Gene-by-Parenting Intervention Interactions: The Polygenic Effect of Dopaminergic genes
Master thesis
University of Amsterdam M.E.C. de Wit
Student number: 10829741 Supervisor: J. Weeland Second assessor: R. Keizer Amsterdam, August, 2016
Index Abstract………..2 Introduction………3 Method………..11 Participants………....11 Procedure………...12 Intervention………...13 Materials………14 Analyses………15 Results………...16 Discussion……….18 References……….24
Abstract
Differences in susceptibility due to children’s genes could be an explanation for the low mean effect of parenting interventions, but there is a lack of experimental studies which focus on this Gene-by-Parent Intervention interaction. The current study focuses on the polygenic effect (the effect of multiple genes) of three dopamine alleles in this interaction. The main question was whether parenting interventions have differential effects on child externalizing problem behavior based on children’s dopaminergic make-up. This question was answered using data of 387 parent-child dyads of a three-wave randomized controlled study in which the effectiveness of The Incredible Years program (IY) was investigated. The results of this study indicated that IY was effective in decreasing externalizing problem behavior and there was no difference in this effectiveness for children carrying more or less of the DRD2 A1, DAT1 10-repeat or DRD4 7-repeat alleles, which was not in line with the hypothesis of this study. This study found no support for Gene-by-Parent Intervention interaction, so the effectiveness of parenting interventions seems not to depend on the amount of these dopaminergic alleles.
Keywords: dopamine alleles, externalizing problem behavior, Gene-by-Intervention interaction, Incredible Years, parenting interventions
Gene-by-Parenting Intervention Interactions: The Polygenic Effect of Dopaminergic genes
Externalizing problem behavior in childhood, such as aggressive behavior, antisocial behavior and delinquency, is associated with several problems later in life (Fergusson,
Hoorwood, & Ridder, 2005; Crick, Ostrov, & Werner, 2006; Knoester, 2013). For example, it has been found that externalizing problem behavior at a younger age is related to future social-psychological adjustment problems, crime, substance dependence and even a greater risk for mental health problems (Fergusson et al, 2005; Crick et al., 2006; Knoester, 2013). Thus, since an extensive body of research indicates that behavior problems early in life seem to result in several problems later in life, it is pivotal to prevent the development of
externalizing problem behavior at an early age.
In order to prevent the development of externalizing problem behavior, it is important to identify factors that contribute to the development of this behavior. One important factor that seems to be related to the development of externalizing problem behavior is parenting (Eisenberg et al., 2005; Mrug & Windle, 2009). Research has revealed that positive parenting behavior (like showing more warmth and sensitivity) seems to be related to optimal child functioning and promotes effortful control which in turn predicts les externalizing problem behavior, while negative parenting behavior (like showing more punitive discipline and less warmth) seems to be associated with developing more aggressive, oppositional, hyperactive and other problem behavior (Burke, Loeber, & Birmhamer, 2002; Aunola & Nurmi, 2005; Olson, Sameroff, Kerr, Lopez, & Wellman, 2005; Eisenberg et al., 2005).
The identification of parenting as an important contributor to child problem behavior, has led to the development of interventions for preventing or decreasing child externalizing problem behavior which focus especially on parents of children with problem behavior (Belsky, 1984; Charles, Bywater, & Edwards, 2010). In fact, these parenting interventions in
which parents learn to improve their parenting behavior in order to reduce the negative behavior and promote the positive behavior of their children, have shown to be one of the most widely used ways to decrease or prevent children’s problem behavior (Charles et al., 2010; Maughan, Christiansen, Jenson, Olympa, & Clark, 2005). Parenting interventions are already accepted as an effective treatment for reducing externalizing behavior that is common in Attention-Deficit Hyperactivity Disorder, Oppositional Defiant Disorder and Conduct Disorder (Tarver, Daley, Lockwood, & Sayal, 2014).
However, the effect sizes of parenting interventions for reducing externalizing problem behavior are only moderate at best (Menting, Castro, & Matthys, 2013). For example, in a research of Leijten, Raaijmakers, Orobio de Castro, Ban, and Matthys (2015), which studied if the effects of the parenting intervention The Incredible Years program (IY) were influenced by a families’ background, there was a medium effect size (ranging from d = .37 to d = .70) of IY on the score on the Eyberg Child Behavior Inventory (ECBI) Intensity Scale of children. In addition, a meta-analysis of Menting, Castro, and Matthys (2013) examining the effectiveness of the same parenting intervention found a medium effect (d = .50) of IY as intervention in decreasing externalizing problem behavior, but even a lower effect (d = .20) for IY as prevention.
A possible explanation for these modest effect sizes is that there might be
heterogeneity in program efficacy for different children, in the way that some children might benefit more from improved parental functioning as a result of these interventions than others. Recent research indicated that genes might play an important role in these differences in susceptibility to changes in parenting (Belsky, 1984; Belsky, Bakermans-Kranenburg, & Van IJzendoorn, 2007). According to Van IJzendoorn and Bakermans-Kranenburg (2015) some children, due to their genetic make-up, are more susceptible to environmental influences like parenting than children with less susceptible genotypes. Although, according to some
researchers the influence of the genetic make-up of children on the susceptibility to
environmental factors is questionable and the studies of this effect are difficult to replicate (Dick et al., 2015), those differences in susceptibility to environment influences could be an explanation for the fact that some children benefit more from interventions than other children. According to a meta-analysis of Van IJzendoorn and Bakermans-Kranenburg (2015), the effect sizes of some interventions were larger for participants with susceptible genotypes than for participants with less susceptible genotypes. For example, a
Video-feedback Intervention to promote Positive Parenting and Sensitive Discipline (VIPP-SD), was more effective in decreasing externalizing behavior in children with the DRD4 7-repeat allele, but was less effective for children without this allele (Bakermans-Kranenburg, Van
IJzendoorn, Pijlman, Mesman, & Juffer, 2008). The genetic make-up of individuals seemed to be a determinant of variation (or moderator) in intervention efficacy (Van IJzendoorn & Bakermans-Kranenburg, 2015). This phenomenon is what Belsky and Van IJzendoorn (2015) called Gene-by-Intervention interaction. Research on Gene-by-Intervention interaction could provide a better insight into individual differences in reactivity to parenting interventions and could give more insight in how to improve the effects of parenting interventions.
