and tightly regulated pathway for clavulanic acid biosynthesis.

Initially, P. rubens host strains were engineered only with the first gene of the BGC. qPCR showed that ceaS2 was successfully expressed, although with a variable level of expression, which could depend on the number of gene copies integrated into the genome (Fig. 3). CeaS2

encodes for a tetrameric enzyme, which condenses arginine and G3P in

a unique mechanism requiring thiamine pyrophosphate. While this

co-factor is usually associated with C-C bond-breaking and bond- forming reactions, here it is used in a N-C bond forming reaction (60). The metabolite profile suggests that the complex CeaS2 enzyme was suc-cessfully assembled and functional. A new molecule was observed in the transformant strains, which was absent in the parental strains. This

compound was identified as the product of CeaS2, N2_{-(2-carboxyethyl)-}

arginine (Fig.4).

In further steps of strain engineering, we investigated the production of downstream metabolites of clavulanic acid pathway. Since this path-way is not fully characterized, we decided to express only the genes which would lead to the biosynthesis of clavaminic acid, for which the enzymatic steps are identified. Here, the P. rubens 4KO strain is the ideal host for heterologous secondary metabolite production, as it has a reduced endogenous metabolic profile which allows for a more sen-sitive detection of new molecules produced in low amount. However, the genetic parts delivered during the transformation did not inte-grate correctly into the penicillin BGC loci, while the expression of the same genes into the region between the Pc20g07090 and Pc20g07100 genes failed (data not shown). As an alternative strategy, we engineered DS68530_OE_ceaS2_strain2 biological replicate with bls2, cas2 and

pah2, resulting in a strain which did not carry pah2 and another one

which integrated this gene into another genome locus (Fig.6 ). From the metabolic analysis, it appeared that a compound with the same

(21)

m/z as deoxyguanidinoproclavaminate was present in the intracellular

samples of the engineered strains (Fig. 7). However, the signal was very weak, suggesting the presence of low amounts. Although this result must be confirmed by comparison with a standard deoxyguan-idinoproclavaminate or by determining the chemical structure through NMR, it provides a first step towards the heterologous expression of this complex pathway. Other expected compounds were not detected. In conclusion, the first intermediate of the clavulanic acid pathway from S. clavuligerus was successfully produced in P. rubens. This shows that P. rubens is able to assemble a functional bacterial enzyme, which has such a complex structure and peculiar mechanism of action and it confirms that this organism has a great potential for producing heter-ologous chemically diverse metabolites. The genetic engineering with further genes of the BGC did not result in the predicted recombination of the genetic parts and the expected compounds were not detected. However, a new metabolite might have beenf found in the metabolite profile of the engineered strains. If the novel molecule proves to be deoxyguanidinoproclavaminate, it would be the first time that a fila-mentous fungus produces a β-lactam compound not relying on the traditional mechanism but on a completely different one. In fact, while in P. rubens the β-lactams are formed from a non-ribosomal tripeptide through an isopenicillin N synthase, here the β-lactam ring would be formed from different substrates and by a mechanism which is typical of bacteria (61). These data represent a first step in the expression of an entire bacterial BGC in a filamentous fungus and a starting point for elucidating the uncharacterized pathway of clavulanic acid.

ACKNOWLEDGMENTS

The research was supported by a grant from the People Programme (Marie Curie Actions) of the European Union’s Seventh Framework Programme FP7/2007-2013, under grant 607332. We thank DSM Centrient Pharmaceuticals (Delft, the Netherlands) for kindly providing the DS68530 strain.

(22)

4

SUPPLEMENTARY DATA

Synthesis of N2_{-(2-carboxyethyl)-L-arginine (compound 1)}

Compound 1 was synthesized according to a literature procedure (Scheme 1) from a commercially available starting material 2 (Com-bi-Blocks Inc., San Diego). The purification was performed by precip-itation from methanol/Et2O. The overall yield from compound 2 after three steps was 26 %.

Scheme 1. Synthesis of compound 1 Taken from S. W. Elson, K. H.

