Simultaneous detection of Homologous
Recombination and Non-Homologous End
Joining in eukaryotic cells
(Complete report)
Guus van de Steeg Cohort 2013/2014
Erasmus Medical Center
Simultaneous detection of Homologous Recombination and Non-Homologous End
Joining in eukaryotic cells
Version: 4.0 Date: 06-01-2014
Contact details
Student: Contact
Guus van de Steeg
g.vandesteeg@erasmusmc.nl g.vandesteeg@student.avans.nl
School guide: Contact
Dr. Arjen Bakker ahf.bakker@avans.nl
Mentors: Contact
Dr. Dik van Gent Inger Brandsma, MSc
d.vangent@erasmusmc.nl i.brandsma@erasmusmc.nl
Location Education
Avans Breda
Abstract
All cells contain proteins, which perform all functions inside the cell. Proteins are coded in DNA and are created by transcription and translation of the DNA. This only functions properly when the DNA is intact. Damage in the DNA can cause missing or mutated genes, which code for faulty proteins, which in turn can lead to apoptosis or carcinogenesis. Double strand breaks (DSB) are one of the most dangerous forms of DNA damage. Double strand breaks can lead to chromosome loss and/or chromosome rearrangements, in turn leading to gene loss or mutations.
The project was focused on two major DSB repair pathways: Homologous Recombination and Non-Homologous End Joining. There are several methods to detect and/or measure each pathway, but there is not yet an assay to detect both pathways at once. This is required to study the balance between the two pathways and ultimately to test the effect of knock-out genes to study their influence on both pathways.
For this purpose a reporter construct has been designed. This construct utilizes Sleeping Beauty (SB) Transposase to introduce a single DSB which the cell needs to repair. Repair results in the expression of one or two fluorescent proteins, with different localizations, dependent on the repair pathway used. Currently, the construct has been stably integrated into cells, however, no repair events have been observed.
Several experiments have been performed to find the cause for the lack of repair. One possibility was transposase inactivity. To test this the transposase-expression plasmid, more specifically the transposase open reading frame (ORF), has been sequenced and this resulted in the discovery of three missing nucleotides when compared to other SB transposase-expression plasmids. The ORF has been repaired and the plasmid has been transfected, but still no transposase activity has been detected.
Contents
1. Introduction...5
2. Theoretical background...6
2.1 Non-Homologous End Joining(NHEJ)...6
2.2 Microhomology Mediated End Joining (MMEJ)...7
2.3 Homologous Recombination (HR)...7
2.4 Single Strand Annealing (SSA)...8
2.5 DDR signaling...10
2.6 Transposon systems...10
3. Construct design...12
4. Methods...15
5. Results...20
6. Conclusion & Discussion...30
7. Source list...32
8. Appendix...34
8.1 CFP & YFP BLAST:...34
8.2 NeoR cloning:...35
8.3 Transposase activity assay:...36
1. Introduction
DNA is one of the most important parts of a cell, as it codes for proteins and therefore controls cellular activity. Damage in the DNA has to be repaired fast or proteins can be lost due to missing or mutated genes, leading to apoptosis or carcinogenesis. DNA damage can be caused by several mutagens, like ionizing radiation, UV radiation or chemotherapeutics. Double strand breaks (DSB) are one of the most dangerous forms of DNA damage. DSBs can lead to chromosome loss and/or chromosome rearrangements, in turn leading to gene loss or mutations [1,2,3,4,5,6]. Maintenance of DNA integrity is highly
dependent on DNA repair proteins. These proteins work together in several repair pathways, like homologous recombination (HR) and non-homologous end joining (NHEJ). Defective DSB repair is associated with various developmental, immunological, and neurological disorders and cancer [2,5]. For
example, Werner’s syndrome is a disease where genetic instability is caused by a defect in Homologous Recombination [5].
NHEJ and HR are the most prominent double strand break repair pathways in cells [1,2,3,4]. The balance
between these repair pathways is important to keep the cell vital [3]. NHEJ can occur during all phases of
the cell cycle, and represents the major pathway in G1 [2,4,6]. HR is preferred during the S and G2 phases,
as a sister chromatid is available to serve as template [1,2,3,6]. During S phase, where the DNA is replicated,
the replication forks can stall due to e.g. single strand breaks [1]. Stalled replication forks can lead to DSBs.
It is important that these DSBs are repaired by HR instead of NHEJ, as NHEJ would introduce translocations [6].
In this project two reporter constructs were tested, the first containing TN5 transposon sites and the second containing Sleeping Beauty (SB) transposon sites. It was hypothesized that TN5 transposase, being a prokaryotic transposase, could not reach the genomic DNA in the chromatin. Prokaryotes don’t contain chromatin, only free DNA, so TN5 transposase might not be able to reach the free DNA. SB, being a eukaryotic transposase originating from fish [7,8] should be able to handle chromatinized DNA.
Brandsma & van Gent describe several individual assays to measure NHEJ or HR, most using I- SceI restriction sites to create a DSB. However, when using restriction enzymes the ends are compatible and can recreate the restriction site. This can result in several cycles of cleavage and repair before the site is lost due to inaccurate repair [3]. Thus, several ways to determine the frequency and efficiency of NHEJ and
HR already exist, but there currently is no method to detect both pathways at the same time. Therefore a DNA construct has been designed to solve this problem. With this construct the used repair pathway can be detected by fluorescence microscopy. The construct is further explained in the section “Construct Design”.
When this assay is functional, the balance between NHEJ and HR can be defined. Furthermore, by knocking out genes required in each pathway, it is desired to find the influence of these genes on both pathways.
2. Theoretical background
2.1 Non-Homologous End Joining(NHEJ)
NHEJ is the most simple DSB repair pathway, as it ligates both ends back together [1]. During this process
mutations can occur at the breakage site due to trimming of the ends [1,2,3].
NHEJ starts when the Ku70/Ku80 heterodimer (or Ku protein) binds to the DSB. The Ku protein forms a complex with the catalytic subunit of the DNA dependent protein kinase (DNA-PKcs)[1,3]. If necessary the
DSB ends can be altered to make them compatible by shortening or lengthening them with respectively endonucleases (Artemis) or DNA polymerases (Polμ) [3]. DNA ligase IV, X-ray cross-complementation
group 4 (XRCC4) and Xrcc4 like factor (XLF)/Cernunnos form a ligation complex which ligates the ends
MRN-CtIP complex to generate single stranded DNA at the break, where the ssDNA tail is bound by RPA to remove secondary structures. BRCA2 replaces the RPA with Rad51, a protein which can invade the sister strand. The DNA end is extended using the intact sequence as a template. The strand invasion finishes by formation of Holliday junctions, which can result in crossover or non-crossover products [3].
2.2 Microhomology Mediated End Joining (MMEJ)
MMEJ functions as a back-up for NHEJ [9,10]. MMEJ usually takes place in cells where NHEJ is absent, as it is
a Ku-independent end joining mechanism which functions mostly when NHEJ does not [10]. MMEJ uses
microhomologous sequences during the alignment of broken ends before joining [9,10]. Microhomologies
are 1-6 bp complementary sequences in the DNA. Mostly microhomologies are not adjacent to the break, so resection occurs leading to deletion of the intermediary DNA [10]. Ku70/80 and Rad51 need to
be removed as they inhibit MMEJ [10]. This enables 5’–3’ resection by the MRN-complex that reveals
microhomologous sequences [9,10,11,12]. These homologies anneal and repair is completed by either flap
trimming, DNA synthesis followed by ligation [9,10]. This results in a deletion relative to the original
sequence.
2.3 Homologous Recombination (HR)
Homologous recombination is the safest DSB repair pathway in the cell, as it copies the DNA from a template. If during replication a DSB occurs and a sister chromatid is available, HR will use the sister chromatid as template, thus repairing the original DNA perfectly [1,3,11]. Because HR requires an exact copy
as a template, it is therefore restricted to the S and G2 phases of the cell cycle [1,3]. It is important to
regulate HR to prevent recombination between non-identical sequences [3]. When the repeats are not
aligned properly it can also lead to insertions or deletions in the sequence [1,3,11]. When a DSB occurs, the
strands are resected by the MRN-complex (consisting of Mre11, Rad50 and NBS1) [11,12] together with the
CtBP-interacting protein (CtIP) [13,14], along with other exonucleases [14,15]. This creates 3’-single stranded
DNA, of which the tail is coated by replicating protein A (RPA) to remove secondary structures [1,11,16].