Many studies have identified several genes that could possibly influence differences in susceptibility to the environment, but especially the dopamine receptor D4 (DRD4) 7-repeat allele, the dopamine transporter (DAT1) 10-repeat allele and the dopamine receptor D2 (DRD2) A1 allele seem to be important contributors to susceptibility to changes in parenting (Kranenburg & Van IJzendoorn, 2011; Van IJzendoorn &
Bakermans-Kranenburg, 2015). Dopamine is a neurotransmitter which is engaged in attentional,
motivational, and reward mechanisms (for an overview see Schultz, 1997). A reason for the importance of dopamine in the susceptibility to parenting is that low dopaminergic efficiency (less signalling and release of dopamine) might be associated with suppressed attentional and
reward mechanisms, which might influence how children react to punishment and rules (for an overview see Matthys, Vanderschuren, Schutter, & Lochman, 2012). Children with low dopaminergic efficiency seem to be less aware of the link between their actions and their parents’ response to these actions and feel less responsible for changes in the environment. These children seem to be less sensitive to rewards and seem to be slower in reward learning. Especially these children might benefit more from parenting interventions which focus on sensitivity of the parent and the reaction of the parent on children’s actions, because in this way these children become more aware of the consequences of their behavior (Bakermans-Kranenburg et al., 2008; Weeland, Overbeek, de Castro, & Matthys, 2015). The DRD4 7-repeat allele, the DAT1 10-7-repeat allele and the DRD2 A1 allele are three important alleles that are known to control the levels of dopamine in the brain. By affecting the levels of dopamine, these alleles might affect the reward mechanisms of children which might cause differences in susceptibility to changes in parenting.
DRD4 7-repeat allele
The DRD4 gene codes for the D4 subtype of dopamine receptor which participates in the mediation of dopaminergic transmission (Forbes et al., 2009). In particular the 7-repeat allele of this dopamine-receptor, which is associated with less dopamine receptors and lower dopamine reception efficiency, might be related to increased susceptibility to changes in parenting (Forbes et al., 2009; Schoots & Van Tol, 2003; Bakermans-Kranenburg & Van IJzendoorn, 2011). Children with this allele seem to have lower levels of dopamine
availability in the brain and therefore are slower in reward learning. The children with this allele might change their behavior more quickly than children without this allele if the direct consequences of their behavior will become more salient (Bakermans-Kranenburg et al., 2008; Weeland et al., 2015). An example of the increased susceptibility to parenting due to the DRD4 7-repeat allele was shown in a study of Bakermans-Kranenburg & Van IJzendoorn
(2011), in which it was found that children who carried the dopamine receptor DRD4 7-repeat allele and who were securely attached to their parents donated more money to charity than children without this allele. Another study found that temperamental sensation seeking of children was only influenced by the quality of parenting if children carried the 7-repeat allele (Sheese, Voelker, Rothbart, & Posner, 2007). Both studies showed a possible influence of the DRD4 7-repeat allele on susceptibility to parenting.
DAT1 10-repeat allele
The DAT1 gene is responsible for transporting dopamine from the synapse into a neuron and cancelling the dopamine signal (Giros & Caron, 1993). Especially the DAT1 10-repeat allele could have influence on differences in susceptibility, because it is related to lower levels of dopamine in the synapse (VanNess, Owens, & Kits, 2005). Children with this allele, seem to have lower levels of dopamine in the brain and are for that reason slower in reward learning. These children might change their behavior more quickly if the
consequences of their behavior will become more salient (Bakermans-Kranenburg et al., 2008; Weeland et al., 2015). A prospective cohort study with 305 adolescents demonstrated that adolescents with the DAT1 10-repeat allele who grew up in an environment with more risk factors, exhibited more attention problems and hyperactivity than children with other genotypes (Laucht et al., 2007). In addition, children with the 10-repeat allele were more susceptible for the negative effects of their mothers’ smoking during pregnancy, than children without this allele (Kahn, Khoury, Nichols, & Lanphear, 2003). Both studies show a possible effect of the DAT1 10-repeat allele on the susceptibility to environments and in this way to parenting.
DRD2 A1 allele
The DRD2 gene codes for the D2 subtype of dopamine receptor which is responsible for the signalling and release of dopamine in the synapse (Noble, Gottschalk, Fallon, Ritchie,
& Wu, 1997). Specially the A1 allele could have influence of differences in susceptibility, which is associated with reduced density of D2 receptors (Ritchie & Noble, 2003). Children who carry this allele, seem to have lower dopamine availability in the brain, which causes a reduced working of the reward mechanism. In particular these children might have a need for direct rewards, because this will make the consequences of their behavior more salient (Bakermans-Kranenburg et al., 2008; Weeland et al., 2015). The increased susceptibility due to the DRD2 A1 allele was shown in a study concerning the influence of a dopamine allele in the child on the association between maternal parenting and depressive symptoms later in life (Zhang, Cao, Wang, Ji, Chen, & Deater-Deckard, 2015). Results of this study indicated that the DRD2 A1 allele influenced the susceptibility to the environment in the way that children who carried the A1 allele reported more depressive symptoms as a result of negative
parenting earlier in life than children without these allele (Zhang et al., 2015). Polygenic effect of dopamine alleles
The previous mentioned studies indicate that the DRD4 7-repeat allele, the DAT1 10-repeat allele and the DRD2 A1 allele could possibly have influence on how children differ in their susceptibility to parenting. However, research indicates that the effect of individual genes on phenotypic outcomes is small (Beaver & Belsky, 2012). For this reason, more recent studies also investigated the polygenic effect of these alleles, which is in the current study defined as the combined effect of multiple alleles at the same time, in predicting the
susceptibility to parenting. The meta-analysis of Bakermans-Kranenburg and Van IJzendoorn (2011) demonstrated that carriers of a combination of previous named dopamine alleles were more vulnerable to environmental adversity and benefited more from parental support than children who did not carry these alleles. A study of Beaver and Belsky (2012) in which the influence of the DRD4 7-repeat allele, the DAT1 10-repeat allele and the DRD2 A1 allele in the child on the association between experienced parenting and future parenting were studied,
also demonstrated a possible polygenic effect of alleles. The results of this study indicated that parenting experiences were more important in predicting how children would experience their own parenting during adulthood for children with more of these susceptibility alleles, than for children with less of these alleles (Beaver & Belsky, 2012). Results of these studies suggest that the susceptibility of the child to parenting increases if the amount of
susceptibility alleles within the child increases.