Bag-galey, M. Fulston, N. H. Nicholson, J. W. Tyler, J. Edwards, H. Holms, I. Hamilton and D. M. Mousdale, J. Chem. Soc., Chem. Commun., 1993, 1211-1212

Compound 1: 1_{H NMR (600 MHz, CD3OD): δ 4.15 (dd, J = 7.6, 4.8 Hz,}

1H, 4), 3.40 (td, J = 6.9, 1.4 Hz, 2H, 5), 3.05 (t, J = 7.6 Hz, 2H, 1), 2.88

(t, J = 6.9 Hz, 2H, 6), 2.19 – 2.04 (m, 2H, 3), 2.03 – 1.81 (m, 2H, 2); 13_C

NMR (151 MHz, CDCl3): δ 172.1, 169.2, 59.3 (4), 42.3 (5), 38.7 (1), 29.8 (6),

26.0 (3), 23.0 (2). HRMS (ESI+) calc. for [M+H]+_{(C9H18N4O4): 247.1401,}

found: 247.1403. HN N H NH H2N O OH COOH 1 HN N H NH HN O OBn COOMe NO2 NH2 N H NH HN O OBn NO2 COOMe MeOH

1. MeOH, water, KOH, 50 C, 48h 2. MeOH, 10% Pd/C, H2, ON HN N H NH H2N O OH COOH 2 3 1 HN N H NH HN O OBn COOMe NO2 NH2 N H NH HN O OBn NO2 COOMe MeOH

1. MeOH, water, KOH, 50 C, 48h 2. MeOH, 10% Pd/C, H2, ON HN N H NH H2N O OH COOH 2 3 1 COOH HN 4 3 2 1 N H NH H2N 5 6 COOH Chemical Formula: C9H18N4O4 Exact Mass: 246.1328

(23)

4: H et er olo gous e xpr ession o f the early g enes fr om t he cla vu lanic acid bios yn the tic g ene clust er in to Penicillium rubens 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0 4.5 5.0 5.5 6.0 6.5 7.0 7.5 8.0 8.5 9.0 9.5 10.0 4.00 1.94 1.52 2.27 1.03 1.85 1.86 1.87 1.97 1.98 2.08 2.08 2.09 2.10 2.10 2.10 2.11 2.11 2.12 2.12 2.12 2.13 2.14 2.15 2.87 2.88 2.89 3.03 3.05 3.06 3.39 3.39 3.40 3.40 3.41 3.41 4.14 4.15 4.15 4.16 2.0 2.5 3.0 3.5 4.0 4.00 1.94 1.52 2.27 1.03 1.85 1.86 1.87 1.97 1.98 2.08 2.08 2.09 2.10 2.10 2.10 2.11 2.11 2.12 2.12 2.12 2.13 2.14 2.15 2.87 2.88 2.89 3.03 3.05 3.06 3.39 3.39 3.40 3.40 3.41 3.41 4.14 4.15 4.15 4.16 Fig. S1. 1H NMR spectrum o f c ompound 1 in CD 3O D.

(24)

4

-10 0 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 f1 (ppm) 23.0 26.0 29.8 38.6 42.3 59.3 169.2 172.1 Fig. S2. 13C NMR spectrum o f c ompound 1 in CD 3O D.

(25)

Fig. S3. 1_{H COSY spectrum of compound 1 in CD3OD}

Fig. S4. 1_H-13_{C HSQC spectrum of compound 1 in CD3OD}

90 Confidential -10 0 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 f1 (ppm) 23.0 26.0 29.8 38.6 42.3 59.3 169.2 172.1 2636

Fig. S2. 13_{C NMR spectrum of compound 1 in CD}₃_OD.

2637 2638 1.5 2.0 2.5 3.0 3.5 4.0 4.5 5.0 1.5 2.0 2.5 3.0 3.5 4.0 4.5 5.0 f1 (ppm) 2639

Fig. S3. 1_{H COSY spectrum of compound 1 in CD}₃_OD

2640 3-4 1-2 2-3 5-6 91 Confidential 1.6 1.7 1.8 1.9 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 2.9 3.0 3.1 3.2 3.3 3.4 3.5 3.6 3.7 3.8 3.9 4.0 4.1 4.2 4.3 4.4 4.5 4.6 10 15 20 25 30 35 40 45 50 55 60 65 f1 (ppm) {1.9,23.1} {2.0,23.1} {2.1,26.0} {2.9,29.7} {3.0,38.7} {3.4,42.4} {3.3,47.8} {4.1,59.3} 2641 2642