BRCA2, a tumor suppressing protein, binds to the ssDNA tail and replaces the RPA with RAD51 [16]. RAD51
is a major protein in homologous recombination, as it is the key component to strand invasion [16]. The
ssDNA tail, coated with RAD51, searches the sister chromatid for a homolous sequence. The sister chromatid can now be used as a template for DNA polymerase.
2.4 Single Strand Annealing (SSA)
When a DSB occurs and a repeat of the sequence exists anywhere else in the genome, it can be repaired by HR, but when the sequence is unique it can be repaired by NHEJ [1,2,3,19]. When the DSB occurs in a
unique sequence between two repeated sequences, it can be stimulated to use the repeats to roughly repair the DNA [19,20]. This is what happens in SSA, a different form of homologous recombination [19,20].
However, it is different from HR, as the process is much simpler and it does not need strand invasion or the creation of Holliday junctions [20]. But both HR and SSA require 5’-3’ resection, creating 3’ tails [19,20,11].
The exact pathway is partially known in yeast, but not known in higher eukaryots. After resection the homologous sequences are aligned, followed by removal of the tails and ligation of the ends [19,20]. The
distance between the homologies is important in the efficiency of SSA [19,20], as the longer this distance
the less efficient SSA becomes; consistent with the need for more time for 5’ to 3’ resection. Sugawara et. al (2000) states that the minimum size of homology should be 63 to 89 bp [19].
Figure 2: Schematic overview of the DSB repair pathways.
NHEJ just ligates the ends of the break. This can cause insertions or deletions.
In contrast with NHEJ, MMEJ is Ku-dependent but needs a homology to function. This homology can be small.
HR resects the DNA ends and coats them with RPA. RPA is substituted for RAD51, which enables strand invasion. The strand with RAD51 searches the template (sister chromatid) for homologous sequences and uses this sequence as a template to repair its own DNA.
SSA functions much like HR, only it doesn’t need strand resection. It uses homology just like MMEJ, but requires a greater homology to function, which also causes bigger deletions in the original strand.
2.5 DDR signaling
To maintain the balance between NHEJ and HR, specific signaling molecules are required for the pathway to initiate. The pathway starts with the histone variant H2AX, which is targeted for phosphorylation in chromatin close to the break site. The phosphorylated form of H2AX, known as γH2AX, signals the presence of damage by marking nucleosomes in one or more megabases of DNA surrounding the DSB
[2,21]. Several signaling- and DNA repair proteins form foci around γH2AX. Foci are clusters consisting of
several proteins which form ‘repair centers’ around the DSB [2,21]. This step initiates the repair pathway,
dependent on the 53BP1 and BRCA1, which serve as regulators for the repair type initiated. 53BP1 contributes to NHEJ by interacting with chromatin at DSB sites where it limits dsDNA end resection, therefore effectively blocking HR initiation [21]. How BRCA1 is able to counteract 53BP1 activity during S
and G2 phases to suppress NHEJ and promote HR remains unclear. BRCA1 could inhibit 53BP1 directly during the S and G2 phases and/or actively promote HR, nullifying the influence of 53BP1 on NHEJ [2,21].
2.6 Transposon systems
Most transposon systems are enzymatic mechanisms where a DNA sequence (donor) is cut out and moved (transposed) to another (target) DNA sequence [7,22,23,24,25,26]. Transposable elements can cause, and
are associated with, other types of genetic rearrangements such as deletions, inversions, and chromosome fusions [23]. Both prokaryotic and eukaryotic organisms carry the elements needed for
transposition [22,23]. They could be considered as the ancient genetic machinery for causing genomic
rearrangements and, therefore, for facilitating genome evolution [23]. The transposon system consists of
two elements, the transposable element and the transposase [22,23,24,25,26]. The transposable element
encodes both the end sequence recognized by the transposase, and the transposase itself [22,23,24]. The
transposable element is defined by the specific sequences at its end [23]. Transposition of the
transposable element occurs precisely at the ends of the these sequences, so mutations in any base pair of these sequences reduces or even inhibits transposition [23,24].
The transposase is the other critical element of transposition [7,22,23,24,25]. Its functions include: Specific
binding to the end sequences, combining the ends through a protein oligomerization process, cutting the DNA adjacent to the end sequences, and finally inserting the transposable element DNA into the target site [22,23,24]. Transposition itself is quite rare, and a highly regulated process. So tight actually, that the cell
has to form a balance between transposition and ensuring its own genetic survival; as transposition causes chromosomal breakage and rearrangements [23,24].
The TN5 transposon system is a prokaryotic mechanism from E. coli [22,24,25]. The TN5 transposon codes for
both the TN5 transposase and a transposase inhibitor. This inhibitor determines the frequency of TN5 transposition [23]. An intact N-terminal sequence is required for the transposase's recognition of the 19-bp
In the past no transposon system existed which was functional in animals [26]. Ivics et. al. (1997) [7] have
created the Sleeping Beauty transposon system by molecular reconstruction to solve this problem [7,24].
A limitation of SB is that the transposed element tends to integrate at sites close to the donor site [25].
Previous studies showed that 50–80% of SB transpositions are located within 10–25 mb of the donor site
3. Construct design
To determine whether a cell utilizes NHEJ or HR to repair its DSBs, a DNA construct has been designed to detect both repair mechanisms simultaneously. The construct contains two inactivated genes, coding for fluorescent proteins, which need to be repaired by specific repair pathways to be translated properly. This construct is integrated into eukaryotic cells and by addition of a transposase a double strand break will be created. The transposase plays an important role in this assay, as the induced DSB can’t be recreated. A restriction enzyme requires a specific restriction site which is compatible and can be repaired after digestion. This repair will keep happening until finally a mutation occurs and the restriction site loses its specificity. The transposase removes a transposon, which will be lost and leaves a clean, single DSB. Since the DSB is located inside the ECFP, repair can result in YFP or CFP expression in either the nucleus, mitochondria or both. The expressed protein(s) and location of expression are a marker for the repair pathway used. With this construct it is possible to detect whether NHEJ, MMEJ, SSA or HR was used to repair the break.
Figure 3: The construct is intact. Without transposase the cell splices the construct, removing the second part of the ECFP protein and the IRES. The second part of ECFP contains the amino acids responsible for the blue color. Removal of this part effectively inhibits CFP expression. Removal of the IRES makes YFP expression impossible, since the ribosomes need the IRES to bind to be able to translate the second protein in the mRNA.
The construct contains several essential elements which are explained here to help understand the process:
The CMV (cytomegalovirus) promoter is a strong constitutive promoter which ensures constant transcription of the reporter genes. The reporter genes, Enhanced Cyan Fluorescent Protein (ECFP) and Enhanced Yellow Fluorescent Protein (EYFP), are variants of the Green Fluorescent Protein (GFP) commonly used as a reporter gene. The GFP, CFP and YFP sequences are similar except for a few nucleotides, shown in Appendix 8.1, page 33. This causes differences in excitation and emission. Upstream of the CFP is the NLS (nuclear localization signal) located, this ensures expression of the protein in the nucleus. The MT (mitochondrial localization signal) functions the same for YFP, only expression is targeted to the mitochondria.
The SB transposon sites are recognized by SB transposase. Important for expression of EYFP in the construct is the Internal Ribosomal Entry Site (IRES). The IRES functions as binding site for ribosomes to translate the mRNA. In eukaryotes ribosomes can only bind to the 5’ end of the mRNA sequence, since cap recognition is required for subsequent binding [8]. Additionally, the construct contains a splice
donor/acceptor. If the splice donor (located on the transposon) is not removed, the splicing will result in loss of the second part of the CFP and the IRES, preventing expression.
When SB transposase is added, a DSB is created. The cell can use four DSB repair mechanisms to repair the DSB, each resulting in CFP or YFP expression, or both.
Figure 4: When TN5 transposase is added the CFP contains a double strand break. Since the IRES is intact YFP will always be expressed, but CFP is dependent on the repair pathway.
If the cell now utilizes NHEJ, CFP will not be expressed as the gene contains a microhomology which, when not combined, will leave the gene nonfunctional. Since the splice donor is removed by excision of the transposon, the IRES is not spliced out and YFP can be expressed in the mitochondria.