In sum, previous studies indicate that different dopamine alleles seem to have effects on how parenting influences child behavior. Children with the DRD4 7-repeat allele, the DAT1 10-repeat allele and the DRD2 A1 allele seem to be more susceptible for changes in the environment and seem to benefit more from positive environment factors like positive
parenting than children with less of these alleles. Because many interventions for preventing or decreasing behavior problems do focus on parenting, it makes sense to assume that interventions like the IY might have differential effects on children based on their genetic make-up and that there might be Gene-by-Intervention interaction for these interventions (Tarver et al., 2014).
Studies about Gene-by-Intervention interaction are very important because these studies could give more insight into individual differences in reactivity to interventions (Chhangur, Weeland, Matthys, & Overbeek, 2015). The existence of Gene-by-Intervention interaction in parenting interventions could be a reason for professionals to alter their interventions to the genetic make-up of children. These personalized interventions could probably be more effective in reducing externalizing problem behavior than the existing interventions which are not adapted to the needs of the children based on their genetic make-up (Belsky & Van IJzendoorn, 2015). The improvement of the effectiveness of interventions for reducing externalizing problem behavior is essential for reducing or even preventing several problems later in life.
Although more insight in individual differences in reactivity to interventions could help to improve the now modest effectiveness of parenting interventions in order to prevent several problems later in life, there is still a lack of and a need for experimental studies which focus on the Gene-by-Intervention interaction in parenting interventions like IY (Bakermans-Kranenburg & Van IJzendoorn, 2011). Studies which did focus on Gene-by-Intervention interaction have three important limitations. First of all, most of these studies are correlational studies, which have been criticized for their risk of spurious findings and lack of statistical power and where it is not possible to make causal inferences from (Duncan & Keller, 2011). There is a need for experimental designs with randomized controlled trials because in these studies the environment is manipulated by the researches, which reduces measurement error in the environment and eliminates alternative interpretations (Bakermans-Kranenburg & Van IJzendoorn, 2011; Belsky & Van IJzendoorn, 2015). Second, most of the existing intervention studies have small sample sizes, which undermines de power of these studies. For example, the mean sample size of the studies which were incorporated in the meta-analysis on IY intervention effectiveness of Menting et al. (2013) was 95 families. A final limitation of existing intervention studies is that most of these studies focus on individual alleles in Gene-by-Parenting Intervention interaction, while previous research suggests that there might be a polygenic effect of the dopamine alleles on susceptibility to parenting and therefore on the effects of parenting interventions. This effect of a combination of dopamine alleles could help explain why some children are more susceptible for the effects of parenting interventions than other children. A study of Chhangur et al. (in press) did focus on the polygenic effect of five alleles on the susceptibility to parenting interventions. However, the effect of some of those five alleles on the dopamine availability in the brain was and remains unclear. For example, research suggests that the monoamine oxidase A (MAOA) allele which was included as a plasticity allele in the research of Chhangur et al. (in press) might be associated with more
dopamine signalling, instead of less dopamine signalling, which may result in less
susceptibility for environmental influences instead of more (Boulton & Eisenhofer, 1997). Present study
In the present study it will be studied whether parenting interventions have differential effects on child externalizing problem behavior based on a combination of three dopaminergic genes. The results of this study will provide a better insight into individual differences in reactivity to parenting interventions and could be used to give more insight in how to improve the effects of parenting interventions in order to reduce child externalizing problem behavior and in this way reduce or even prevent several problems later in life. The Gene-by-Parenting Intervention interaction will be studied using a large randomized controlled trial including the Incredible Years program (IY). The main question of this research will be: Do parenting interventions have differential effects on child externalizing problem behavior based on children’s dopaminergic make-up? The hypothesis of this study states that children who carry more of three dopaminergic alleles DRD4 7-repeat, DRD2 A1 and DAT1 10-repeat show a higher decrease in reported externalizing problem behavior after IY compared to children with less of these alleles and children in the control group.
Method
Participants
The participants for this study were 387 parents including 356 mothers (92%), and 387 children including 173 girls (45%).The participants were derived through community records from two Dutch healthcare organizations. Families with children from 4 to 8 years old of targeted municipalities received an information letter, including the Eyberg Child Behavior Inventory (ECBI) to screen them for child externalizing problem behavior (Eyberg &
the ECBI, were excluded from this study. The parents of the children with scores above the 75th percentile were invited to participate (N = 1,524). Researchers were able to reach 850 of these parent-child dyads. The 387 parents of this group which agreed to participate in this study were between 23.47 and 51.04 years of age (M = 38.09, SD = 4.84). The 387 children in this study had a mean age of 6.31 years (SD = 1.32). The parents in this study had between 1 and 6 children.
Drop out. During the study 34 parent-child dyads dropped out at posttest or at follow-up. Reasons for dropping out were inability to reach parents, divorces and migration of the parents. There was no significant difference in amount of parent-child dyads who dropped out between the control and intervention condition (χ2 (1, N = 387) = 1.76, p = .19). There was also no difference in mean ECBI score at pre-test between the children of the dyads who dropped out and the children of the dyads who did not drop out (t (384) = -.66, p = .51, two-tailed).
Procedure
For this study data from the Observational Randomized Controlled Trial on Childhood Differential Susceptibility (ORCHIDS) study was used (Chhangur & Weeland et al., 2015; Chhangur, Weeland, Overbeek, Matthys, & Castro, 2012). The ORCHIDS study is a three-wave randomized controlled trial in which families were randomly assigned to the
intervention or the control condition: Participants in the intervention condition followed The Incredible Years program (IY) and participants in the control condition did not follow IY (i.e., received care as usual). Before the randomization a pretest took place in which researchers visited the participants at home. During pretest researchers gave more information about the study and parents signed the informed consent. Further, the pretest consisted of
questionnaires, a buccal swab and the parents and children were videotaped during a
Coding System-Revised (Robinson & Eyberg, 1981). After the pretest, the randomization took place. Six months after this pretest and directly after the parents in the intervention condition received IY the posttest was conducted. The posttest consisted of these same questionnaires, an interview about the children’s genetic ancestry and family mental health care, and the parents and children were again videotaped during play situations. Ten months after the pretest and four months after IY, a follow-up test took place in which the same questionnaires, observations and interview about the genetic ancestry and family mental health care were repeated.
