Cholesterol and phospholipid transporters in atherosclerotic lesion development

development

Pennings, M.

Citation

Pennings, M. (2008, September 16). Cholesterol and phospholipid transporters in

atherosclerotic lesion development. Division of Biopharmaceutics of the Leiden/Amsterdam Center for Drug Research|Leiden University Medical Center (LUMC), Leiden University.

Retrieved from https://hdl.handle.net/1887/13099 Version: Corrected Publisher’s Version

License: Licence agreement concerning inclusion of doctoral thesis in the Institutional Repository of the University of Leiden

Downloaded from: https://hdl.handle.net/1887/13099

Note: To cite this publication please use the final published version (if applicable).

Bone marrow derived multidrug restistance protein ABCB4 protects against atherosclerotic lesion development in LDL receptor knock out mice

Cardiovascular Research 2007;76:175-183

Marieke Pennings¹, Reeni B. Hildebrand¹, Dan Ye¹, Cindy Kunne², Theo J.C. Van Berkel¹, Albert K. Groen³, Miranda Van Eck¹

1division of Biopharmaceutics, Leiden/Amsterdam Center for Drug Research, Leiden University, Einsteinweg 55, 2333 CC Leiden, The Netherlands

2AMC Liver Center, Amsterdam Medical Center, Meibergdreef 69-71, 1105 BK Amsterdam, The Netherlands.

3department of Medical Biochemistry, Amsterdam Medical Center, Meibergdreef 15, 1105 AZ Amsterdam, The Netherlands.

Abstract Several members of the adenosine triphosphate (ATP)-binding cassette (ABC)- transporter super family expressed in macrophages protect against atherosclerosis by promoting macrophage cholesterol and phospholipid efflux.

Systemic disruption of ABCB4 in mice results in a virtual absence of phospholipids in bile and a strongly impaired biliary cholesterol secretion, indicating that ABCB4 plays an essential role in cellular lipid efflux. The aim of the current study was to determine the role of bone marrow derived ABCB4 in atherosclerotic lesion development. Methods: Chimeras were created that specifically lack ABCB4 in bone marrow derived cells, including macrophages, by performing a bone marrow transplantation on LDL receptor knockout (LDLr-/-) mice. Atherosclerotic lesion development was induced by feeding a high-cholesterol diet (15% fat and 0.25% cholesterol). Results: Serum cholesterol levels were significantly lower in mice reconstituted with ABCB4 knock out bone marrow, as a result of reduced VLDL and LDL cholesterol levels. Despite the lower serum cholesterol levels, ABCB4 deficiency in bone marrow derived cells resulted in a 1.8-fold (p=0.005) increase in lesion size. In vitro foam cell formation, induced with acetylated LDL (AcLDL) in peritoneal macrophages, was increased in the absence of ABCB4, possibly due to a 2-fold (p<0.05) increased association of AcLDL, while the efflux of cholesterol was unaffected.

Conclusion: Bone marrow derived ABCB4 has an important anti-atherosclerotic function probably by limiting macrophage foam cell formation.

Introduction

The adenosine triphosphate (ATP) binding cassette (ABC)-transporters belong to a super family of proteins which contain characteristic evolutionary conserved two transmembrane domains and two ATP-binding sites. All family members are involved in energy dependent transport of a wide variety of substrates (1). Mutations in these proteins are associated with multiple diseases, including cystic fibrosis, anemia, drug response phenotype, and cholesterol and bile transport defects (2).

Several ABC-transporters have been implicated in reverse cholesterol transport and thus protection against foam cell formation, the hallmark of atherosclerosis (3, 4).

Reverse cholesterol transport is the transport of cholesterol from macrophages in the arterial wall to the liver for excretion into the bile (5).

An important member of the ABC-transporter family is ABCB4, formerly known as multidrug resistance protein 2 (mdr2), which is the murine homolog of the human MDR3. ABCB4 is a full transporter, which shares 92% sequence homology with ABCB1 or mdr1 (6). Both genes are located on chromosome 5 and are transcribed convergent from each other (7). The murine expression profile of ABCB1 and ABCB4 is different. ABCB1 mRNA is ubiquitously expressed (8, 9), while ABCB4 is highly expressed in the bile canicular membrane of the liver (10). In addition, ABCB4 mRNA expression is found in heart, muscle, spleen, adrenal gland and tonsils (10).

ABCB1 plays an essential role in the development of drug resistance during cancer chemotherapy (11). ABCB4, however, does not comprise equal multidrug resistance properties (11). In 1993 Smit et al generated knock out mice that lack ABCB4 expression (12). This mouse model showed severe damage to both the hepatocytes and the bile ducts of the liver due to an impaired phospholipid and cholesterol transport from the liver into the bile (12). Cholesterol flux from the liver to the bile could be restored by intravenous infusion of hydrophobic bile salts in the ABCB4 knock out (-/-) mice (12). Under these conditions however, the phospholipid flux remained impaired, indicating that ABCB4 is essential for phospholipid transport to the bile (13). Subjects with a disruption in ABCB4 develop progressive familial intrahepatic cholestasis (14). Interestingly, ABCB4-/- mice fed normal chow diet display lower total serum HDL cholesterol levels, indicating that ABCB4 also influences cholesterol metabolism (15).