If the cell uses MMEJ, the DNA will be repaired using a microhomology which results in CFP expression in the nucleus. YFP will also be expressed in the mitochondria.
When SSA is utilized, the cell aligns the first part of the YFP with the first part of the CFP. This mechanism is similar to MMEJ, only for larger sequences. After annealing two 3’ flaps are cut by nucleases. The gaps are filled by DNA polymerase. This causes a major deletion in the DNA. SSA only occurs when extensive resection has taken place. The DNA between the original two genes will be lost and the CFP is changed into YFP, resulting in only nuclear YFP.
When HR is used, not an exact copy of the construct, but the YFP gene on the construct itself will function as a template to repair CFP, since GFP clones are highly similar in sequence. After strand invasion, a DNA polymerase will use the YFP as a template to fill the gap caused by the transposase. As a result, YFP will be expressed in both the nucleus and the mitochondria.
4. Methods
Tissue culture
All cells were grown in DMEM/F10 (1:1) + 10% Fetal Calf Serum (FCS) + Penicillin/Streptavidin (P/S) in a 37°C incubator with 5% CO2.
Genomic DNA isolation
Cells (from a 10 cm dish) were trypsinized and centrifuged at 10.000 RCF. Pellet was washed with 1x PBS and transferred to safelock eppendorf tubes. Cells were lysed with 700µl lysis buffer (100mM Tris-HCl pH 8.0, 5mM EDTA, 0.2% SDS, 200mM NaCl) supplemented with 200µg/ml proteinase K and incubated overnight at 37°C in a shaker. Suspension was centrifuged 10 seconds before adding 700µl phenol:chloroform:isomayl-alcohol (Sigma). Suspension was centrifuged 5 minutes at 10.000 RCF and upper phase was transferred to new Safelocks. 700µl chloroform (Fluka) was added and centrifuged for 5 minutes at 14,200 RCF, upper phase transferred to new safelocks. 700µl 2-propanol (Fluka) was added and centrifugation 30 minutes at 14,200 RCF at 4°C, sup was discarded and pellet was washed with 70% EtOH and resuspended in 50µl deionized water.
PCR (Platinum Taq polymerase)
All PCRs using Platinum Taq were performed with the following conditions, unless stated otherwise: 1x PCR reaction buffer (Invitrogen), 0.2mM dNTP’s, 1.5mM MgCl2, 5pmol primers, 1ng DNA and 1U
Platinum Taq polymerase (Invitrogen) in a total volume of 50µl. The following program was used: Denaturation 2 min at 94°C, followed by 35 cycles of denaturation, 30 sec. at 94°C; annealing, 30 sec. at 55°C; extension, 3 min. at 72°C. Final extension of 5 min. at 72°C.
PCR (Phusion High-Fidelity polymerase)
All PCRs using Phusion HF polymerase were performed with the following conditions, unless stated otherwise: 1x HF Phusion reaction buffer, 0.2mM dNTP’s, 1.5mM MgCl2, 5pmol primers, 1ng DNA and 1U
Phusion HF polymerase (New England Biolabs) in a total volume of 50µl. The following program was used: Denaturation 2 min at 94°C, followed by 35 cycles of denaturation, 30 sec. at 94°C; annealing, 30 sec. at 55°C; extension, 3 min. at 72°C. Final extension of 5 min. at 72°.
LaminB immunofluorescence
Cells were grown on coverslips and fixed using 4% Paraformaldehyde and washed 3x short, 2x 10 min. with 1x PBS + 0.1% Triton X-100. Afterwards cells were washed with PBS+ (0.25g BSA, 0.075g Glycin, 50ml 1x PBS). LaminB (Santa Cruz) primary Ab was diluted 1:1000 in PBS+ and added to cells. Cells were incubated 1.5hours at RT. Afterwards washing was repeated and secondary Ab (Alexa594 Donkey-αGoat) was diluted 1:1000 in PBS+ and added to cells. Cells were incubated for 1 hour at RT in darkness. Repeated wash and transferred coverslips to slides containing Vectashield without Dapi (Vectorlabs). A fluorescence microscope (Leica DMRBE) was used to screen expression.
Protein Extraction
Cell culture medium was aspirated and cells were washed 2x with 1x PBS. 100µl 1x PBS was added and cells were scraped and transferred to an Eppendorf tube. 125µl Laemmli buffer was added and the tube was incubated at 95°C for 5 min. Solution was homogenized with a syringe and incubated at 95°C for 5 min.
Western blot
A 15% acrylamide gel was prepared with 5ml 30% acrylamide mix, 5ml 0.75M Tris-HCl pH 8.8, 100µl 10% SDS, 50µl 20% APS and 4µl TEMED and run at 50V for ±30 min, then 100V for 1-2h. The blot was assembled with an activated PVDF membrane. The blotting was done at 100V for 1 hour in 1x blot buffer. After blotting the Western blot was blocked for 30 min. in 5% skim milk powder in 1x PBS + 0.1% Tween-20. The primary antibody (9E10 αMyc) was diluted in blocking solution, added to the blot and incubated overnight. The blot was washed 4x 10 min. with 1x PBS + 0.1% tween. After washing the secondary antibody (αMouse-HRP 1:2000) was diluted in blocking solution and added to the blot, incubation was 1 hour at RT. The washing was repeated and the blot was incubated 1 min. with 0.5ml detection reagent 1 + 0.5ml detection reagent 2 (GE Healthcare cat#RPN2109). Afterwards the blot was measured with the Alliance (Uvitec).
Transformation
2µl plasmid DNA was added to 50µl competent E. coli. After 30 minutes on ice the suspension was incubated 45 sec at 42°C and again cooled for 5 minutes on ice. 200µl LB was added and suspension was incubated 1 hour at 37°C in a shaking incubator. The suspension was concentrated in 50µl LB and transferred to agar plates containing 30mg/ml ampicillin. After 24h incubation at 37°C colonies were transferred to 5ml LB supplemented with 0.1mg/ml ampicillin and incubated overnight at 37°C.
Plasmid DNA isolation (mini-prep)
4ml of transformed bacteria were centrifuged and sup was discarded. The pellet was resuspended in 50µl 1x maxi buffer (9.9mg/ml glucose, 25mM Tris-HCl pH 8.0, 10mM EDTA) and incubated on ice for 5 min. Next 100µl 0.2M NaOH, 1% SDS was added. After 5 min. incubation on ice, 75µl 3M NaAc pH 4.8 was added to the suspension followed by another 5 min. incubation on ice. Finally 225µl 5 M LiCl was added to the suspension and the suspension was incubated at -20°C for 10 minutes and centrifuged 10 min. at 10,000 RPM. Sup was transferred to a new tube and 900µl 96% EtOH was added, suspension was incubated 30 min. at -20°C followed by 10 min centrifugation at 10,000 RPM, 4°C. Sup was discarded and DNA was washed with 70% ethanol. After centrifugation 10,000 RPM, 4°C the sup was discarded and pellet was centrifuged shortly. Pellet was resuspended in 50µl deionized water.
Plasmid DNA isolation from eukaryotic cells (Hirt-Prep)
Cell culture medium was aspirated and cells were washed 2x with 1x PBS. 400µl “Hirt I” (0,6% SDS, 10mM Tris pH 8.0, 1mM EDTA pH 8.0) was added to cells and incubated 10 min. at RT. 100µl “Hirt II” (5M NaCl, 10mM Tris pH 8.0, 1mM EDTA pH 8.0) was added and incubated for 2 min. at RT. Formed clot was transferred to 1.5ml Eppendorf tubes. The eppendorfs were centrifuged at 15.000 RPM @ 4°C for 40 minutes. Supernatant was transferred to new eppendorfs. 250µl phenol:chloroform was added and mixed by shaking followed by centrifugation at 12.000 RPM for 4 minutes RT. The top phase was transferred to another tube; this phenol:chloroform ‘washing’ was repeated once. 250µl butanol was added and mixed by shaking, followed by centrifugation at 12.000 RPM for 1 minute. Bottom layer was transferred to a new tube and put on ice. 200µl 7.5M NH4Ac was added and filled to top with ice cold
100% EtOH. The mixture was mixed and chilled on ice, followed by 30 min @-20°C and centrifugation at 13.200 RPM @ 4°C. Supernatant was discarded. 1ml ice cold 70% EtOH was added to wash the DNA and several centrifugation steps were performed to remove the EtOH. DNA was respunded in 20µl deionized water.