Fig. S4. 1_H-13_{C HSQC spectrum of compound 1 in CD}₃_OD

2643 2644 2645 REFERENCES 2646 2647

1. Bilyk O, Luzhetskyy A. 2016. ScienceDirect Metabolic engineering of natural product

2648

biosynthesis in actinobacteria. Curr Opin Biotechnol 42:98–107. 2649

2. Takahashi Y, Nakashima T. 2018. Actinomycetes, an Inexhaustible Source of Naturally

2650

Occurring Antibiotics. Antibiotics 7. 2651

3. Robertsen HL, Weber T, Kim HU, Lee SY. 2018. Toward Systems Metabolic Engineering of

2652

Streptomycetes for Secondary Metabolites Production. Biotechnol J 13. 2653

4. Ikeda H, Shin-Ya K, Omura S. 2014. Genome mining of the Streptomyces avermitilis

2654

genome and development of genome-minimized hosts for heterologous expression of 2655

biosynthetic gene clusters. J Ind Microbiol Biotechnol 41:233–250. 2656

5. Komatsu M, Komatsu K, Koiwai H, Yamada Y, Kozone I, Izumikawa M, Hashimoto J, Takagi

2657

M, Omura S, Shin-Ya K, Cane DE, Ikeda H. 2013. Engineered Streptomyces avermitilis host 2658

for heterologous expression of biosynthetic gene cluster for secondary metabolites. ACS 2659

Synth Biol 2:384–396. 2660

6. Álvarez-Álvarez R, Martínez-Burgo Y, Pérez-Redondo R, Braña AF, Martín JF, Liras P.

2661 4 5 Residual MeOH 1 6 ₃ 2

(26)

4

REFERENCES

1. Bilyk O, Luzhetskyy A. 2016. ScienceDirect Metabolic engineering of natural product biosynthesis in actinobacteria. Curr Opin Biotechnol 42:98–107. 2. Takahashi Y, Nakashima T. 2018. Actinomycetes, an Inexhaustible Source of

Naturally Occurring Antibiotics. Antibiotics 7.

3. Robertsen HL, Weber T, Kim HU, Lee SY. 2018. Toward Systems Metabolic Engi-neering of Streptomycetes for Secondary Metabolites Production. Biotechnol J 13. 4. Ikeda H, Shin-Ya K, Omura S. 2014. Genome mining of the Streptomyces avermitilis genome and development of genome-minimized hosts for heterologous expres-sion of biosynthetic gene clusters. J Ind Microbiol Biotechnol 41:233–250. 5. Komatsu M, Komatsu K, Koiwai H, Yamada Y, Kozone I, Izumikawa M, Hashimoto

J, Takagi M, Omura S, Shin-Ya K, Cane DE, Ikeda H. 2013. Engineered

Streptomy-ces avermitilis host for heterologous expression of biosynthetic gene cluster for

secondary metabolites. ACS Synth Biol 2:384–396.

6. Álvarez-Álvarez R, Martínez-Burgo Y, Pérez-Redondo R, Braña AF, Martín JF, Liras P. 2013. Expression of the endogenous and heterologous clavulanic acid cluster in Streptomyces flavogriseus: Why a silent cluster is sleeping. Appl Microbiol Biotechnol 96:9451–9463.

7. Gomez-Escribano JP, Bibb MJ. 2011. Engineering Streptomyces coelicolor for het-erologous expression of secondary metabolite gene clusters. Microb Biotechnol 4:207–215.

8. Komatsu M, Uchiyama T, Omura S, Cane DE, Ikeda H. 2010. Genome-minimized

Streptomyces host for the heterologous expression of secondary metabolism. Proc

Natl Acad Sci 107:2646–2651.

9. Harris DM, Westerlaken I, Schipper D, Van Der Krogt ZA, Gombert AK, Sutherland J, Raamsdonk LM, Van Den Berg MA, Bovenberg RAL, Pronk JT, Daran J-M. 2009. Engineering of Penicillium chrysogenum for fermentative production of a novel carbamoylated cephem antibiotic precursor. Metab Eng 11:125–137.

10. van den Berg MA, Bovenberg RAL, Raamsdonk LM, Sutherland J, de Vroom E, Vollinga RCR. 2004. WO2004/106347 A1.