Intervention
The intervention which was used for this study was IY. This program is aimed at improving parenting skills in order to reduce child behavioral problems (Webster-Stratton, 2001). IY consists of 15 weekly group sessions in which the focus is on increasing positive parenting behavior and decreasing negative parenting behavior. In total fourteen groups consisting of 8 to 15 parents participated in IY. The 197 participants in the intervention group attended on average 11.01 (SD = 3.69) of the 15 sessions. During these 2-hour sessions parents watched video-vignettes of parent and children interacting and are stimulated to discuss the effectiveness of the parenting skills they see in these videos. Each session was led by two certified leaders who facilitated the group discussions and encouraged the parents to practice the new learned parenting skills through role-playing during the session and
encouraged the parents to practice these skills at home.
Randomization check. The children in the intervention and control condition did not significantly differ in age and gender. They also did not significantly differ in ECBI score at pretest, nor in amounts of DRD2 A1, DAT1 10-repeat, DRD4 7-repeat alleles (ps > .05) (see Table 1 for descriptives).
Materials
Externalizing problem behavior. Externalizing problem behavior of the child was measured with the Dutch version of the ECBI (Eyberg & Robinson, 1983). The ECBI consists of a list of 36 conduct problem behaviors of children. Parents needed to report the frequency of these problems (1 = never to 7 = always) in order to get the Intensity score of the problem behavior. Besides this, the parents needed to report whether the behavior of the child was a problem for them (yes or no). However, for this study only the Intensity Scale was used. A high score on this scale indicated that the child frequently showed externalizing problem behavior. An example of an item from this scale was: ‘Verbally fights with sisters and
brothers’. The scale in the current study had an internal consistency (Cronbach’s alpha) of .85, .86 and .88 for the pretest, posttest and follow-up respectively, which shows the reliability of this scale in this study was sufficient.
Genotyping. Genotyping was conducted at BaseClear laboratories, Leiden, The Netherlands, using well-established methods. Buccal swabs collected from children were incubated in lysis buffer (100 mM NaCl, 10 mM EDTA, 10 mM Tris pH 8, 0.1 mg/ml proteinase K, and 0.5% w/v SDS) until further processing. Genomic DNA was isolated from the samples using the Chemagic buccal swab kit on a Chemagen Module I workstation (Chemagen Biopolymer-Technologie AG, Baesweiler, Germany). All analyses were performed automatically using specialized genotyping software. The results of the 96wells plates were checked by a lab-worker (and checked by a second worker); those showing notable deviations or failings were repeated. As a control check, each 96wells plate contained one blank and analyses were continued only if the blank showed a negative result. Overall, genotyping yielded a success rate of approximately 99% or higher for the polymorphisms central to this report.
DRD4. For all VNTR polymorphisms (i.e., DRD4 and DAT1) one microliter of PCR product was mixed with 0.3 ml LIZ-500 size standard (Applied Biosystems) and 11.7 ml formamide (Applied Biosystems) and run on a AB 3730 genetic analyser set up for fragment analyses with 50 cm capillaries. Results were analysed using GeneMarker software
(Softgenetics). The region of interest from the DRD4 gene was amplified by PCR using the a FAM-labelled primer 5’- GCGACTACGTGGTCTACTCG -3’ and a reverse primer 5’- AGGACCCTCATGGCCTTG -3’. Typical PCR reactions contained between 10 and 100 ng genomic DNA templates, 10 pmol of forward and reverse primer. PCR was carried out in the presence of 7.5% DMSO, 5x buffer supplied with the enzyme and with 1.25U of LongAmp Taq DNA Polymerase (NEB) in a total volume of 30 ml using the following cycling
conditions: initial denaturation step of 10 min at 95oC, followed by 27 cycles of 30 sec 95oC, 30 sec 60oC, 60 sec 65oC and a final extension step of 10 min 65oC. The distribution of the genotypes (n = 248: no7R/no7R, n = 119: no7R/7R, n = 8: 7R/7R) were in Hardy–Weinberg equilibrium (HWE), χ2 (1, N = 375) = 2.11, p = .15 (n = 12 no genotyping).
DAT1. The region of interest from the DAT1 gene was amplified by PCR using the a FAM-labelled primer 5’- TGTGGTGTAGGGAACGGCCTGAG -3’ and a reverse primer 5’- CTTCCTGGAGGTCACGGCTCAAGG -3’. Typical PCR reactions contained between 10 and 100 ng genomic DNA templates, 10 pmol of forward and reverse primer. PCR was carried out in the presence of 3.3% DMSO with 1.25U of LongAmp Taq DNA Polymerase (NEB) in a total volume of 30 ml using the following cycling conditions: initial denaturation step of 5 min at 95oC, followed by 29 cycles of 30 sec 95oC, 30 sec 68oC, 60 sec 65oC and a final extension step of 5 min 65oC. The distribution of the genotypes (n = 31: no10R/no10R, n = 148: no10R/10R, n = 203: 10R/10R) were in HWE, χ2 (1, N = 382) = .30, p = .58 (n = 5 no genotyping).
DRD2. To determine the SNP’s of the DRD2 rs1800497, 1ul of the isolated samples were analyzed using TaqMan® chemistry (Cat. # 4351379, Applied Biosystems). Samples were run on an ABI-7500 Real-Time PCR instrument and data was analyzed using 7500 System SDS software. The distribution of the DRD2 genotypes (n = 247: A2/A2, n = 122: A2/A1, n = 14: A1/A1) were in HWE, χ2 (1, N = 383) = .05, p = .82 (n = 4 no genotyping). Analyses
Preliminary analyses. The SPSS software program version 22.0 was used to analyse the data of this study(IBM corp., Amonk, NY). The preliminary analyses showed that there were no outliers in ECBI scores. The scores on the ECBI at pretest, posttest and follow-up were normally distributed and the assumption of homogeneity of variances was not violated (Levene’s test not significant), which indicated that the variance in scores at the pretest, posttest and follow-up was the same for the control and intervention group. The ECBI scores of 1 participant (.3%) at pretest, 21 participants (5.4%) at posttest and 18 participants at follow-up (4.7%) were missing.
Analyses. Repeated measures analysis of variance were conducted to assess the impact of the two different conditions (if the parents participated in IY or not) and the impact of carrying a combination of the three dopamine alleles on the children’s score on
externalizing problem behavior, across three time periods (pretest, posttest, follow-up).
Results
A repeated measures analysis of variance was used to test the interaction between condition and the children’s score on the ECBI, across three time periods (pretest, posttest, follow-up). There was a significant interaction between condition and time, F (2, 362) = 8.07, p < .00, partial eta squared = .04, which indicated a small effect (Table 2). The observed power was .96, which indicated that a Type I error was possible, but was not likely. The
results indicated that children of parents who participated in IY showed a higher decrease in externalizing problem behavior than children of parents who did not participate in IY (i.e., the control group), however this effect of participation in IY was small (Figure 1).