ABCB4 is expressed in macrophages, which might indicate that ABCB4 plays

a role in macrophage lipid homeostasis (8). In agreement, cholesterol loading regulates macrophage ABCB4 mRNA expression (16). It is thus conceivable that ABCB4 plays a role at either end of the reverse cholesterol transport process.

Macrophages in atherosclerotic lesions primarily depend on infiltration of bone marrow derived monocytes into the arterial wall. Therefore, in the present study, we investigated the effects of selective disruption of ABCB4 in bone marrow derived cells and thus macrophages on lipoprotein metabolism and atherosclerosis by means of bone marrow transplantation. Our results indicate that bone marrow derived ABCB4 has a significant protective role in atherosclerotic lesion development.

Methods

Mice

ABCB4 knock out (ABCB4-/-) mice on a FVB background were obtained from the Academic Medical Center, Amsterdam, The Netherlands (12). Heterozygous ABCB4+/- mice, from crossing to the C57Bl/6 background, were crossed to generate ABCB4-/- mice and non-transgenic ABCB4+/+

littermates, which were used as wild type (ABCB4+/+) controls. LDL receptor knock out (LDLr-/-) mice on a C57Bl/6 background were obtained from the Jackson Laboratory (Bar Habor, USA). All mice were housed in a light and temperature controlled environment. Food and water were supplied ad libitum. Mice were maintained on regular chow (RM3, Special Diet Services, Whitham, UK), or were fed a Western-type diet, containing 15% (w/w) total fat and 0.25% (w/w) cholesterol (Diet W, Special Diet Services, Whitham, UK). Drinking water was supplied with antibiotics (83 mg/L ciprofloxacin and 67 mg/L polymyxin B sulphate) and 6.5 g/L sucrose. The Ethics committee for Animal Experiments of the University of Leiden approved all experimental procedures and the investigation conforms with the Guide for the Care and Use of Laboratory Animal published in the US National Institutes of Health (NIM publication No. 85-23, revised 1996).

Bone Marrow Transplantation

Female LDL receptor knockout (LDLr-/-) mice (n=10, 12 weeks old) were lethally irradiated with a single dose of 9 Gy (0.19 Gy/min, 200 kV, 4 mA), 1 day before transplantation. Bone marrow was harvested by flushing the femurs and tibias from male ABCB4-/- mice or male non transgenic ABCB4+/+ littermates (12 weeks old). Irradiated recipients received 5 x 10⁶ bone marrow cells by intravenous injection into the tail vein.

Assessment of Chimerism

The reconstitution of the transplanted bone marrow was determined using PCR on genomic DNA from bone marrow. The wild type ABCB4 gene was detected using a forward primer (5'- gCTgAgATggATCTTgAg-3’) and a reverse primer (5'-gTCgAgTAgCCAgATgATgg-3') resulting in a 300 bp PCR-fragment. The mutant ABCB4 gene was detected using a forward primer (5'-

CggCgAggATCTCgTCgTgACCCA-3') and a reverse primer (5'-gCgATACCgTAAAgCACgAggAAg- 3') resulting in a 200 bp PCR-fragment. Primers were obtained from Isogen (Maarsen, The Netherlands).

Western blot analysis

Peritoneal macrophages were elicited with an injection of 1 ml 3% Brewers’ thioglycolate medium (Difco) into the peritoneum of the ABCB4-/- and wild type control mice (n=4). At five days after injection, macrophages were isolated by flushing the peritoneal cavity with 10 ml of ice cold PBS. The peritoneal macrophages were lysed in lysisbuffer containing 50 mmol/LTris-HCl, 150 mmol/L NaCl, 1% Triton X-100, 0.5% deoxycholate, 1% SDS (pH 7.5) supplementedwith inhibitors (10 µg/mL leupeptin, 10µg/mL aprotinin, 10µg/mL trypsine). Equal amounts of protein (20 µg) were separated by 10% SDS-PAGE gel electrophoresis. Subsequently, the proteins were transferred to a Protran nitrocellulose membrane (Scheicher and Schnell, Dassel, Germany) by western blotting for 2 hours.

Blots were blocked in 5% milk in PBS followed by incubation with anti-P-glycoprotein monoclonal antibody C219 (Alexis Biochemicals, Lausane, Switzerland) in a 1:100 dilution. The monoclonal antibody C219 recognizes both ABCB1 and ABCB4, which can be distinguished by their size (170 kD and 140 kD, respectively). After washing, the blots were incubated with goat anti-mouse secondary horseradishperoxidase–coupled antibody (R&D sytems, Abingdon, UK). Antigen-antibody complexes were visualised with EnhancedChemiluminescence Plus reagent and visualized with a typhoon imager (both from Amersham Bioscience, Little Chalfont, England).

Separation of splenocytes

Splenocytes were harvested from mice (n=6) by passing spleens through a cell strainer (BD Biosciences, Bedford, USA) in BD^TM IMag buffer. The cell suspensions were treated with either CD4, CD8a, CD45R/B220 or CD11b monoclonal antibodies conjugated to magnetic nanoparticles according to manufacturer’s instructions for the isolation of CD4+ T cells, CD8+ T cells, B cells and macrophages/neutrophils, respectively. Isolated cells were used for mRNA extraction according to Chomczynski et al (17). ABCB4 mRNA expression was analyzed using real-time SYBR Green technology (Eurogentec, Seraing, Belgium), as previously described (18) with the primers displayed in table 1 using real-time quantitative PCR.