11. Salo O, Guzmán-Chávez F, Ries MI, Lankhorst PP, Bovenberg RAL, Vreeken RJ, Driessen AJM. 2016. Identification of a polyketide synthase involved in sorbicillin biosynthesis by Penicillium chrysogenum. Appl Environ Microbiol 82:3971–3978. 12. Viggiano A, Salo O, Ali H, Szymanski W, Lankhorst PP, Nygård Y, Bovenberg RAL,

Driessen AJM. 2018. Pathway for the Biosynthesis of the Pigment Chrysogine by Penicillium chrysogenum. Appl Environ Microbiol 84.

13. Ali H, Ries MI, Nijland JG, Lankhorst PP, Hankemeier T, Bovenberg RAL, Vreeken RJ, Driessen AJM. 2013. A Branched Biosynthetic Pathway Is Involved in Production of Roquefortine and Related Compounds in Penicillium chrysogenum. PLoS One 8. 14. van den Berg M, Albang R, Albermann K, Badger J, Daran J, Driessen A, Garcia-Es-trada C, Fedorova N, Harris D, Heijne W, Joardar V, Kiel J, Kovalchuk A, Martín J, Nierman W, Nijland J, Pronk J, Roubos J, van der Klei I, van Peij N, Veenhuis M, von Döhren H, Wagner C, Wortman J, Bovenberg R. 2008. Genome sequencing and analysis of the filamentous fungus Penicillium chrysogenum. Nat Biotechnol 26:1161–1168.

15. Samol MM. 2015. Genomic Wake-Up Call Activating Silent Biosynthetic Pathways for Novel Metabolites in Penicillium chrysogenum.

(27)

16. Pohl C, Kiel JAKW, Driessen AJM, Bovenberg RAL, Nygård Y. 2016. CRISPR/Cas9 Based Genome Editing of Penicillium chrysogenum. ACS Synth Biol 5:754–764. 17. Polli F, Meijrink B, Bovenberg RAL, Driessen AJM. 2016. New promoters for strain

engineering of Penicillium chrysogenum. Fungal Genet Biol 89:62–71.

18. Mózsik L, Büttel Z, Bovenberg RAL, Driessen AJM, Nygård Y. 2019. Synthetic control devices for gene regulation in Penicillium chrysogenum. Microb Cell Fact 18. 19. McLean KJ, Hans M, Meijrink B, van Scheppingen WB, Vollebregt A, Tee KL, van der Laan J-M, Leys D, Munro AW, van den Berg MA. 2015. Single-step fermenta-tive production of the cholesterol-lowering drug pravastatin via reprogramming of Penicillium chrysogenum. Proc Natl Acad Sci 112:2847–2852.

20. Reading C, Cole M. 1977. Clavulanic acid: a beta lactamase inhibiting beta lactam from Streptomyces clavuligerus. Antimicrob Agents Chemother 11:852–857. 21. Brown A, Butterworth D, Cole M, Hanscomb G, Hood J, Reading C, Rolinson G.

1976. Naturally-occurring beta-lactamase inhibitors with antibacterial activity. J Antibiot (Tokyo) 668/669.

22. Saudagar PS, Survase SA, Singhal RS. 2008. Clavulanic acid: A review. Biotechnol Adv 26:335–351.

23. Tahlan K, Anders C, Jensen SE. 2004. The paralogous pairs of genes involved in clavulanic acid and clavam metabolite biosynthesis are differently regulated in

Streptomyces clavuligerus. J Bacteriol 186:6286–6297.

24. Liras P, Rodríguez-García A. 2000. Clavulanic acid, a β-lactamase inhibitor: bio-synthesis and molecular genetics. Appl Microbiol Biotechnol 54:467–475. 25. Rolinson GN. 1982. The history and background of Augmentin. South African

Med J 62:3–4.

26. Paradkar A. 2013. Clavulanic acid production by Streptomyces clavuligerus: bio-genesis, regulation and strain improvement. J Antibiot (Tokyo) 66:411–420. 27. Ward JM, Hodgson JE. 1993. The biosynthetic genes for clavulanic acid and

cephamycin production occur as a “super-cluster” in three Streptomyces. FEMS Microbiol Lett 110:239–242.

28. Aidoo KA, Wang A, Alexander DC, Rittammer RAR, Jensen SE. 1994. Cloning, sequencing and disruption of a gene from Streptomyces clavuligerus involved in clavulanic acid biosynthesis. Gene 147:41–46.