Another repeated measures analysis of variance was conducted to assess the polygenic effect of the DRD2 A1, DRD4 7-repeat and DAT1 10-repeat alleles on the children’s score on the ECBI, across three time periods (pretest, posttest, follow-up). The interaction effect for comparing children with less or more of the DRD2 A1, DRD4 7-repeat and DAT1 10-repeat alleles at different conditions was not significant, F (2, 355) = .62, p = .71, suggesting no difference in the decrease in externalizing behavior due to participation of the parents in IY between children with less of more of these alleles (Table 3). The observed power was .25, which was low and indicated that the change for Type II error was high.
Posthoc analyses were conducted to test whether contrary effects of the DRD2 A1, DRD4 7-repeat and DAT1 10-repeat allele could be an explanation for the fact that there was no combined effect of these alleles. First, repeated measures analysis of variance was
conducted to assess the individual impact of having the DRD4 7-repeat allele on the
children’s score on the ECBI, across three time periods (pretest, posttest, follow-up). There was no significant interaction between the DRD4 and condition, F (2, 359) = .12, p = .88. The observed power was .07, which was low and indicated that the change for Type II error was high. The results indicated that there was no difference in the decrease in externalizing
behavior due to participation of the parent in IY between children with and without the DRD4 7-repeat allele (Table 4).
Another repeated measures analysis of variance was conducted to assess the individual impact of having the DAT1 10-repeat allele on the children’s score on the ECBI, across three time periods (pretest, posttest, follow-up). There was no significant interaction between the DAT1 and condition, F (2, 358) = .43, p = .65, suggesting no difference in the decrease in
externalizing behavior due to participation of the parents in IY between children with and without the DAT1 10-repeat allele (Table 5). The observed power was .12, which was low and indicated a high risk for Type II error.
Next, repeated measures analysis of variance was conducted to assess the individual impact of having the DRD2 on the children’s score on the ECBI, across three time periods (pretest, posttest, follow-up). There was a no significant interaction between the DRD2 A1 allele and condition, F (2, 353) = .34, p = .71. This indicated that there was no difference in the effectiveness of IY in decreasing externalizing behavior in children with or without the DRD2 A1 allele (Table 6). The observed power was .10, which was low and indicated a high risk for Type II error.
Sensitivity Analyses
As a robustness check, final analyses were undertaken to determine whether the results reported would hold under varying sampling conditions because results of the effectiveness of IY may differ between mother-child dyads and father-child dyads (Matricardi, Agostino, Fedeli, & Montirosso, 2013). A repeated measures analysis of variance was used to test the interaction between gender of the parent and the score on the ECBI of the children from which the parents participated in IY, across three time periods (pretest, posttest, follow-up). There was no significant interaction between gender of the parent and time, F (2, 178) = .56, p = .57. The results indicated the effect of IY on the externalizing problem behavior was not different between mother-child and father-child dyads. The results underscore the robustness of results in the primary analyses.
Discussion
Existing parenting interventions only have moderate effect sizes in decreasing externalizing problem behavior. A possible explanation for this moderate effect size is that
children differ in their susceptibility to the effects of parenting interventions due to their genetic make-up. However, there is still a lack of experimental studies which focus on the Gene-by-Intervention interaction in parenting interventions. The current study investigated whether a parenting intervention (The Incredible Years program: IY) has differential effects on children’s externalizing problem behavior based on three dopaminergic genes. This Gene-by-Intervention interaction was investigated under 387 parents and children using a pretest, posttest, follow- up, experimental design. The expectation was that children with more
dopamine receptor DRD4 7-repeat alleles, dopamine receptor DRD2 A1 alleles and dopamine transporter DAT1 10-repeat alleles show a higher decrease in reported externalizing behavior after IY compared to children with less of these alleles. However, the results of this study indicated that there was no difference in susceptibility to the effects of IY between children with more or less of the DRD2 A1, DAT1 10-repeat, DRD4 7-repeat alleles, so no support for the hypothesis was found. There were also no contrary effects of the individual alleles which could explain why there was no effect of the alleles combined.
Results of this study show no support for possible Gene-by-Intervention interaction in parenting interventions like IY. Although it was expected that children with more dopamine alleles would be more susceptible for the effects of IY, IY seems to be even effective in decreasing externalizing problem behavior independent of the dopamine alleles of the child. Generally, this means that parenting interventions like IY, although the effectiveness is small, could be used to decrease externalizing problem behavior in every child and that the
effectiveness of this interventions would not improve if they will be tailored to the needs of children with a specific dopaminergic make-up.
As expected from previous research, the results of this study indicated that there is no large effect of IY for decreasing externalizing problem behavior (Menting et al., 2013; Leijten et al., 2015). However, it was predicted in this study that children with the DRD4 7-repeat
allele, DRD2 A1 allele or DAT1 10-repeat allele would be more susceptible to the effects of IY than children with less of these alleles, because these same alleles were in previous studies all found to be related to heightened susceptibility of children to their environment and to parenting (Bakermans-Kranenburg & Van IJzendoorn, 2011; Sheese et al., 2007; Laucht et al., 2007). In the current study no differences in susceptibly for the effects of IY were found. Although an extensive body of research indicates that several genes could possibly influence differences in susceptibility to the environment and susceptibility to changes in parenting, Dick et al. (2015) already suggested that the results of these studies should be considered with a degree of caution. According to Dick et al. (2015), examples of reasons to be concerned about the published literature about the influence of genes on the susceptibility to the environment are that most studies use small samples sizes, which causes low power for detecting small effect sizes and that researchers use different conceptualizations of gene-environment interaction what leads to different effect sizes. These two problems are important reasons why there might be a very high proportion of false discoveries in candidate genes that seem to have an effect on the environment (Dick et al., 2015). Another important reason to be careful when interpreting the results of previous research about this topic is the publication bias whereby findings about the effect of genes on differences in susceptibility that were statistically significant were more likely to be published than findings that were not significant (Dick et al., 2015). Especially in research on the effects of genes on the
environment, this phenomenon seems common; while a majority of previous reports about the effects of genes on the susceptibility to the environment were positive, a much lower
proportion of attempted replications found the same results (Dick et al., 2015). It seems possible that there truly are no differences in susceptibility due to different genes when it comes to parenting, but that there is a publication bias when it comes to studies who did find a significant result by chance. The results of the current study and the conclusions of Dick et al.