Transposase activity assay
Plasmid DNA (Hirt-Prep) was digested with NgoMIV and SspI (New England Biolabs, incubation 2h at 37°C). Digested DNA was amplified by Taq-PCR with IB20 and IB22 (5pmol). DNA screening on 0.8% agarose gel electrophoresis. Explained on page 34 (Appendix 8.3)
Used primers
Primer name Sequence (5’ 3’) FW/RV
GFP-CR CATGGTCCTGCTGGAGTTCGTG FW Neo-RI CGTGCAATCCATCTTGTTCA RV EGFP-N CGTCGCCGTCCAGCTCGACCAG FW IB17 CCTGCTCGAGATGGGAAAATCAAAAGAAATC FW IB18 CCTAGCGGCCGCGTATTTGGTAGCATTGCC RV IB19 AATGGGCGGTAAGCAGAGCT FW IB20 ACTGCTTACTGGCTTATCGA FW IB21 TTATTCCAAGCGGCTTCGGC RV IB22 GAGGGAGAGGGGCGGAATTC RV GS1 TGAGCTAGCGTCGCCACCATGGC FW GS2 CTAATCGATTGTAACCATTATAAGCTGCA RV GS3 ACAATCGATTAGCCAGCAGGCAGAAGTATGCA FW GS4 TCACCGCGGAACGCAGTGAAAAAAATGCTTTA RV GS5 ACAATCGATTAGATGGTTGAACAAGATGGATT FW GS6 TCACCGCGGAACTCAGAAGAACTCGTCAAGAA RV GS8 AGCCACGTGGCTTTTGGCCGCAG RV GS11 CCGGGATAACTTCGTATAGCCTAGGCTATACGAAGTTATTT nvt GS12 GCCTCGACTGTGCCTTCTAG RV GS14 TGTACGGTGGGAGGTCTATA FW GS16 CGAAATAACTTCGTATAGCCTAGGCTATACGAAGTTATC nvt GS17 TGAAGCACGGGGGTGGCAGCATCATGTTGTGGGGGT FW GS18 ACCCCCACAACATGATGCTGCCACCCCCGTGCTTCA RV GS22 GTTCCGCGGTGAAATAAAGCAACAGCATCACAAATTTCACAA FW
Table of used antibodies
Protein Host Dilution Western Blot Dilution Immunefluorescenc e Company and product number
LaminB Goat - 1:1000 Santa Cruz
Biotechnology sc-6216
Alexa594 αGoat Donkey - 1:1000 Invitrogen
A11058 Alexa488
αMouse
Rabbit - 1:1000 Invitrogen
A11059
αMouse-HRP Rabbit 1:2000 - DAKO
9E10 αMyc Mouse 1:1000 - Santa Cruz
Biotechnology sc-40
Table of used plasmids
Plasmid name Transposon/Transposas e Tag Resistance marker Other pDvG107 Ampicillin Neomycin BFP, GFP pDvG191 TN5 Ampicillin Neomycin Transposon pDvG192 SB Ampicillin Neomycin Transposon pDvG181 TN5 Myc Ampicillin Neomycin Transposase
pDvG148 TN5 Myc Ampicillin Transposase
pDvG182 SB Myc Ampicillin Neomycin Transposase pSBM (Sleeping Beauty Myc) SB Myc Ampicillin Neomycin Transposase pRSBM (Repaired
Sleeping Beauty Myc)
SB Myc Ampicillin
Neomycin
Transposase
pCMV/myc/nuc Myc Ampicillin
Neomycin
MCS, nuclear localization signal
5. Results
To be able to detect NHEJ and HR simultaneously a reporter construct has been created. By introducing a DSB using a transposase four different repair pathways can be measured. The construct has been transfected into the cell where it has integrated into the genome. By fixing the cells and staining them with LaminB (goat) and αGoat Alexa594 (red) the nuclei can be seen on a fluorescent microscope. By checking the cells with different filters the CFP or YFP can be seen. As CFP emits in the same wavelength as DAPI, DAPI could not be used to stain the nuclei.
Earlier clones, made by I. Brandsma, contained the TN5-reporter construct (pDvG191), containing the TN5 transposon. The cells were transfected with 1μg TN5-expression plasmid (pDvG181), and fixed and stained after 48h. Figure 5 is a representative for all 191/182 transfections. On the left the nuclei are shown, stained with LaminB. On the right are the same cells, now viewed through a blue filter to detect CFP expression. This result was similar to the YFP expression. No YFP/CFP fluorescent cells were observed.
A
B
C
Figure 5: Fluorescence detection in LaminB-stained U2OS cells
A: pDvG191 #6 + TN5 transposase. Left: LaminB nuclear staining. Middle: CFP expression. Right: YFP expression. B: U2OS transfected with GFP. Left: LaminB nuclear staining. Right GFP expression.
C: Untransfected U2OS. Left: LaminB nuclear staining. Middle: CFP expression. Right: YFP expression.
Another TN5-transposase expression plasmid available is pDvG148. Both pDvG148 and -181 were transfected in U2OS and protein extracts were made. As both plasmids also code for a myc tag, expression was screened on Western blot. Figure 6 shows the results of both pDvG148 and -181 after Western blot and incubation with αMyc (Mouse) and αMouse-HRP. It is clear that pDvG181 is not expressed or in very low quantities.
Figure 6: Western blot of pDvG148 and 181. The blot was incubated with 9E10 (aMyc). pDvG181 is not expressed and experiments will continue with pDvG148.
As pDvG181-TN5 transposase is not expressed, the same clones have been transfected and screened with pDvG148-TN5 transposase. Figure 7 shows a representative result of clone pDvG191 #6 + pDvG148. Again, no CFP/YFP expression was visible.
A B C
Figure 7: pDvG191 clone 6 + TN5 transposase. A: LaminB nuclear staining
B: CFP expression C: YFP expression
Since TN5 is a prokaryotic transposon, it is possible the system doesn’t work in eukaryotic cells. For instance, prokaryotes don’t use chromatin. The transposase can possibly not reach the DNA, thus rendering it impossible to induce a DSB. pDvG192 clones, containing a SB transposon instead of TN5, have been made to test the Sleeping Beauty eukaryotic transposon. U2OS cells were transfected with pDvG192 and colonies were picked and grown. Since cells should not express CFP or YFP without transposase it was not possible to screen clones with a fluorescence microscope. Instead a PCR performed with primers GFP-CR and NeoRI, designed to fit onto the Neomycin resistance gene and YFP. A 1.3 kb band was expected. 96 clones were tested in total, 63 of them tested positive in this way. Figure 8 shows one of the gels containing several tested clones.
Figure 8: Screening of pDvG192 clones. Primers annealed to the Neo resistance gene and YFP, amplifying a 1.3kb band. As shown in the picture, “192+ #2” shows a band around 2.1kb, which suggests mutations during integration. As such this clone was not continued. Using this method, 63 clones have been selected and stored.
Several SB reporter (pDvG192) clones were transfected with pDvG182 (SB transposase). After 48h the cells were fixed and stained with LaminB before checking for fluorescence expression. There was still no CFP/YFP expression, as shown in Figure 9.
A B C
Figure 9: Fluorescence detection in LaminB-stained SB reporter clones + pDvG182 (SB transposase). A: LaminB staining of nuclear membrane
B: CFP expression C: YFP expression
Since pDvG182 does not contain a Myc tag, it was not detectable if SB transposase was expressed. Primers (IB17/18) were designed to introduce XhoI and NotI sites 5’ and 3’ of the SB transposase gene, so it could be inserted into the pCMV/myc/nuc plasmid, which contains a triple Nuclear localization signal and a Myc tag. Figure 10A shows the result after PCR with primers IB17 and IB18. The expected band was 1032bp, containing the extra restriction sites. After PCR, the PCR product and pCMV/myc/nuc were digested with XhoI and NotI and separated on gel, as seen in Figure 10B. DNA was extracted and E.
coli was transformed with the ligation product, containing the amplified SB transposase gene digested
with XhoI and NotI and the pCMV/myc/nuc plasmid, digested with XhoI and NotI. 6 colonies were picked and the plasmid DNA was extracted via Miniprep. The extracted DNA was screened with IB17/18 to select for the transposase gene. pDvG182 was used as positive control, since that already contained the
SB-transposase gene. Figure 10C shows clones #2, #3 and #6 are similar to the original plasmid. Clone #2
A B
C
Figure 10: Cloning of SB transposase in pCMV/myc/nuc
A: PCR of pDvG182 with IB17/18. Here the transposase gene has been amplified containing adjacent XhoI and NotI sites. B: Digestion of PCR product (A) and pCMV/myc/nuc with XhoI and NotI. DNA was extracted from gel using a Geneclean II DNA extraction kit, ligated and transformed.