29. Khaleeli N, Li R, Townsend CA. 1999. Origin of the β-lactam carbons in clavulanic acid from an unusual thiamine pyrophosphate-mediated reaction [3]. J Am Chem Soc 121:9223–9224.

30. Bachmann BO, Li R, Townsend C a. 1998. Beta-lactam synthetase: A new biosyn-thetic enzyme. Proc Natl Acad Sci 95:9082–9086.

31. Neil Marsh E, Chang MDT, Townsend CA. 1992. Two Isozymes of Clavaminate Synthase Central to Clavulanic Acid Formation: Cloning and Sequencing of Both Genes from Streptomyces Clavuligerus. Biochemistry 31:12648–12657.

32. Salowe SP, Krol WJ, Iwata-Reuyl D, Townsend CA. 1991. Elucidation of the Order of Oxidations and Identification of an Intermediate in the Multistep Clavaminate Synthase Reaction. Biochemistry 30:2281–2292.

33. Townsend C a, Wu T, Busby RW, Houston T a, Ilwaine DBMC, Egan L a, Townsend C a. 1995. Identification, cloning, sequencing and overexpression of the gene encoding proclavaminate amidino hydrolase and characterization of protein function in clavulanic acid biosynthesis . J Bacteriol 177:3714–3720.

(28)

4

Greaves P, Barton B, Robinson C V., Schofield CJ. 2002. ORF6 from the clavulanic acid gene cluster of Streptomyces clavuligerus has ornithine acetyltransferase activity. Eur J Biochem 269:2052–2059.

35. Tahlan K, Park HU, Wong A, Beatty PH, Jensen SE. 2004. Two Sets of Paralogous Genes Encode the Enzymes Involved in the Early Stages of Clavulanic Acid and Clavam Metabolite Biosynthesis in Streptomyces clavuligerus 48:930–939. 36. Jensen SE, Elder KJ, Aidoo KA, Paradkar AS. 2000. Enzymes catalyzing the early

steps of clavulanic acid biosynthesis are encoded by two sets of paralogous genes in Streptomyces clavuligerus. Antimicrob Agents Chemother 44:720–726. 37. Paradkar AS, Jensen SE. 1995. Functional analysis of the gene encoding the

clavaminate synthase 2 isoenzyme involved in clavulanic acid biosynthesis in

Streptomyces clavuligerus. J Bacteriol 177:1307–1314.

38. Jensen SE, Paradkar a S, Mosher RH, Anders C, Beatty PH, Brumlik MJ, Griffin a, Barton B. 2004. Five Additional Genes Are Involved in Clavulanic Acid Bio-synthesis in Streptomyces clavuligerus. Society 48:192–202.

39. Arulanantham H, Kershaw NJ, Hewitson KS, Hughes CE, Thirkettle JE, Schofield CJ. 2006. ORF17 from the clavulanic acid biosynthesis gene cluster catalyzes the ATP-dependent formation of N-glycyl-clavaminic acid. J Biol Chem 281:279–287. 40. Pérez-Llarena FJ, Liras P, Rodríguez-García A, Martin JF. 1997. A regulatory gene (ccaR) required for cephamycin and clavulanic acid production in Streptomyces

clavuligerus: Amplification results in overproduction of both β-lactam compounds.

J Bacteriol 179:2053–2059.

41. Santamarta I, López-García MT, Kurt A, Nárdiz N, Álvarez-Álvarez R, Pérez- Redondo R, Martín JF, Liras P. 2011. Characterization of DNA-binding sequences for CcaR in the cephamycin-clavulanic acid supercluster of Streptomyces clavuligerus. Mol Microbiol 81:968–981.

42. Bibb MJ. 2005. Regulation of secondary metabolism in Streptomycetes. Curr Opin Microbiol 8:208–215.

43. Li R, Townsend CA. 2006. Rational strain improvement for enhanced clavulanic acid production by genetic engineering of the glycolytic pathway in Streptomyces

clavuligerus. Metab Eng 8:240–252.

44. Song JY, Jensen SE, Lee KJ. 2010. Clavulanic acid biosynthesis and genetic ma-nipulation for its overproduction. Appl Microbiol Biotechnol 88:659–669. 45. Nath Jnawali H, Cheol Yoo J, Kyung Sohng J. 2011. Improvement of clavulanic

acid production in Streptomyces clavuligerus by genetic manipulation of structural biosynthesis genes. Biotechnol Lett 33:1221–1226.