(2015) about previous studies on the effects of genes on differences in susceptibility to environmental factors could be a reason to question the theory about Gene-by-Intervention interaction. If there is no Gene-by-Intervention interaction, adapting the parenting
intervention to the needs of children based on their dopaminergic make-up would not help to improve the effectiveness of these interventions. This would mean that researchers should identify other factors (e.g., demographic factors) which could possibly influence the effectiveness of parenting interventions in order to improve the effectiveness of these interventions.
However, there are also different methodological reasons which could explain why the predicted Gene-by-Intervention interaction was not found in the current study. One
explanation why differences in susceptibility to parenting were found in previous studies while no differences in susceptibility to parenting interventions were found in the current study, might be that most of the previous studies were correlational studies (Bakermans-Kranenburg & Van IJzendoorn, 2011). Correlational studies have, in contrast to experimental studies like the current study, been criticized for risk of spurious findings (Duncan & Keller, 2011). Because the environment in these studies is not experimentally manipulated, there could be measurement error which could have led to misinterpretation of the findings regarding to differences in susceptibility to changes in parenting in previous studies.
However, it is also possible that no Gene-by-Intervention interaction was found in this study because there are possibly more alleles which play a role in this interaction, which are not included in this study. For example, previous research suggests that the
catechol-O-methyltransferase gene, or COMT, which metabolizes neurotransmitters like dopamine, might also play a role in differences in susceptibility to parenting (Belsky & Pluess, 2009). Future research might consider to add more alleles in their analyses which might play a role in Gene-by-Intervention interaction.
Another recommendation for future researchers is to use more observers in different settings in order to increase the reliability of the measuring of externalizing problem behavior. In the current study, only one observer rated the externalizing problem behavior of the child, while problem behavior could differ over different settings like at home and at school (Lang, SigaFoos, Lancioni, Didden, & Rispoli, 2010). Another limitation of the current study was that the power was low due to the low overall effect of IY, which makes it difficult to detect differences in decrease in externalizing problem behavior between the children with more or less dopamine alleles. Future researchers might consider to increase the sample size in order to increase the power of studies to Gene-by-Intervention interaction. However, using even larger sample sizes and gather more genetic data for intervention studies like this raises
ethical questions. For example, the question is whether it is ethical to burden so many children for research with collection of genetic data. When children participate in studies using genetic information, researchers of these studies get inside in important personal information
concerning possible genetic diseases and information about the genetic heritage of the
individuals, while the scientific yield of research on DNA in settings like this and the yield for the children themselves might be minimal (Chhangur, Weeland, Matthys, & Overbeek, 2015). Future researchers should always carefully consider these ethical questions.
Despite of some limitations, the present results are an important step for investigating differences in susceptibility of children to parenting interventions to decrease externalizing problem behavior. This study is one of the first randomized controlled trials with a large sample size (387 parent-child dyads) to investigate Gene-by-Intervention interactions. Previous studies on Gene-by-Intervention interaction are mostly correlational studies, which have been criticized for their lack of power and risk for spurious finding (Duncan & Keller, 2011). The current study fulfils the need for experimental designs with randomized controlled trials through which causal inferences could be made and alternative interpretations could be
eliminated (Bakermans-Kranenburg & Van IJzendoorn, 2011). Finally, this study is one of the first experimental studies which studies the polygenic effect of genes in Gene-by-Intervention interaction instead of effects of individual genes only.
The main question of this study was whether parenting interventions have differential effects on child externalizing behavior based on children’s dopaminergic make-up. The results of this study provide a better insight into individual differences in reactivity to
parenting interventions. Despite some limitations of this study and the need for future studies, the results of this study indicate that parenting interventions seem to have no different effects on children based on their dopamine alleles. Using personalized interventions based on the dopaminergic make-up of children would possibly not help to improve the effectiveness of parenting interventions and future researchers might consider to look at other factors that could improve the effectiveness of these interventions. In sum, parenting interventions like IY, seem to be effective independent of the genes of children and could be used for decreasing externalizing problem behavior in every child.
References
Aunola, K., & Nurmi, J. E. (2005). The role of parenting styles in children's problem behavior. Child Development, 76, 1144-1159.
doi:10.1111/j.14678624.2005.00840.xi1
Bakermans-Kranenburg, M. J., & Van IJzendoorn, M. H. (2011). Differential susceptibility to rearing environment depending on dopamine-related genes: New evidence and a met analysis. Development and Psychopathology, 23, 39-52.
doi:10.1017/S0954579410000635
Bakermans-Kranenburg, M. J., Van IJzendoorn, M. H. , Pijlman, F. T., Mesman J., & Juffer, F. (2008). Experimental evidence for differential susceptibility: Dopamine D4 receptor polymorphism (DRD4 VNTR) moderates intervention effects on toddlers’
externalizing behavior in a randomized controlled trial. Developmental Psychology, 44, 293–300. doi:10.1037/0012-1649.44.1.293
Beaver, K. M., & Belsky, J. (2012). Gene-environment interaction and the intergenerational transmission of parenting: testing the differential-susceptibility hypothesis. Psychiatric Quarterly, 83, 29-40. doi:10.1007/s11126-011-9180-4
Belsky, J. (1984). The determinants of parenting: A process model. Child Development, 55, 83-96. doi:10.2307/1129836
Belsky, J., Bakermans-Kranenburg, M. J., & Van IJzendoorn, M. H. (2007). For better and for worse differential susceptibility to environmental influences. Current Directions in Psychological Science, 16, 300-304. doi:10.1111/j.1467-8721.2007.00525.x Belsky, J., & Pluess, M. (2009). Beyond diathesis stress: differential susceptibility to
environmental influences. Psychological Bulletin, 135, 885-908. doi:10.1037/a0017376
Belsky, J., & van Ijzendoorn, M. H. (2015). What works for whom? Genetic moderation of intervention efficacy. Development and Psychopathology, 27, 1-6.
doi:10.1017/S0954579414001254
Boulton, A. A., & Eisenhofer, G. (1997). Catecholamine metabolism. In D. S. Goldstein, G. Eisenhofe, & R. McCarty (Eds.), Advances in Pharmacology (pp. 273–292).
Academic Press.