C: Screening of transformed clones by PCR. SB transposase gene was cloned into pCMV/myc/nuc containing a myc tag. Clones 2, 3 and 6 were cultured for Maxiprep and renamed pSBM2, 3 and 6.
Expression of SBM-transposase was tested by transfecting U2OS cells with pSBM and extracting the proteins. Total protein was used in Western Blot and targeted with αMyc + αMouse-HRP, shown in figure 11. pDvG148 (TN5 transposase) was used as a positive (αMyc) control and αGRB2 was used as loading control.
The newly created pSBM plasmid was transfected in SB transposon reporter clones and cells were fixed after 48h and stained with LaminB. Cells were viewed under a fluorescence microscope to detect CFP and YFP expression, but still none was observed; as shown in Figure 12.
A B C
Figure 12: Immunofluorescence of U2OS + pSBM. A: LaminB staining of nuclear membrane. B: CFP expression
C: YFP expression
Even though the transposase was expressed, it was not certain that the enzyme was active. Therefore an assay was developed to test the transposase activity. The transposase activity assay was performed by transfecting pSBM and pDvG192 in U2OS WT cells. After 48h the plasmids were isolated by Hirt-Prep. The plasmids were digested with NgoMIV and SspI, followed by Taq-PCR with IB20/22. The restriction sites of both enzymes are located only inside the transposon, so when the transposon is removed the restriction sites are removed too. The PCR will amplify the transposed fragment only if the break is repaired. If the transposon is not removed, the restriction sites will be intact and the DNA will be digested. The PCR will stall due to the breakage and no band will be visible on gel. The gel shows no transposase activity at all, which was also observed in the fluorescence microscopy
A negative control consisted of only the reporter-construct (pDvG192) transfection, which would definitely contain the restriction sites. The assay is further explained in Appendix 8.3, page 34. Figure 13 shows the result of the assay with pSBM and pDvG192.
Figure 13: Transposase activity assay of pSBM. The transposon sites of the reporter construct contain two restriction sites, which would digest the transposon fragment if the transposon is not removed, making PCR impossible. Absence of a band in the “Hirt 192 SBM” sample proves inactivity of the transposase. “Hirt 192” serves as a negative control, since no transposase is added. The pDvG192 plasmid has been amplified and shows an uncut band of 3000 bp.
As no band was visible, it could be assumed that the transposase was expressed, but not functional. The pDvG192 control shows a band around 3000bp, which corresponds to the size of the construct with transposons. The second lane, containing both the pDvG192 SB construct plasmid and the pSBM transposase plasmid, should have shown a band around 900 bp, but since no band was visible the transposase has not transposed the fragment.
To isolate a possible cause for inactivity, the pSBM transposase open reading frame (ORF) has been sequenced.
After sequencing of the SB transposase ORF a deletion was detected of 3 nt, coding for Alanine. Primers (GS17/18) were designed to repair this deletion. Each primer aligns onto the deletion, and together with IB17/18 two separate fragments were created, as shown in Figure 14A. Part 2 was not amplified correctly in this PCR, but later the fragment was successfully amplified. Unfortunately, the result of that gel was lost. The two fragments containing the correct part of the specific sequence were used as template with primers IB17/18 to create 1 correct fragment, as shown in Figure 14B. The PCR fragment was digested with XhoI and NotI (insert), along with pCMV/myc/nuc (vector). Both insert and vector were ligated with T4 ligase and transformed into DH5α E. coli. Transformants were picked and the plasmid DNA was isolated by Miniprep. Clones were screened by PCR (Figure 14C) and digestion of NotI and XhoI, shown in Figure 14D. Selected clones were sequenced and clone #16 contained the repaired sequence, without any additional mutations. Experiments were continued with clone #16, renamed pRepaired-Sleeping-Beauty-Myc(pRSBM).
A B
C
D
Figure 14: Repair of SB ORF and cloning in pCMV/myc/nuc
A: PCR of pDvG182 with IB17/GS18 and GS17/IB18. The created fragments contain the correct sequence and will be able to align with each other to serve as template.
B: PCR to combine part 1 and part 2 into 1 repaired SB ORF.
C: Screening of transformed clones by PCR. Here all clones were tested positive.
D: Screening of transformed clones by digestion with XhoI and NotI. Repaired SB transposase gene was cloned into pCMV/myc/nuc containing a myc tag. Clone 16 was cultured for Maxiprep and renamed pRSBM.
The newly created pRSBM transposase-plasmid was transfected in SB transposon reporter clones and cells were fixed after 48h and stained with LaminB. No CFP or YFP expression was detected. The results are visible in Figure 15.
A
B
Figure 15: Fluorescence detection in LaminB-stained U2OS SB reporter clones after pRSBM transfection. A: pDvG191 clone 17 + pRSBM. Left: LaminB nuclear staining. Right CFP/YFP expression.
B: U2OS transfected with GFP. Left: LaminB nuclear staining. Middle: GFP expression. Right: Merge
After transfection of the pRSBM transposase-plasmid the total protein was extracted from cells and run on 12% acrylamide gel. Due to false-negative Lowry results a higher volume of protein was added in the TN5 (positive expression control) and U2OS (negative expression control) lanes. This results in a seemingly lower expression of RSBM transposase, as visible in Figure 16.
Figure 16: Western Blot of Repaired-Sleeping-Beauty-Myc (RSBM) expression. TN5 transposase serves as a positive control for protein expression. The untreated sample is a protein extract from U2OS WT. TN5 transposase and RSBM contain a Myc-tagged transposase coding gene, and are detected by an αMyc primary antibody. GRB2 functions as a loading control and this shows that a lower amount of total protein is loaded in the pRSBM lane.
The transposase activity assay was performed by transfecting SB-transposase (pRSBM) and the SB reporter construct (pDvG192) in U2OS WT cells. After 48h the plasmids were isolated by Hirt-Prep. The plasmids were digested with NgoMIV and SspI, followed by Taq-PCR with IB20/22.
αMyc
To see if the Hirt prep was successful, the isolated plasmids were amplified with PCR and run on gel, visible in the “Hirt pRSBM” and “Hirt p192” lanes. This shows that pDvG192 was not isolated, but since it only functions as negative control, and there are no positive results, the experiment does not need to be repeated. Additionally, another reporter construct (pDvG107) is similar to pDvG192 except that it does not contain transposon sites, it was used as a positive control for PCR. Amplification of pDvG107 with IB20/22 results in a band of around 1000bp, which would also be expected in the pDvG192-transfected samples after successful transposition. Additionally, pDvG107 has been added together with the isolated Hirt-prep samples. If pDvG107 would not be amplified in combination with the Hirt-prep samples, it would indicate that a contamination (presumably SDS) would inhibit amplification.
Summary: DNA was isolated by Hirt-prep plasmid isolation, except for the negative control. This was visualized by amplifying the DNA by PCR. No transposase activity was detected, as no band was visible in the “Digested pRSBM” lane. The SB reporter construct (pDvG192) was amplified by PCR as size control for the isolated DNA. A reporter construct, without transposon mechanism (pDvG107), was amplified as a positive size control for the transposase activity and also added to the isolated DNA to test for contamination which could inhibit amplification.
Figure 17 shows no transposase activity at all, which was also observed in the fluorescence microscopy.
Figure 17: U2OS cells were transfected with pRSBM and pDvG192 or just pDvG192 and after 48h the DNA was isolated by Hirt-Prep. The isolated DNA and pDvG107, which serves as a positive control, were digested with NgoMIV and SspI and amplified with Taq-PCR. pDvG107 was also tested undigested and added together with the Hirt-prep DNA as control for contamination of SDS in the Hirt-prep DNA. Undigested ‘Hirt pRSBM’ and ‘Hirt pDvG192’ were run on gel to determine DNA presence. The pDvG192 Hirt-prep was unsuccesful, but this is not relevant for the obtained results as It functions as negative control and there are no positive results.