Lipid Analyses

After an overnight fasting-period, 100 µl of blood was drawn from each individual mouse (n=10). The concentrations of cholesterol in serum were determined by enzymatic colorimetric assays with 0.025 U/mL cholesterol oxidase (Sigma) and 0.065 U/mL peroxidase and 15 μg/mL cholesteryl esterase (Roche Diagnostics, Mannheim, Germany) in reaction buffer (1.0 KPi buffer, pH=7.7 containing 0.01 M phenol, 1 mM 4-amino-antipyrine, 1% polyoxyethylene-9-laurylether, and 7.5% methanol).

Absorbance was read at 490 nm. The distribution of cholesterol over the different lipoproteins in serum was determined by fractionation of 30 μL serum of each mouse using a Superose 6 column (3.2 x 300

mm, Smart-system; Pharmacia, Uppsala, Sweden). Cholesterol content of the effluent was determined as indicated.

Histological Analysis of the Aortic Root

To analyze the development of atherosclerosis at the aortic root, transplanted LDLr-/- mice (n=10) were sacrificed 17 weeks after bone marrow transplantation, (age 29 weeks). All the mice were fed the Western-type diet for 9 weeks before sacrifice. The arterial tree was perfused in situ with PBS. The heart plus descending aorta were excised and stored in 3.7% neutral-buffered formalin (Formal-fixx;

Shandon Scientific Ltd., UK). Corresponding sections on separate slides were stained immunohistochemically with a macrophage specific antibody: MOMA-2 (polyclonal rat IgG2b, Research Diagnostics Inc, Flanders, USA; 1:10 dilution) to determine the macrophage content, or with Oil-Red-O to visualize the lipid content of the lesion. The atherosclerotic lesion areas in cryostat sections of the aortic root, and the relative macrophage content of the lesions were quantified using the Leica image analysis system, consisting of a Leica DMRE microscope coupled to a camera and Leica Qwin Imaging software (Leica Ltd., Cambridge, UK). Mean lesion area (in µm²) was calculated from 10 sections per mouse. The average foam cell size was calculated by dividing the foam cell area by the number of nuclei in the area. The number of nuclei in the area was determined using Masson´s Trichome stained on sections, and the foam cell area was determined in the same sections after comparison with MOMA-2 stained consecutive sections.

Table 1: Primer sequences

Gene genbank Forward primer Reverse primer

ABCB4 NM_008830 AGGCAGCGAGGAAACGGAAC TGGTTGCTGATGCTGCCT

AGT

SR-A L04274 GGTGGTAGTGGAGCCCATGA CCCGTATATCCCAGCGAT

CA

SR-BI NM_016741 GGCTGCTGTTTGCTGCG GCTGCTTGATGAGGGAGG

G

CD36 NM_007643 GTTCTTCCAGCCAATGCCTTT ATGTCTAGCACACCATAA

GATGTACAGTT ABCA1 NM_013454 GGTTTGGAGATGGTTATACAA

TAGTTGT

TTCCCGGAAACGCAAGTC

ABCG1 NM_009593 AGGTCTCAGCCTTCTAAAGT

TCCTC

TCTCTCGAAGTGAATGAA ATTTATCG

Lipid Efflux

Lipid efflux studies were performed as described earlier (19). In short thioglycolate-elicited macrophages from ABCB4-/- and wild type control mice (n=4) were cultured for 24 hours, after which they were labeled with 1 μCi/mL ¹⁴C-cholesterol for studying cholesterol efflux and with 1 μCi/mL ³H- choline for studying phospholipid efflux. Both radio active labeled lipids were from Amersham Bioscience (Little Chalfont, England). After a 24 hour incubation period the cells were washed with PBS and incubated with Dulbecco’s modified eagles medium (DMEM) containing 2 mmol L- glutamine, 100U/mL penicillin, 100 µg/mL streptomycin (all from BioWhittaker, Verviers, Belgium),

and 0.2% BSA, in the presence of 5 μg/mL apoAI (Calbiochem, La Jolla, USA) or 50 μg/mL human HDL as acceptor for 24 hours. Human HDL was isolated by ultracentrifugation according to Redgrave et al (20). Efflux was calculated as the percentage radioactivity released from the cells into the medium relative to the total radioactivity in cells plus medium and corrected for efflux in the presence of BSA alone.

Foam cell Formation Assay

Thioglycolate-elicited peritoneal macrophages from ABCB4-/- and wild type control mice (n=4) were plated at a concentration of 0.5 x 10⁶ cells per well in DMEM containing 10% FBS, 2 mmol L- glutamine 100U/mL penicillin and 100 µg/mL streptomycin (all from BioWhittaker, Verviers, Belgium). After a 4 hours incubation period the cells were washed and incubated for 24 hours with DMEM containing 80 μg/mL acetylated human LDL (AcLDL). Human LDL was isolated and acetylated as described earlier (20, 21). Cells were fixed in 3.7% paraformaldehyde and stained for lipids with Oil-Red-O. Foam cell formation was visualized using light microscopy and the percentage Oil-Red-O staining per cell surface was determined with Leica Qwin Imaging software (Leica Ltd, Cambridge, UK), a minimum of 50 cells per mouse was used for the analysis. In addition, cells were used for mRNA analysis as described above, the primers are displayed in table 1. For analysis of AcLDL cell association, the cells were incubated for 3 hours at 37°C with the indicated concentrations

3H-labeled AcLDL (4504 dpm/μg), washed, and lyzed with 1M NaOH. LDL was labeled with ³H- cholesterol oleate (22) from Amersham Bioscience (Little Chalfont, England). Protein content was determined using a BCA-protein kit according to manufacturers’ description (Pierce, Rockfort, USA).