Burke, J. D., Loeber, R., & Birmaher, B. (2002). Oppositional defiant disorder and conduct disorder: a review of the past 10 years, part II. Journal of the American Academy of Child & Adolescent Psychiatry, 41, 1275-1293.
doi:10.1097/0000458320021100000009
Charles, J. M., Bywater, T., & Edwards, R. T. (2011). Parenting interventions: a systematic review of the economic evidence. Child: Care, Health and Development, 37, 462-474. doi:10.1111/j.1365-2214.2011.01217.x
Chhangur, R. R., Weeland, J., Matthys, W., & Overbeek, G. (2015). Gene by environment research to prevent externalizing problem behavior: ethical questions raised from a public healthcare perspective. Public Health Ethics, 8, 1-10. doi:10.1093/phe/phv024 Chhangur, R. R., Weeland, J., Overbeek, G., Matthys, W., & de Castro, B. O. (2012).
ORCHIDS: an Observational Randomized Controlled Trial on Childhood Differential Susceptibility. BMC Public Health, 12, 917. doi:10.1186/1471-2458-12-917
Chhangur, R. R., Weeland, J., Overbeek, G., Matthys, W., Orobio de Castro, B., Van der Giessen, D., & Belsky, J. (n.d.). Genetic moderation of Intervention efficacy: Dopaminergic genes, The Incredible Years, and externalizing behavior in children. Child Development.
Crick, N. R., Ostrov, J. M., & Werner, N. E. (2006). A longitudinal study of relational aggression, physical aggression, and children's social–psychological
adjustment. Journal of Abnormal Child Psychology, 34, 127-138. doi:10.1007/s10802-005-9009-4
Dick, D. M., Agrawal, A., Keller, M. C., Adkins, A., Aliev, F., Monroe, S., ... & Sher, K. J. (2015). Candidate gene–environment interaction research reflections and
recommendations. Perspectives on Psychological Science, 10, 37-59. doi:10.1177/1745691614556682
Duncan, L. E., & Keller, M. C. (2011). A critical review of the first 10 years of candidate gene-by-environment interaction research in psychiatry. American Journal of Psychiatry, 168, 1041-1049. doi:10.1176/appi.ajp.2011.11020191
Eisenberg, N., Zhou, Q., Spinrad, T. L., Valiente, C., Fabes, R. A., & Liew, J. (2005). Relations among positive parenting, children's effortful control, and externalizing problems: A three‐wave longitudinal study. Child Development, 76, 1055-1071. doi:10.1111/j.1467-8624.2005.00897.x
Eyberg, S.M. & Robinson, E. A. (1983). Conduct problem behavior: standardization of a behavioral rating scale. Journal of Clinical Child Psychology, 12, 347–354. doi:10.1080/15374418309533155
Fergusson, D. M., Horwood, L. J., & Ridder, E. M. (2005). Show me the child at seven: the consequences of conduct problems in childhood for psychosocial functioning in adulthood. Journal of Child Psychology and Psychiatry, 46, 837-849.
doi:10.1111/j.1469-7610.2004.00387.x
Forbes, E. E., Brown, S. M., Kimak, M., Ferrell, R. E., Manuck, S. B., & Hariri, R. (2009). Genetic variation in components of dopamine neurotransmission impacts ventral
striatal reactivity associated with impulsivity. Molecular Psychiatry, 14, 60–70. doi:10.1038/sj.mp.4002086
Giros, B., & Caron, M. G. (1993). Molecular characterization of the dopamine transporter. Trends in Pharmacological Sciences, 14, 43-49. doi:10.1016/0165-6147(93)90029-J Hutchings, J., Bywater, T., Daley, D., Gardner, F., Whitaker, C., Jones, K., ... & Edwards, R.
T. (2007). Parenting intervention in Sure Start services for children at risk of
developing conduct disorder: pragmatic randomised controlled trial. Britisch Medical Journal, 334, 678-682. doi:10.1136/bmj.39126.620799.55
van IJzendoorn, M. H., & Bakermans-Kranenburg, M. J. (2015). Genetic differential susceptibility on trial: Meta-analytic support from randomized controlled experiments. Development and Psychopathology, 27, 151-162.
doi:10.1017/S0954579414001369
Kahn, R. S., Khoury, J., Nichols, W. C., & Lanphear, B. P. (2003). Role of dopamine transporter genotype and maternal prenatal smoking in childhood hyperactive impulsive, inattentive, and oppositional behaviors. Journal of Pediatrics, 143, 104 -110. doi:10.1016/S0022-3476(03)00208-7
Knoester, C. (2003). Implications of childhood externalizing problems for young adults. Journal of Marriage and Family, 65, 1073-1080.
doi: 10.1111/j.17413737.2003.01073.x
Lang, R., Sigafoos, J., Lancioni, G., Didden, R., & Rispoli, M. (2010). Influence of
assessment setting on the results of functional analyses of problem behavior. Journal of Applied Behavior Analysis, 43, 565-567. doi:10.1901/jaba.2010.43-565
Laucht, M., Skowronek, M. H., Becker, K., Schmidt, M. H., Esser, G., Schulze, T. G., & Rietschel, M. (2007). Interacting effects of the dopamine transporter gene and psychosocial adversity on attention-deficit/hyperactivity disorder symptoms among
15-year-olds from a high-risk community sample. Archives of General Psychiatry, 64, 585-590. doi:10.1001/archpsyc.64.5.585
Leijten, P., Raaijmakers, M. A., Orobio de Castro, B., van den Ban, E., & Matthys, W. (2015). Effectiveness of the incredible years parenting program for families with socioeconomically disadvantaged and ethnic minority backgrounds. Journal of
Clinical Child & Adolescent Psychology, 1-15. doi:10.1080/15374416.2015.1038823 Matthys, W., Vanderschuren, L. J., Schutter, D. J., & Lochman, J. E. (2012). Impaired
neurocognitive functions affect social learning processes in oppositional defiant disorder and conduct disorder: Implications for interventions. Clinical Child and Family Psychology Review, 15, 234-246. doi:10.1007/s10567-012-0118-7
Matricardi, S., Agostino, R., Fedeli, C., & Montirosso, R. (2013). Mothers are not fathers: differences between parents in the reduction of stress levels after a parental
intervention in a NICU. Acta Paediatrica, 102, 8-14. doi:10.1111/apa.12058
Maughan, D. R., Christiansen, E., Jenson, W. R., Olympia, D., & Clark, E. (2005). Behavioral parent training as a treatment for externalizing behaviors and disruptive behavior disorders: A meta-analysis. School Psychology Review, 34, 267-286.