YFP background expression
Three clones (pDvG192+ #17, #20 and #22) expressed nuclear YFP. Unfortunately, a similar amount of expression was observed in the transposase-negative samples. The efficiency in both with and without transposase was very low, less than 50 expressing cells on a confluent 24mm cover glass.
#17 A B
#20 A B
#22 A B
Figure 18: Fluorescence detection in LaminB-stained U2OS SB reporter clones. Only the LaminB/YFP merge is shown. A: With transposase. B: Without transposase
This YFP expression is presumably due to premature recombination, which uses the homology between
CFP and YFP to remove most of the construct. To disable this premature recombination, a neomycin
resistance gene (NeoR) will be inserted between the SB transposon sites, as shown in Figure 19. Without the addition of transposase, the NeoR gene is present and ensures the survival of the cells in addition of neomycin. If the cell recombines the construct and removes the transposon sites, the NeoR gene is removed and the cell dies due to the neomycin. After addition of transposase, however, the cell would also lose its NeoR gene. The SB transposase expression plasmid (pSBM) also contains a NeoR gene to ensure cellular survival. In the previous version of the reporter construct, the NeoR was present in the plasmid, outside of the reporter part. This gene will be removed by digestion and the gap will be filled with a LoxP site. The LoxP site esures that only 1 copy of the construct will be integrated after addition of the Cre enzyme. The cloning is explained in detail in Appendix 8.2 on page 35.
The cloning is still in progress and there are no proper results yet.
Figure 19: Intact construct with a Neomycin Resistance gene inserted between the transposon sites. This kills all cells with premature recombination.
6. Conclusion & Discussion
In this project a new assay was designed and tested to simultaneously detect Non-Homologous End Joining and Homologous Recombination, two major double strand break-repair pathways. Already several assays exist, but none are able to detect both pathways at once. It is desired to know the balance between both pathways, to be able to test the influence of several repair-pathway enzymes on
both pathways: i.g. Ku, BRCA and 53BP1.
Most single-pathway-detection-assays make use of the I-SceI nuclease, which recognizes a specific sequence, which can be repaired by ligation. Therefore it might take several cycles of digestion and repair before the sequence becomes unusable due to a mutation. The new assay uses a transposase to create one non-repeatable DSB. After repair CFP and/or YFP (GFP-like proteins) can be expressed, dependent on the pathway used to repair the break.
Two reporter constructs , differing only in transposon mechanism, were tested. The first, containing the prokaryotic TN5 transposon mechanism, did not express CFP or YFP after addition of TN5 transposase. At first it was detected that the transposase was not expressed at all, so the experiment was repeated with another plasmid which was tested positive for protein expression. Still there was no fluorescence detected. The hypothesis was that TN5 could not reach the DNA on the eukaryotic chromatids. Therefore the project was continued with the second transposon mechanism, the eukaryotic Sleeping Beauty transposon system.
The Sleeping Beauty reporter construct did not result in CFP or YFP expression either, so to find the possible problem the transposase enzyme was examined. Protein expression could not be tested with the original SB construct (pDvG182), as the plasmid did not contain a tag. The open reading frame was amplified from the plasmid with primers which introduce restriction sites onto the ORF. The ORF was then ligated into pCMV/myc/nuc which consists of three nuclear localization signals and a myc tag (among others), creating the pSleepingBeautyMyc (pSBM) plasmid. Expression of the protein was proved by Western blot.
To test the activity of the enzyme a new assay was designed, which can detect the presence of the transposons in the construct. In-between the transposon ends, two specific restriction sites exist. After addition of the transposase, it was expected that the transposon and the restriction sites would be discarded. Amplification of the sequence would only be possible after removal of the transposon, as the nucleases would make PCR impossible. Unfortunately the assay resulted in no visible activity of the enzyme, as no PCR products were visible.
Sequencing of the pSBM transposase ORF indicated the absence of three consecutive nucleotides, coding for Alanine. The sequence was repaired and a new plasmid was created, pRepairedSleepingBeautyMyc (pRSBM). Western blot of the new plasmid showed protein expression, but the activity assay was once again negative. Also no CFP or YFP expression was detected after transfection of the plasmid.
Also, three reporter clones were found with YFP expression, but a similar amount of expression was found in the samples without transposase. This meant that the cells had somehow recombined the construct so YFP was expressed in the nucleus. To counter this effect a new construct is being cloned
with a NeoR in-between the transposon ends, so if the cells would recombine they would remove the resistance gene and lose their resistance to the neomycin in the medium.
In short, there has not been any CFP or YFP expression found yet. This can be caused by a catalytically inactive SB transposase, but also by the reporter construct itself. The plasmid has been cloned and edited repeatedly, which might have caused mutations which have rendered the construct nonfunctional. The construct is also dependent on a lot of different factors to function properly, like: correct transposon sequences, functional transposon excision, functional repair, enough CFP/YFP expression to be visualized, etc.
In the future it is important to design a new assay to determine the transposase activity. The currently used plasmid is too big and success is dependent on multiple factors, such as correct transposon sequences and an active transposase. A simpler plasmid, for example the transposon together with an
EGFP gene, or where removal of the transposon promotes expression of a resistance gene like NeoR;
could improve the detection of transposase activity. To be able to do this with a new, or the old, assay; it is important to know the transposon sequences for certain. If the transposase is active, but the recognition sequences are mutated, the enzyme will not function. Finally it is also possible the entire construct and CFP and YFP expression are happening and functional, but that the effiency is too low to be detected properly.
Another possibility is to use the Piggybac(PB) transposon system. For this a new reporter construct has to be created, with the PB recognition sites. The PB transposon mechanism is already a widely used transposon system in human, insect and mouse gene cloning [27,28,29].
7. Source list
[1] Alberts, Molecular Biology of The Cell. P295-311, 5th edition.
[2] Chapman, JR. (2012) Playing the End Game: DNA Double-Strand Break Repair Pathway Choice
Molecular Cell, 47
[3] Brandsma, I., Van Gent, D.C. (2012) Pathway choice in DNA double strand break repair: observations of a balancing act. Genome integrity, 3:9
[4] Shibata, A., Conrad, S., Birraux, J., Geuting, V., Barton, O., Ismail, A., Kakarougkas, A., Meek, K., Taucher-Scholz, G., Löbrich, M., Jeggo, PA. (2011) Factors determining DNA double-strand break
repair pathway choice in G2 phase. The EMBO Journal; 30, 1079–1092
[5] Hoeijmakers, J.H.J (2009) DNA Damage, Aging, and Cancer; The new England Journal of Medicine; 361;15
[6] Sonoda, E., Hochegger, H., Saberi, A., Taniguchi, Y., Takeda, S. (2006) Differential usage of non-homologous end-joining and non-homologous recombination in double strand break repair. DNA Repair, 5; 1021-1029
[7] Ivics, Z., Hackett, BP., Plasterk, HP., Izsvak, Z. (1997) Molecular Reconstruction of Sleeping Beauty, a Tc1-like Transposon from Fish, and Its Transposition in Human Cells. Cell; Vol. 91, 501–510.
[8] Pelletier, J., Sonenberg, N. (1988) Internal initiation of translation of eukaryotic mRNA directed by a sequence derived from poliovirus RNA. Nature; 334(6180):320-5.
[9] Bennardo, N., Cheng, A., Huang, N., Stark, J.M. (2008) Alternative-NHEJ Is a Mechanistically Distinct Pathway of Mammalian Chromosome Break Repair. PLoS Genetics. 4:6.
[10] McVey, M., Lee, S.E. (2008) MMEJ repair of double-strand breaks (director’s cut) deleted sequences and alternative endings. Trends in Genetics. 24:529-538
[11] Heyer, W.D., Ehmsen, K.T., Liu, J. (2010) Regulation of Homologous Recombination in Eukaryotes.
Annual Review of Genetics. 44:113–39
[12] Stracker, T.H., Petrini, J.H. (2011) The MRE11 complex: starting from the ends. Nat Rev Mol Cell Biol. 12:90–103.