The association of ³H-labeled AcLDL was determined and expressed as nanogram ³H-AcLDL per mg of cell protein.

Flow cytometry

Thioglycolate-elicited peritoneal macrophages from ABCB4-/- and ABCB4+/+ mice (n=4) were incubated with 5% BSA in PBS and stained for surface and intra cellular SR-A, SR-BI, CD36 and ABCA1 (Santa Cruz Biotechnology Inc, Santa Cruz, USA)(10 μg Ab/mL). A minimum of 100.000 peritoneal leucocytes were analyzed using a FACSCalibur flowcytometer (BD Biosciences, Bedford, USA), data was analyzed with CELLQuest software (BD Biosciences, Bedford, USA).

Statistical analysis

Values are expressed as mean ± SEM. A two-tailed Students t-test was used to compare means after confirming normal distribution by the method Kolmogorov and Smirnov using Graphpad Instat Software (San Diego, USA). For the comparison of means of the atherosclerotic plaque sizes, the nonparametric Mann-Whitney test was used.

Results

To study the effects of bone marrow ABCB4 deficiency on lipoprotein metabolism and atherosclerosis in vivo LDLr-/- recipient mice were transplanted with ABCB4-/- or ABCB4+/+ donor bone marrow. Seventeen weeks after bone marrow transplantation the chimerism of the bone marrow and peritoneal macrophages was determined. PCR analysis on genomic DNA from the bone marrow of the transplanted animals verified that the mice transplanted with ABCB4-/- bone marrow expressed a major band at 200 kb, indicative of the disrupted allele while the ABCB4+/+ band of 300 kb was absent (Fig. 1A). Western blot analysis was performed on peritoneal macrophages to confirm the absence of ABCB4 protein. As shown in Fig. 1B, ABCB1 was present on peritoneal macrophages in both groups. In contrast, ABCB4 was only found on the peritoneal macrophages of the mice transplanted with ABCB4+/+ bone marrow, indicating that ABCB4 protein was selectively disrupted in macrophages of mice reconstituted with ABCB4-/- bone marrow.

A

200 kb

Figuure 1: Chimerism determination in bone marrow and peritoneal macrophages of LDLr-/- recipient mice after bone marrow transplantation, and ABCB4 mRNA expression in bone marrow derived cell types in spleens of C57Bl/6 mice.

(A) PCR analysis of bone marrow of ABCB4+/+ transplanted (ABCB4+/+) and ABCB4-/- transplanted (ABCB4-/-) LDLr-/- mice. (B) Western blot analysis of peritoneal macrophages of ABCB4+/+ transplanted and ABCB4-/- transplanted LDLr -/- mice for the proteins ABCB1 and ABCB4. (C) Quantitative ABCB4 mRNA expression analysis of the bone marrow derived cell types CD+ T cells (CD4+), CD8+ T cells (CD8+), B cells (B) and macrophages/neutrophils (M) (n=6). Statistically significant difference *p<0.05.

170

140 ABCB

ABCB4- ABCB4+/

ABCB4- ABCB4+/

ABCB

ABCB4+/ ABCB4-

B

C

*

Figure 2: Lipoprotein distribution and cholesterol levels at 0, 8 and 17 weeks after bone marrow transplantation.

Serum cholesterol concentrations at weeks 0, 8 and 17 after transplantation of ABCB4+/+ (open bars) and ABCB4-/- (closed bars) reconstituted mice (A). Lipoprotein distribution of total cholesterol of ABCB4+/+ (open symbols) and ABCB4-/- (closed symbols) reconstituted mice, 8 weeks after transplantation on a normal chow diet (B) and 17 weeks after transplantation with 9 weeks Western- type diet (WTD) feeding (C). Values are means ± SEM of n=10. Statistically significant difference

*p<0.05, **p<0.005.

Bone marrow transplantation replaces all bone marrow derived cells. To confirm that the presented data are mainly the result of ABCB4 deficiency on macrophages, and not due to disruption of ABCB4 in other bone marrow derived cells the mRNA expression of ABCB4 was determined on splenocytes, from wildtype C57Bl/6 mice expressing ABCB4 in all tissues. The spleen gives a good representation of bone marrow derived cells. The CD4+ T cell, the CD8+ T cell and the B cell population showed a significantly lower ABCB4 mRNA expression compared to the macrophage/neutrophil population, as depicted in Fig. 1C (p<0.05).

Before bone marrow transplantation there were no differences in the serum concentrations of cholesterol. The bone marrow transplantation did not lead to differences in serum cholesterol concentrations when fed a normal chow diet, as is shown in Fig. 2A. Also the lipoprotein distribution was not different between the two recipient groups on chow diet (Fig. 2B). At eight weeks after bone marrow transplantation the diet was switched to a Western-type diet. The diet switch induced a large increase in serum cholesterol concentrations in both acceptor groups. This increase was higher in the ABCB4+/+ transplanted recipients (2112±24 mg/dL versus 1642±9, p<0.005) (Fig. 2A). In both recipient groups the increase in serum cholesterol levels was mainly due to increased VLDL and LDL levels, as is shown in Fig. 2C.