46. Song JY, Kim ES, Kim DW, Jensen SE, Lee KJ. 2008. Functional effects of in-creased copy number of the gene encoding proclavaminate amidino hydrolase on clavulanic acid production in Streptomyces clavuligerus ATCC 27064. J Microbiol Biotechnol 18:417–426.

47. Jnawali HN, Lee HC, Sohng JK. 2010. Enhancement of clavulanic acid production by expressing regulatory genes in gap gene deletion mutant of Streptomyces

clavuligerus NRRL3585. J Microbiol Biotechnol 20:146–152.

48. Paradkar AS, Mosher RH, Anders C, Griffin A, Griffin J, Hughes C, Greaves P, Barton B, Jensen SE. 2001. Applications of gene replacement technology to

Streptomyces clavuligerus strain development for clavulanic acid production. Appl

Environ Microbiol 67:2292–2297.

49. Hung TV, Malla S, Park BC, Liou K, Lee HC, Sohng JK. 2007. Enhancement of clavulanic acid by replicative and integrative expression of ccaR and cas2 in

(29)

Streptomyces clavuligerus NRRL3585. J Microbiol Biotechnol 17:1538–1545.

50. Ser H-L, Law JW-F, Chaiyakunapruk N, Jacob SA, Palanisamy UD, Chan K-G, Goh B-H, Lee L-H. 2016. Fermentation Conditions that Affect Clavulanic Acid Production in Streptomyces clavuligerus: A Systematic Review. Front Microbiol 7. 51. Hoff B, Kamerewerd J, Sigl C, Zadra I, Kück U. 2010. Homologous recombination in the antibiotic producer Penicillium chrysogenum : strain ΔPcku70 shows up-reg-ulation of genes from the HOG pathway. Appl Microbiol Biotechnol 85:1081–1094. 52. Snoek ISI, Krogt ZA Van Der, Touw H, Kerkman R, Pronk JT, Bovenberg RAL, Berg MA Van Den, Daran JM. 2009. Construction of an hdfA Penicillium chrysogenum strain impaired in non-homologous end-joining and analysis of its potential for functional analysis studies. Fungal Genet Biol 46:418–426.

53. Kovalchuk A, Weber SS, Nijland JG, Bovenberg RAL, Driessen AJM. 2012. Chapter 1 Fungal ABC Transporter Deletion and Localization Analysis. Methods Mol Biol 835:1–16.

54. Weber SS, Kovalchuk A, Bovenberg RAL, Driessen AJM. 2012. The ABC transporter ABC40 encodes a phenylacetic acid export system in Penicillium chrysogenum. Fungal Genet Biol 49:915–921.

55. Kolar M, Puntb PJ, van den Hondel CAMJJ, Schwab H. 1988. Transformation of

Penicillium chrysogenum using dominant selection markers and expression of an Escherichia coli lacZ fusion gene. Gene 62:127–134.

56. Sigl C, Handler M, Sprenger G, Kürnsteiner H, Zadra I. 2010. A novel homologous dominant selection marker for genetic transformation of Penicillium chrysogenum: Overexpression of squalene epoxidase-encoding ergA. J Biotechnol 150:307–311. 57. Weber E, Engler C, Gruetzner R, Werner S, Marillonnet S. 2011. A Modular Cloning

System for Standardized Assembly of Multigene Constructs. PLoS One 6. 58. Pohl C, Mózsik L, Driessen AJM, Bovenberg RAL, Nygård YI. 2018. Genome editing

in Penicillium chrysogenum using cas9 ribonucleoprotein particles. Methods Mol Biol 1772:213–232.

59. Vrabl P, Artmann DJ, Schinagl CW, Burgstaller W. 2016. Rapid sample processing for intracellular metabolite studies in Penicillium ochrochloron CBS 123.824: the FiltRes-device combines cold filtration of methanol quenched biomass with resuspension in extraction solution. Springerplus 5.

60. Caines MEC, Elkins JM, Hewitson KS, Schofield CJ. 2004. Crystal Structure and Mechanistic Implications of N 2-(2-Carboxyethyl)arginine Synthase, the First Enzyme in the Clavulanic Acid Biosynthesis Pathway. J Biol Chem 279:5685–5692. 61. Hamed RB, Gomez-Castellanos JR, Henry L, Ducho C, McDonough MA, Schofield

(30)

(31)