[13] Limbo, O., Chahwan, C., Yamada, Y., de Bruin, R.A., Wittenberg, C., Russell, P. (2007) Ctp1 is a cell-cycle-regulated protein that functions with Mre11 complex to control double-strand break repair by homologous recombination. Mol Cell. 28:134–146.
[14] Sartori, A.A., Lukas, C., Coates, J., Mistrik, M., Fu, S., Bartek, J., Baer, R., Lukas, J., Jackson, S.P. (2007) Human CtIP pro motes DNA end resection. Nature, 450:509–514.
[15] Wyman, C., Kanaar, R. (2006) DNA double-strand break repair: all's well that ends well. Annu Rev
Genet, 40:363–383.
[16] Sugiyama, T., Zaitseva, E.M., Kowalczykowski, S.C. (1997) A single-stranded DNA-binding protein is needed for efficient presynaptic complex formation by the Saccharomyces cerevisiae Rad51 protein. J
Biol Chem, 272:7940–7945.
[17] Maher, R.L., Branagan, A.M., Morrical, S.W. (2011) Coordination of DNA replication and recombination activities in the maintenance of genome stability. J Cell Biochem. 10:2672-82
[18] Pardo, B., Gomez-Gonzalez, B., Aguilera, A. (2009) DNA repair in mammalian cells: DNA double-strand break repair: how to fix a broken relationship. Cell Mol Life Sci, 66:1039–1056.
[19] Sugawara, N., Ira, G., Haber, J.E. (2000) DNA Length Dependence of the Single-Strand Annealing Pathway and the Role of Saccharomyces cerevisiae RAD59 in Double-Strand Break Repair. Mol Cell Biol. 14:5300-9
[20] Ivanov, E.L., Sugawara, N., Fishman-Lobell, J., Haber, J.E. (1996) Genetic Requirements for the Single-Strand Annealing Pathway of Double-Single-Strand Break Repair in Saccharomyces cerevisiae. Genetics. 3:693-704
[21] Ciccia, A., Elledge, S.J. (2010) The DNA Damage Response: Making It Safe to Play with Knives. Mol
Cell Biol. 2:179-204
[22] Davies, D.R., Goryshin, I.Y., Reznikoff, W.S., Rayment, I. (2000) Three-Dimensional Structure of the Tn5 Synaptic Complex Transposition Intermediate. Science. 289(5476):77-85
[23] Reznikoff, W.S. (1993) The TN5 transposon. Microbiol. 47:945-63
[24] Igor, Y.G., Reznikoff, W.S. (1998) Tn5 in Vitro Transposition. THE JOURNAL OF BIOLOGICAL
CHEMISTRY. 273:13, 7367–7374
[25] Dupuy, A.J., Akagi, K., Largaespada, D.A., Copeland, N.G., Jenkins, N.A. (2005) Mammalian mutagenesis using a highly mobile somatic Sleeping Beauty transposon system. Nature. 436(7048):221-6 [26] Geurts, A.M., Yang, Y.,Clark, K.J., Liu,G., Cui, Z., Dupuy,A.J. Bell, J.B., Largaespada, D.A., Hackett, P.B. (2003) Gene Transfer into Genomes of Human Cells by the Sleeping Beauty Transposon System.
Molecular Therapy. 8:1, 1525-0016/03
[27] System Biosciences, Transposagen. PiggyBac™ Transposon Vector System Cat. # PBxxx-1 User Manual
[29] Lia, Z., Michaelb, L.P., Zhouc, D., Nagyb, A., Rinia, J.M. (2013) Simple piggyBac transposon-based mammalian cell expression system for inducible protein production. Proc Natl Acad Sci U S A. 13:5004-9
8. Appendix
8.1 CFP & YFP BLAST:
Differences in GFP and CFP sequence. The changes in amino acids cause a difference in emission and excitation, resulting in a different colour.
Query: CFP Subject: GFP
Differences in GFP and YFP sequence. The changes in amino acids cause a difference in emission and excitation, resulting in a different colour.
8.2 NeoR cloning:
Fragment 1 (NheI/ClaI) and Fragment 3 (SacII/PmlI) are amplified from pDvG192. Fragment 2 (ClaI/SacII) is amplified from pCMV/myc/nuc. The fragment’s starts and ends are compatible for both PCR and digestion with the respective enzymes. The fragments are combined and the fragments (insert) and the original pDvG192 (vector) are digested with NheI and PmlI. Ligation of insert + vector results in the original pDvG192 sequence, apart from an inserted NeoR gene with compatible promotor and terminator.
8.3 Transposase activity assay:
The cells are transfected with pRSBM and pDvG192. If the transposase is active, the transposon is removed and the DNA repaired. After DNA isolation a PCR will amplify the DNA, showing a band on gel. If the transpose is not active however, NgoMIV and SspI which recognize sequences inside the transposon will cut the DNA, making it impossible for polymerase to amplify the DNA. This way the transposase activity can be tested.
8.4 Protocols:
Tissue culture
All cells were grown in DMEM/F10 (1:1) + 10% FCS + P/S in a 37°C incubator unless stated otherwise.
Thawing of cell lines
1. Fill a tube with 3ml warm medium.
2. Thaw the cells carefully in a 37°C water bath. 3. Add the cells to the tube.
4. Centrifuge the cells, 1000 rpm, 5 min, 20°C
5. Remove sup and resuspend cells in 8ml fresh medium and transfer to 10cm plate.
Culturing
1. Warm medium (>15min) before culturing. 2. Wash cells once with 10ml 1x PBS.
3. Remove PBS and add 1ml TE (Trypsin EDTA)
4. Incubate ±5 min at 37°C (or until all cells are floating) 5. Meanwhile prepare new plates.
6. Add 4ml medium to TE suspension and homogenize suspension. 7. Transfer required amount of suspension to new plates to dilute cells.
Freezing
1. Repeat steps 1-4 of Culturing.
2. Add 4ml medium to TE suspension and homogenize suspension.
3. Transfer suspension to a 15ml tube and centrifuge 5 min, 1000 rpm, 20°C 4. Prepare 2 cryotubes.
5. Remove supernatant and resuspend pellet in 2ml medium + 10% DMSO. 6. Transfer 1ml suspension to each 1.8ml cryotube.
7. Store cryotubes overnight at -80°C. 8. Transfer cryotubes to N2(l).
Transfection
1. Seed cells in a 6 wells plate with coverslips, 2ml total susp. 2. After 24 h, prepare transfectionmix:
a. Prepare amount
x=(100∗samples)+50 ml
DMEM (no supplements)b. Add 1µg/100µl plasmid DNA to the mix.
c. Add XtremeGene to mix, 3µl XtremeGene per 1µg DNA d. Incubate mix 15 min. @ RT.
3. Wash cells once with 1x PBS.
4. Add 2ml DMEM/F10 (1:1) + 10% FCS per well.
5. After incubation, transfer 100µl transfectionmix per well; mix carefully. 6. After 48 h, fix cells.
Fixation of cells
1. Wash cells twice with 1x PBS.
2. Add 1ml 4% PFA to wells. Incubate 15 min. 3. Remove PFA and wash once with 1x PBS.
LaminB immunofluorescence
PBS+: 100ml PBS, 0.5g BSA, 0.15g glycine Primary Ab: LaminB 1:1000
Secondary Ab: Alexa 594 1:1000
1. Wash 2x short in PBS+0,1% triton 2. Wash 2x 10 min in PBS+0,1% triton 3. Wash 1x short in PBS+
4. Dilute primary Ab in PBS+. 150µl solution per coverslip. 5. Incubate 1,5 hour in primary Ab.
6. Repeat step 1-3
7. Dilute secondary Ab in PBS+. 150µl solution per coverslip. 8. Incubate 1 hour. From now on, avoid light as much as possible. 9. Repeat step 1-3
10. Add vectashield (without dapi) to slides and transfer coverslips to slides. Dry and seal slides with nail polish.
Western blot
1x PAGE buffer: 3g Tris-HCl, 14.5g glycine, 1g SDS, 1000ml dH2O
4x sample buffer: 5ml 0.625M Tris-HCl pH 6.8; 1ml 20% SDS, 2.1ml 87% glycerol, 400µl β-mercaptoethanol, 500µl 0.5% BPB.