Atherosclerotic lesion development in the aortic root was analyzed in Oil-Red- O stained sections at 17 weeks post-transplant and after 9 weeks Western-type diet feeding in ABCB4+/+ and ABCB4-/- bone marrow reconstituted mice. Lesion size was 1.8-fold increased (5.8±0.7*10⁵ µm² versus 3.2±0.3*10⁵ µm² p=0.005) as the result of the selective disruption of bone marrow derived ABCB4 (Fig. 3A). Figure 3B shows representative photomicrographs of aortic roots of ABCB4+/+ and ABCB4- /- reconstituted animals. The absolute macrophage area present in the atherosclerotic lesions of the recipients transplanted with ABCB4-/- bone marrow was larger, however the relative amount of macrophages in the lesion did not differ significantly between the ABCB4+/+ and ABCB4-/- reconstituted animals (Fig. 3C and 3D). The size of the lesion macrophages, however, was increased in the ABCB4-/- transplanted animals (808±221 µm² versus 462±43 µm², p<0.005) (Fig. 3E and F), indicating more extensive lipid accumulation in these macrophages.

Selective disruption of bone marrow ABCB4 increased atherosclerotic lesion development despite reduced serum cholesterol levels, suggesting local effects of ABCB4 on lesion development. The mRNA expression of lipid efflux proteins as ABCA1 and ABCG1 was not significantly different between the ABCB4-/- and ABCB4+/+ macrophages after AcLDL loading (data not shown).

In order to unravel the mechanism by which macrophage ABCB4 influences atherosclerotic lesion development, an in vitro foam cell assay was performed. Fig. 4 shows the quantification of the Oil-Red-O staining per cell surface as well as representative photomicrographs of the Oil-Red-O stained macrophages. Both the ABCB4+/+ and the ABCB4-/- macrophages showed lipid staining as a result of AcLDL loading. However, the lipid staining in ABCB4 deficient macrophages was more extensive (69±3% versus 13±1%, p<0.005), which indicates that these macrophages are more prone to foam cell formation.

A

F D B

E C

ABCB4+/+

ABCB4+/+

ABCB4+/+

ABCB4-/-

ABCB4-/- ABCB4-/-

A

F D B

E C

ABCB4+/+

ABCB4+/+

ABCB4+/+

ABCB4-/-

ABCB4-/- ABCB4-/-

Figure 3: Atherosclerotic lesion development in LDLr-/- mice reconstituted with ABCB4-/- or ABCB4+/+ bone marrow.

Lesion size in the aortic root of ABCB4+/+ and ABCB4-/- transplanted mice was analyzed at 17 weeks after the bone marrow transplantation and after a 9-week Western-type diet-feeding period (A).

Macrophage positive area as a percentage of the lesion size in the aortic root of ABCB4+/+ and ABCB4-/- transplanted mice (C). Size of atherosclerotic lesion macrophages of ABCB4+/+ and ABCB4-/- transplanted mice (E). The photomicrographs show representative pictures from sections of the aortic root of ABCB4+/+ and ABCB4-/- reconstituted mice, after an Oil-Red-O lipid staining (B), macrophage immunohistochemical staining (D), and Masson´s Trichrome histochemical staining (F).

ABCB4-/- ABCB4+/+

ABCB4-/- ABCB4+/+

Figure 4: Foam cell formation in ABCB4+/+ and ABCB4-/- peritoneal macrophages.

Thioglycolate-elicited peritoneal macrophages were isolated from ABCB4+/+ and ABCB4-/- mice and cultured for 4 hours. The foam cell formation was assessed by incubation of the peritoneal macrophages with 80 µg/mL of acetylated LDL for 24 hours at 37°C. Oil-Red-O positive area as a percentage of total cell area. Photomicrographs show representative pictures of the formed foam cells.

Values are means ± SEM of n=4. Statistically significant difference **p<0.005.

Foam cell formation is a consequence of the dysregulation of the balance between cholesterol influx and cholesterol efflux. In total-body ABCB4-/- mice phospholipid secretion from the liver into the bile is reduced to almost zero (12). To determine if the increased lesion size in the ABCB4-/- reconstituted mice was due to an impaired phospholipid efflux capacity of macrophages, an in vitro phospholipid efflux study using peritoneal macrophages was performed. Considering that the cholesterol output to the bile is also affected in the ABCB4-/- mice, we also examined the effect of ABCB4 deficiency on cholesterol efflux from peritoneal macrophages. In macrophages from ABCB4+/+ and ABCB4-/- mice no differences in cholesterol or phospholipid efflux to HDL or apoAI were observed (Fig. 5A and 5B). Thus ABCB4 does not, under the applied conditions, play a role in the efflux of cholesterol and phospholipid from macrophages to HDL or apoAI.