Menting, A. T., de Castro, B. O., & Matthys, W. (2013). Effectiveness of the Incredible Years parent training to modify disruptive and prosocial child behavior: A meta-analytic review. Clinical Psychology Review, 33, 901-913. doi:10.1016/j.cpr.2013.07.006 Mrug, S., & Windle, M. (2009). Mediators of neighborhood influences on externalizing
behavior in preadolescent children. Journal of Abnormal Child Psychology, 37, 265 280. doi: 10.1007/s10802-008-9274-0
Noble, E. P., Gottschalk, L. A., Fallon, J. H., Ritchie, T. L., & Wu, J. C. (1997). D2 dopamine receptor polymorphism and brain regional glucose metabolism. American Journal of
Medical Genetics, 74, 162–166.
doi:10.1002/(SICI)1096-8628(19970418)74:2<162::AID-AJMG9>3.0.CO;2-W Olson, S. L., Sameroff, A. J., Kerr, D. C., Lopez, N. L., & Wellman, H. M. (2005).
Developmental foundations of externalizing problems in young children: The role of effortful control. Development and Psychopathology, 17, 25-45.
doi:10.1017/S0954579405050029
Posthumus, J. A., Raaijmakers, M. A., Maassen, G. H., Van Engeland, H., & Matthys, W. (2012). Sustained effects of Incredible Years as a preventive intervention in preschool children with conduct problems. Journal of Abnormal Child Psychology, 40, 487-500. doi:10.1007/s10802-011-9580-9
Ritchie, T., & Noble, E. P. (2003). Association of seven polymorphisms of the D2 dopamine receptor gene with brain receptor-binding characteristics. Neurochemical Research, 28, 73-82. doi: 10.1023/A:1021648128758
Robinson, E. A., Eyberg, S. M. (1981). The dyadic parent–child interaction coding system: standardization and validation. Journal of Consulting and Clinical Psychology, 49, 245–250. doi:10.1037/0022-006X.49.2.245
Schoots, O., & Van Tol, H. (2003). The human dopamine D4 receptor repeat sequences modulate expression. The Pharmacogenomics Journal, 3, 343–348.
doi:10.1038/sj.tpj.6500208.
Schultz, W. (1997). Dopamine neurons and their role in reward mechanisms. Current Opinion in Neurobiology, 7, 191-197. doi:10.1016/S0959-4388(97)80007-4
Sheese, B. E., Voelker, P. M., Rothbart, M. K., & Posner, M. I. (2007). Parenting quality interacts with genetic variation in dopamine receptor D4 to influence temperament in early childhood. Development and Psychopathology, 19, 1039-1046.
Tarver, J., Daley, D., Lockwood, J., & Sayal, K. (2014). Are self-directed parenting interventions sufficient for externalizing behavior problems in childhood? A
systematic review and meta-analysis. European Child & Adolescent Psychiatry, 23, 1123-1137. doi:10.1007/s00787-014-0556-5
Taylor, P. J., Lamers, A., Vincent, M. P., & O'Driscoll, M. P. (1998). The validity of immediate and delayed self‐reports in training evaluation: an exploratory field study. Applied Psychology, 47, 459-479. doi:10.1111/j.1464-0597.1998.tb00038.x VanNess, S. H., Owens, M. J., & Kilts, C. D. (2005). The variable number of tandem repeats
element in DAT1 regulates in vitro dopamine transporter density. BMC Genetics, 6, 55. doi:10.1186/1471-2156-6-55.
Webster-Stratton, C. (2001). The Incredible Years: parents, teachers, and children training series. Residential Treatment For Children & Youth, 18, 31-45.
doi:10.1300/J007v18n03_04
Weeland, J., Overbeek, G., de Castro, B. O., & Matthys, W. (2015). Underlying mechanisms of gene-environment interactions in externalizing behavior: A systematic review and search for theoretical mechanisms. Clinical Child and Family Psychology Review, 18, 413-422. doi: 10.1007/s10567-015-0196-4
Zhang, W., Cao, Y., Wang, M., Ji, L., Chen, L., & Deater-Deckard, K. (2015). The dopamine D2 receptor Polymorphism (DRD2 TaqIA) interacts with maternal parenting in predicting early adolescent depressive symptoms: evidence of differential susceptibility and age differences. Journal of Youth and Adolescence, 44, 1428 -1440. doi:10.1007/s10964-015-0297-x
Table 1
Baseline Profile of the Children
Control Condition Intervention Condition
N % N % Gender Men 100 52.6 114 57.8 Women 90 47.4 83 42.1 DRD4 At least one 58 30.9 69 35.2 none 130 69.1 127 64.8 DAT1 At least one 173 91.5 178 92.2 none 16 8.5 15 7.8 DRD2 At least one 59 31.1 77 39.9 none 131 68.9 116 60.1 M SD M SD Age 6.32 1.29 6.30 1.36 Baseline ECBI 3.65 .51 3.75 .55
Figure 1. Decrease in externalizing problem behavior for children whose parents did and did not participate in The Incredible Years Program.
Table 2
Results Repeated Measures ANOVA, Time and Condition on ECBI score
F df1 df2 p η²
Time 66.24** 2 362 .00 .27
Condition 8.07** 2 362 .00 .04
N = 365, * p < .05, ** p < .01.
Table 3
Results Repeated Measures ANOVA, Polygenic Alleles on ECBI score
F df1 df2 p η² Time 24.36** 2 355 .00 .12 Condition 1.82 2 355 .16 .01 Polygenic alleles 1.21 2 355 .30 .01 Condition×Polygenic alleles .62 2 355 .71 .01 N = 364, * p < .05, ** p < .01. Table 4
Results Repeated Measures ANOVA, DRD4 7-repeat Allele on ECBI score
F df1 df2 p η² Time 60.56** 2 359 .00 .25 Condition 7.54** 2 359 .00 .04 DRD4 .21 2 359 .81 .00 Condition×DRD4 .12 2 359 .88 .00 N = 358, * p < .05, ** p < .01.
Table 5
Results Repeated Measures ANOVA, DAT1 10-repeat Allele on ECBI score
F df1 df2 p η² Time 14.98** 2 358 .00 .08 Condition 1.48 2 358 .23 .01 DAT1 1.67 2 358 .19 .01 Condition×DAT1 .43 2 358 .65 .00 N = 363, * p < .05, ** p < .01. Table 6
Results Repeated Measures ANOVA, DRD2 A1 Allele on ECBI score
F df1 df2 p η² Time 65.26 2 353 .00 .27 Condition 5.52 2 353 .00 .03 DRD2 2.42 2 353 .09 .01 Condition×DRD2 .34 2 353 .71 .00 N = 364, * p < .05, ** p < .01.