Preparation of 15% acrylamide gel:
1. Add together: a. 5ml 30% acrylamide b. 5ml 0.75M Tris-HCl pH 8.8 c. 100µl 10% SDS d. 50µl 20% APS e. 4µl TEMED
2. Mix and pour into gel chamber. 3. Add 1ml 70% EtOH
4. After gel has polymerized, add together for stacking gel: a. 2.05ml deionized water b. 0.5ml 30% acrylamide c. 0.375µl 1M Tris-HCl pH 6.8 d. 30µl 10% SDS e. 15µl 20% APS f. 3µl TEMED
SDS-PAGE
1. Transfer gel to running tray and fill inner chamber with 1x PAGE buffer. 2. Remove comb and load 25µl sample and 8µl All Blue ladder (Bio-Rad)
a. Samples: DNA + 4x sample buffer (4 : 1)
3. Run at 50V until samples have passed through the stacking gel, then at 100V until front has passed end of gel.
Western Blot
10x blot buffer: 1000ml H2O 30g Tris-HCl, 145g Glycine
1x blot buffer: 100ml 10x blot buffer, 200µl methanol, 700µl H2O
Blocking solution: 5% skim milk powder, 1x PBS + 0.1% tween
1. Activate PVDF membrane 15 sec in methanol, afterwards transfer to water. 2. Assembe blot:
a. Blot clamp, black side down. b. Sponge
c. Pre-wet filter paper d. Acrylamide gel e. PVDF membrane f. Pre-wet filter paper g. Sponge
h. Close blot clamp
3. Place blot in blotting tray, black side to negative (black) electrode. 4. Add ice block and stirrer. Run 1 hour at 100V
5. Remove membrane and block 30 min with blocking buffer.
6. Dilute primary Ab (9E10) 1:1000 in blocking buffer, add to membrane and incubate overnight at 4°C.
7. Wash membrane 4x 10 min. with 1x PBS + 0.1% tween.
8. Dilute secondary Ab (aMouse-HRP) 1:2000 in blocking buffer, add to membrane and incubate 1 hour at RT.
9. Repeat step 7.
10. Incubate membrane 1 min with 0.5ml detection reagent 1 + 0.5ml detection reagent 2 (GE Healthcare cat#RPN2109)
Genomic DNA isolation
1. Use safelock eppendorf tubes. 2. Wash cell pellet once with 1x PBS.
3. Lysate cell pellet with 700μl lysis buffer + 200 μg/ml proteinase K (14 μl, 10mg/µl stock). 4. Incubate overnight shaking @ 37°C.
5. Centrifuge briefly.
6. Add 700 μl phenol:chloroform:isoamyl-alcohol and vortex. 7. Centrifuge 5 min @ max RPM.
8. Transfer upper phase to a new eppendorf . 9. Add 700 μl chloroform.
10. Centrigue 5 min @ max RPM.
11. Transfer upper phase to a new eppendorf. 12. Add 700 μl isopropanol.
13. Centrifuge ≥ 30 min @ max RPM, 4°C
14. Immediately remove supernatant, pellet can be loose. 15. Add 500µl 70% EtOH.
16. Vortex and centrifuge 5 min @ max RPM. 17. Remove supernatant and centrifuge briefly. 18. Airdry pellet
19. Solve DNA in 50 μl deionized water shaking @ 37°C for 30 min. a. If the pellet is too big, incubate 1 hour @ 55°C.
Transformation
1. Thaw competent E. coli on ice for 10 min. Also cool plasmid on ice. 2. Add 2µl ligationmix to 50µl E. coli and incubate 30 min. on ice. 3. Heat shock: 45 sec at 42°C. Cool on ice afterward for 5 min. 4. Add 200µl LB to 50µl transformant.
5. Incubate 1 h shaking at 37°C.
6. Meanwhile, dry and warm agar plates.
7. Centrifuge sample and resuspend in 50µl LB. Spread drop over the plate. 8. Incubate plates O/N at 37°C.
Plasmid DNA isolation (mini-prep)
10x maxi buffer: 99.1g glucose, 250ml 1M Tris-HCl pH 7.5, 200ml 0.5M EDTA pH 8.0, 550ml H2O.
Buffer 2: 0.2M NaOH, 1% SDS Buffer 3: 3M NaAc pH 4.8 Buffer 4: 5 M LiCl
1. Spin down the cloudy cultures in 2ml eppendorf tubes (1 min 10.000 rpm). Remove supernatant. 2. Prepare buffer 1: 100µl 10x maxi buffer + 0.9ml deionized water.
3. Incubate 5 min. on ice.
4. Add 100µl buffer 2, mix gently and incubate 5 min. on ice. 5. Add 75µl buffer 3, mix gently and incubate 5 min. on ice. 6. Add 225µl buffer 4, mix gently and incubate 10 min. -20°C 7. Store 96% EtOH at -20°C.
8. Spin 10 min. at 10.000 rpm 9. Transfer supernatant to new tube. 10. Add 900µl 96% EtOH (-20°C). 11. Incubate 30 min at -20°C. 12. Spin 10 min. at 10.000 rpm, 4°C.
13. Remove supernatant and add 900µl 70% EtOH to wash pellet. 14. Spin 10 min. at 10.000rpm, 4°C.
15. Remove supernatant and spin shortly. 16. Remove rest of EtOH.
17. Resuspend pellet in 30µl deionized water. 18. Add 5µl RNase A.
Plasmid DNA isolation (Maxi-prep)
Plasmid DNA isolation from eukaryotic cells (Hirt Prep)
1. Recovery of plasmid DNA from transfected cells
2. Gently aspirate culture medium. Wash cells 2x with 3ml 1x PBS.
3. Add 400µl “Hirt I” (0,6% SDS, 10 mM Tris pH 8.0, 1 mM EDTA pH 8.0) at RT. Cells lyse and become clear immediately. Incubate 10 minutes.
4. Swirl gently for about 30 seconds. Cells should be a gooey clot that slowly moves across plate surface.
5. Add 100µl “Hirt II” (5M NaCl, 10 mM Tris pH 8.0, 1mM EDTA pH 8.0) at room temp. Tilt and swirl plate briefly to mix. Gooey clot becomes cloudy. Let sit on benchtop for about 2 minutes.
6. For last time, tilt and swirl; clot should slide freely over surface of plate. Carefully pour clot into 1.5ml Eppendorf tube.
7. Centrifuge 15.000 RPM @ 4°C for 40 minutes. Draw off clear supe to fresh tube, taking care to avoid white clumps.
8. Add 250µl phenol:chloroform. Cap tightly and vortex well. Centrifuge 12.000 RPM for 4 minutes RT. Expect small white pellet at bottom, cloudy interface, and sometimes white floaters in aqueous phase.
Transfer aqueous phase (top) to fresh tube (leave interface but if “floaters” come with, it’s OK.) 9. Repeat step 8. Do second extraction just as above; this time expect much smaller interface, if
visible at all, and no “floaters”. Draw supernatant to fresh tube.
10. Add 250µl butanol. Cap tightly and vortex well. Expect mix to be cloudy at first and then quickly clear. Centrifuge 12.000 RPM for 1 minute.
11. Remove top layer (butanol) to waste. Transfer aqueous layer to a new tube. Put on ice.
12. Add 200µl 7.5M ammoniumacetate. Fill to top with ice cold 100% ethanol. Cap tightly, vortex well, chill (first on ice briefly, then 30 min. in freezer), centrifuge 15.000 RPM @ 4°C and immediately draw off supernatant.
13. Add 1ml ice cold 70% EtOH, spin down @ 4°C. take off sup with blue & yellow tip. Spin down again to remove EtOH from walls. Don’t dry. Immediately resuspend in 20µl deionized water.
9. Acknowledgements
This has been a very educative year. Before starting at the Erasmus I did not know the existence of half of the things I have learned here. I have been guided with patience and understanding, been given the freedom to make mistakes and most of all I have been accepted very quickly as part of lab 663. During this internship I have learned a lot of new skills, in both lab- and social skills. The enthusiasm that is felt in lab 663 is unmatched by any other lab I have seen so far. You have all been very caring and helpful whenever I need help.
Of course special thanks to Dik and Inger for the supervision and guidance during this internship!
I want to thank the Avans University for the education that made it possible to enter this experience, with special thanks to Robert Sijbrandi as my mentor during my education and Arjen Bakker for the supervision during this internship.