Since the cholesterol efflux was not impaired in peritoneal macrophages lacking ABCB4 it might be possible that ABCB4 deficiency induces macrophage foam cell formation by increasing the uptake of cholesterol from AcLDL. To quantify the cholesterol accumulation from AcLDL in the ABCB4+/+ and ABCB4-/- macrophages an association assay was performed. The ³H-AcLDL association to ABCB4-/- peritoneal macrophages, as shown in Fig. 6A, was two-fold higher compared to the ³H-AcLDL association to ABCB4+/+ peritoneal macrophages (p<0.05). The mRNA expression of the scavenging receptors SR-A, SR-BI and CD36

was not altered after AcLDL loading (data not shown). However, flowcytometric analysis shows that ABCB4-/- macrophages express more SR-A, SR-BI, and CD36 protein on their membrane compared to ABCB4+/+ macrophages (Fig. 6B). For SR-A and SR-BI also increased intracellular protein expression was found, while intracellular CD36 was unaltered by the absence of ABCB4 (Fig. 6C).

Thus, the observed increased foam cell formation in ABCB4 deficient macrophages in vivo and in vitro is unlikely to be the consequence of an impaired cholesterol efflux, but rather an effect of enhanced cholesterol association and uptake, probably as a result of increased uptake via scavenger receptors.

A

B A

B

Figure 5: Cholesterol and Phospholipid efflux studies in ABCB4+/+ and ABCB4-/- peritoneal macrophages.

Capacity of ABCB4+/+ and ABCB4-/- peritoneal macrophages to efflux cholesterol (A) or phospholipids (B) to apoAI and HDL was determined and expressed as the percentage secreted radioactivity normalized to total radioactivity and corrected for efflux to BSA containing medium.

Values are means ± SEM of n=4.

* *

*

*

*

*

A B

* *

*

** **

**

*

*

*

*

*

*

A B

*

*

C

*

*

**

**

C

receptor expression in ABCB4+/+ and ABCB4-/- peritoneal macrophages.

The association of ³H-labeled acetylated LDL to ABCB4+/+ and ABCB4-/- macrophages was determined and expressed as nanogram ³H-AcLDL per mg of cell protein (A). ABCB4+/+ and ABCB4-/- macrophages stained for cell surface (B) and intra cellular SR-A, SR-BI and CD36 by flowcytometric analysis (C). Values are means ± SEM of four individual mice. Statistically significant difference

*p<0.05.

Discussion

In the current study we demonstrate an important new role for the multidrug resistance protein ABCB4 in macrophage foam cell formation and atherosclerotic lesion development. The importance of ABC-transporters in lipid homeostasis was first suggested in 1993 with the discovery that ABCB4 transports phosphatidyl choline and is essential for bile formation by the liver (12). In addition to the liver, where ABCB4 plays an essential role in the phosphatidyl choline transport into the bile, ABCB4 mRNA is also expressed in monocytes and macrophages (16). In the current study we show, for the first time that macrophages do not only express ABCB4 mRNA, but also substantial amounts of ABCB4 protein. To specifically study the role of bone marrow derived ABCB4 in atherosclerosis we specifically deleted ABCB4 in bone marrow derived cells by transplantation of bone marrow from ABCB4-/- mice into LDLr-/- mice. Our study shows that specific disruption of ABCB4 in bone marrow derived cells decreased serum cholesterol levels on Western- type diet. Despite the observed decrease in serum cholesterol levels, the development of atherosclerotic lesions in ABCB4-/- reconstituted mice was increased, indicating an

important anti-atherogenic function for bone marrow derived ABCB4. The expression of ABCB4 is very low in T and B cells as compared to macrophages/neutrophils, suggesting that the effect of disruption of ABCB4 in bone marrow derived cells is probably the result of the absence on macrophages and neutrophils.

ABCB4 is essential for the transport of phospholipid from the liver into the bile, and consequently ABCB4 also influences cholesterol transport into the bile (12).

In a recent report by Langheim et al. the hypothesis is put forward that ABCB4 is required for ABCG5/G8 mediated cholesterol secretion from the hepatocyte into the bile, indicating an indirect role for ABCB4 in cholesterol secretion (23). In the current study, we found that ABCB4 deficiency on peritoneal macrophages, does not lead to impaired cholesterol or phospholipid to efflux apoAI and HDL. AcLDL-induced macrophage foam cell formation was increased, which suggests that ABCB4 has a role in lipid accumulation. Indeed, macrophage AcLDL association was increased in absence of ABCB4. In contrast, Le Goff et al recently showed that altered expression of human ABCB1, which is highly homologous to ABCB4, does not lead to differences in cholesterol uptake from native LDL in human HeLa and mouse embryo fibroblasts (24).A well-known receptor for acetylated and oxidized LDL is the class A scavenger receptor (SR-A) (25). The mRNA expression of SR-A, however, was not affected by macrophage ABCB4 deficiency.

The intracellular processing of SR-A or other internalizing receptors could, however, be changed due to altered phospholipid membrane asymmetry. In biological membranes lipids are asymmetrically distributed across the bilayer (26).

Phosphatidylcholine and other choline containing phospholipids are mainly situated on the outer leaflet of the membrane. On the cytoplasmic site the amine-containing glycerophospholipids are predominantly located (26). Phospholipid asymmetry has significant physiological consequences in processes such as membrane budding and membrane protein function, especially in the endoplasmatic reticulum (ER) and the Golgi apparatus (27). Because ABCB4 is a floppase, an energy dependent translocator of phosphatidylcholine from the inner to the outer leaflet of the membrane, it is conceivable that the deletion of ABCB4 has important consequences for the macrophage phospholipid membrane asymmetry (26). Little is known about the actual mechanism by which phospholipids are extracted from the membrane after ABCB4 translocation (28). It appears to involve vesiculation from the outer leaflet of the

ABCA1, translocates phosphatidylserine to the outer leaflet of the membrane (30).

Interestingly, ABCA1 deficient fibroblasts show increased receptor-mediated endocytosis (31). This increased endocytosis can be normalized through the addition of synthetic phosphatidylserine to the outer leaflet (31). Zha et al showed that loss of functional ABCA1 results not only in enhanced receptor mediated endocytosis, but also in increased fluid phase uptake (31). Fluid phase uptake by macropinocytosis had previously been demonstrated to be an important process in LDL-induced foam cell formation of stimulated macrophages (32). Interestingly, ABCA1 up regulation by LXR activating treatment, which enhances macrophage cholesterol efflux and protects against atherosclerotic lesion development also inhibited fluid phase macropinocytosis of LDL (33).

Although the mRNA expression of the SR-A was not affected by macrophage ABCB4 deficiency, ABCB4-/- macrophages express more SR-A, SR-BI, CD36 protein on their membrane, and have more intracellular SR-A and SR-BI compared to ABCB4+/+ macrophages. This increase in scavenger receptor expression could be a consequence of altered membrane fluidity, or a result of differences in intracellular signaling (34). Altered scavenger receptor expression, both on the membrane and intracellular, form the most likely explanation for the increased foam cell formation as observed in vitro upon incubation of macrophages with AcLDL, and the increased atherosclerotic lesion development in vivo. After bone marrow transplantation not only arterial wall macrophages but also liver sinusoidal Kupffer cells are replaced by cells of donor origin. Expression of SR-A in the liver is thought to form a major protection system of the body by scavenging atherogenic particles from the blood compartment. It is thus possible that increased SR-A expression in Kupffer cells of the liver as a result of ABCB4-deficiency is responsible for the observed decrease in VLDL cholesterol levels. In agreement, we have previously shown that overexpression of human SR-A in bone marrow derived cells also results in a significant reduction in VLDL cholesterol levels, probably due to increased clearance of oxidized lipoproteins as a result of increased expression of SR-A by Kupffer cells in the liver (35). ABC-transporters, including ABCB4, can thus influence atherosclerotic lesion development indirectly by affecting the lipid accumulation in macrophages as a result of modulation of membrane asymmetry. Furthermore it is conceivable that other cholesterol-responsive members of the ABC-transporter super

family have a critical role in maintaining the membrane integrity and thereby in cellular lipid homeostasis.

In conclusion, macrophage ABCB4 protects against foam cell formation by reducing the accumulation of lipid in macrophages and thus protects against atherosclerotic lesion development. The protection against atherosclerotic lesion development indicates an important anti-atherosclerotic function for bone marrow derived ABCB4.

References

1 Dean M, Rzhetsky A, Allikmets R. The human ATP-binding cassette (ABC) transporter superfamily.

Genome Res 2001;11:1156-66.

2 Klein I, Sarkadi B, Varadi A. An inventory of the human ABC proteins. Biochim Biophys Acta 1999;6:237-62.

3 Groen AK, Oude Elferink RP, Verkade HJ, Kuipers F. The ins and outs of reverse cholesterol transport. Ann Med 2004;36:135-45.

4 Lewis GF, Rader DJ. Circ Res 2005;96:221-32.

5 Van Eck M, Pennings M, Hoekstra M, Out R, Van Berkel TJ Scavenger receptor BI and ATP- binding cassette transporter A1 in reverse cholesterol transport and atherosclerosis. Curr Opin Lipidol 2005; 6:307-15.

6 Dhir R, Buschman E, Gros P. Structural and functional characterization of the mouse multidrug resistance gene family. Bull Cancer 1990;77:1125-29.

7 Lincke CR, Smit JJM, Van der Velde-Koerst T, Borst P. Structure of the human MDR3 gene and physical mapping of the human MDR locus. J Biol Chem 1991;266:5303-10.

8 Croop JM, Raymond M, Haber D, Devault A, Arceci RJ, Gros P et al. The three mouse multidrug resistance (mdr) genes are expressed in a tissue-specific manner in normal mouse tissues. Mol Cel Biol 1989;9:1346-50.

9 Langmann T, Mauerer R, Zahn A, Moehle C, Probst M, Stremmel W et al. Real-time reverse transcription-PCR expression profiling of the complete human ATP-binding cassette transporter superfamily in various tissues. Clin Chem 2003;49:230-38.

10 Smit JJ, Schinkel AH, Mol CA, Majoor D, Mooi WJ, Jongsma AP et al. Tissue distribution of the human MDR3 P-glycoprotein. Lab Invest 1994;71:38-49.

11 Buschman E, Gros P. Functional analysis of chimeric genes obtained by exchanging homologous domains of the mouse mdr1 and mdr2 genes. Mol Cell Biol 1991;11:595-603.

12 Smit JJM, Schinkel AH, Oude Elferink RPJ, Groen AK, Wagenaar E. et al Homozygous disruption of the murine mdr2 P-glycoprotein gene leads to a complete absence of phospholipid from bile and to liver disease. Cell 1993;75:451-62.

13 Oude Elferink RPJ, Groen AK The role of mdr2 P-glycoprotein in biliary lipid secretion. Cross-talk between cancer research and biliary physiology. J Hepat 1995;23:617-25.

14 De Vree JML, Jacquemin E, Sturm E, Cresteil D, Bosma PJ, Aten J et al. Mutations in the MDR3 gene cause progressive familial intrahepatic cholestasis. Proc Natl Acad Sci USA 1998;95: 82-87.

15 Voshol PJ, Havinga R, Wolters H, Ottenhoff R, Princen HMG, Oude Elferink RPJ, et al. Reduced plasma cholesterol and increased fecal sterol loss in multidrug resistance gene 2 P-glycoprotein- deficient mice. Gastroenterology 1998;114:1024-34.

16 Klucken J, Buchler C, Orso E, Kaminski WE, Porsch-Ozcurumez M, Liebisch G et al. Proc Natl Acad Sci USA. ABCG1 (ABC8), the human homolog of the Drosophila white gene, is a regulator of macrophage cholesterol and phospholipid transport. 2000;2:817-22.

17 Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate- phenol-chloroform extraction. Anal Biochem. 1987;162:156-59.

18 Van Eck M, Twisk J, Hoekstra M, Van Rij BT, Van der Lans CA, Bos IS et al. Differential effects of scavenger receptor BI deficiency on lipid metabolism in cells of the arterial wall and in the liver. J Biol Chem 2003;278:23699-705.

19 Van Wijland MJA, De Waart DR Groen AK Biliary anionic peptide fraction/calcium binding protein inhibits apolipoprotein A-I-mediated cholesterol efflux from cultured cells. Biochem Biophys Res Com 2001;287:1-4.

20 Redgrave TG, Roberts DC, West CE. Separation of plasma lipoproteins by density-gradient ultracentrifugation. Anal Biochem 1975;12:42-49.

21 Basu SK, Goldstein JL, Anderson RGW, Brown MS. Degradation of cationized low density lipoprotein and regulation of cholesterol metabolism in homozygous familial hypercholesterolemia fibroblasts. Proc Natl Acad Sci USA 1976;73:3178-82.

22 Blomhoff R, Drevon CA, Eskild W, Helgerud P, Norum KR et al. Clearance of acetyl low density lipoprotein by rat liver endothelial cells. Implications for hepatic cholesterol metabolism. J Biol Chem 1984;259:8898-903.

23 Langheim S, Yu L, von Bergmann K, Lutjohann D, Xu F, Hobbs HH, et al. ABCG5 and ABCG8 require MDR2 for secretion of cholesterol into bile. J Lipid Res 2005;46:1732-38.

H

24 Le Goff W, Settle M, Greene DJ, Morton RE, Smith JD. Reevaluation of the role of the multidrug- resistant P-glycoprotein in cellular cholesterol homeostasis. J Lipid Res 2006;47:51-58.

25 Platt N, Gordon S. Is the class A macrophage scavenger receptor (SR-A) multifunctional? - The mouse's tale. J Clin Invest 2001;108:649-54.

26 Daleke DL. Regulation of transbilayer plasma membrane phospholipid asymmetry. J Lipid Res 2003;44:233-42.

27 Gummadi SN, Kumar KS. The mystery of phospholipid flip-flop in biogenic membranes. Cell Mol Biol Lett 2005;10:101-21.

28 Borst P, Oude Elferink R. Mammalian ABC transporters in health and disease. Annu Rev Biochem 2002;71:537-92.

29 Crawford AR, Smith AJ, Hatch VC, Oude Elferink RPJ, Borst P, Crawford JM Hepatic secretion of phospholipid vesicles in the mouse critically depends on mdr2 or MDR3 P-glycoprotein expression.

Visualization by electron microscopy. J Clin Invest 1997;100:2562-67.

30 Alder-Baerens N, Muller P, Pohl A, Korte T, Hamon Y, Chimini G. et al. Headgroup-specific exposure of phospholipids in ABCA1-expressing cells. J Biol Chem 2005;280:26321-26329.

31 Zha X. Genest J Jr, McPherson R. Endocytosis is enhanced in Tangier fibroblasts: possible role of ATP-binding cassette protein A1 in endosomal vesicular transport. J Biol Chem 2001;276:39476-83.

32 Kruth HS, Jones NL, Huang W, Zhao B, Ishii I, Chang J et al. Macropinocytosis is the endocytic pathway that mediates macrophage foam cell formation with native low density lipoprotein. J Biol Chem 2005;280:2352-60.

33 Buono C, Waldo SW, Kruth. LXRs inhibit cholesterol accumulation and LDL uptake by micropinocytosis in macrophages differentiated form human monocytes with M-CSF in vitro. HS Arterioscler Thromb Vasc Biol 2006;26:e-48.

34 Downes CP, Gray A. Lucocq JM. Probing phosphoinositide functions in signaling and membrane trafficking. Trends Cell Biol 2005;15:259-68.

35 Van Eck M, De Winther MP, Herijgers N, Havekes LM, Hofker MH, ^H Groot PH, et al. Effect of human scavenger receptor class A overexpression in bone marrow-derived cells on cholesterol levels and atherosclerosis in ApoE-deficient mice. Arterioscler Thromb Vasc Biol 2000;20:2600-6.