Decoding therapeutic roles of adipose tissue-derived stromal cells and their extracellular
vesicles in liver disease
Afsharzadeh, Danial
DOI:10.33612/diss.121499227
IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below.
Document Version
Publisher's PDF, also known as Version of record
Publication date: 2020
Link to publication in University of Groningen/UMCG research database
Citation for published version (APA):
Afsharzadeh, D. (2020). Decoding therapeutic roles of adipose tissue-derived stromal cells and their extracellular vesicles in liver disease. University of Groningen. https://doi.org/10.33612/diss.121499227
Copyright
Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).
Take-down policy
If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.
Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum.
CHAPTER
2
Adipose tissue-derived
stromal cells are
attracted to activated
hepatic stellate cells
through CXCR2- and
CXCR3-mediated
signaling
Danial Afsharzadeh1 Svenja Sydor2 Ali Saeed1 Ali Canbay2 Peter Olinga3 Lars P. Bechmann2 Martin C. Harmsen4 Klaas Nico Faber1,5Departments of 1Hepatology and Gastroenterology, 4Pathology and Medical Biology, 3Pharmaceutical Technology and Biopharmacy and 5Laboratory Medicine, Center for Liver, Digestive and Metabolic Disease, University of Groningen, University Medical Center Groningen, Groningen, The Netherlands. 2Department of Gastroenterology, Hepatology and Infectious Diseases, Otto von Guericke University Magdeburg, Magdeburg, Germany.
ABSTRACT
Background & Aim: Hepatic stellate cells (HSC) are the major driver of hepatic
fibrogenesis. Under physiological conditions, HSC are quiescent but these are activated by chronic injury. Activated HSC (aHSC) express higher levels of fibrogenic factors including chemoattractants. Experimental liver fibrosis in rodents is alleviated after systemic administration of mesenchymal stromal cells (MSC) yet the type and cellular origin of these hepatic chemoattractants are largely unknown. Here, we investigated hypothesized that activated HSC attract human adipose tissue-derived stromal cells (hASC) by secretion of chemokines.
Methods: hASC migration was monitored using the xCELLigence system and
precision-cut human and rat liver slices (PCLS). hASC were analyzed for the expression of CXCR2, CXCR3 and CXCR4, and the expression of respective ligands was compared between quiescent rat HSC (qrHSC) and activated rat HSC (arHSC). Potent and selective antagonists were used to block hASC-derived CXCR2, CXCR3 and CXCR4 and identify their role in migration.
Results: Human and rat PCLS strongly enhanced hASC migration. Rat
hepatocytes and qrHSC did not stimulate hASC migration while arHSC did. qrHSC highly expressed Cxcl12, while expression of Cxcl1 and Cxcl2 was low. In contrast, arHSC had upregulated expression of Cxcl1 and Cxcl2, while expression of Cxcl12 was low. In arHSC, expression of Cxcl9, Cxcl10 and Cxcl11 was low too. hASC expressed all three assessed chemokine receptors. Antagonists specific for CXCR2 and CXCR3, suppressed hASC migration towards arHSC while antagonizing CXCR4 did not influence hASC migration. Conditioned medium of arHSC promoted hASC migration to similar levels as co-culturing with arHSC. Blocking CXCR2 suppressed this migration while no effect was observed with the CXCR3 and CXCR4 antagonists.
Conclusion: Activation of HSC promotes hASC attraction to liver via CXCR2,
2
2.1. INTRODUCTION
Chronic liver disease is commonly accompanied by the development of liver fibrosis, e.g. the formation of scar tissue that disturbs the liver architecture and may ultimately lead to cirrhosis and liver failure. Hepatic stellate cells (HSC) are considered to be the main drivers of liver fibrogenesis1. HSC are located in the space of Disse and are referred to as quiescent HSC (qHSC) in the healthy liver where they play a key role in regulating vitamin A homeostasis. As a result of chronic injury, HSC are activated, start to proliferate and secrete excessive amounts of extracellular matrix (ECM) proteins, in particular collagens and fibronectins2, as well as growth factors, cytokines and chemokines with mitogenic activity1. At this moment, the only curative and life-saving treatment for end‐stage liver cirrhosis is liver transplantation. However, this is a complex and costly procedure, with limited availability of donor organs and risk for immunologic rejection of the graft3. Fortunately, increasing evidence indicates that liver fibrosis is largely reversible prior to the phase of cirrhosis. Scar tissue in liver can be resolved when the hepatotoxic insult is neutralized, as observed after treatment of hepatitis C patients with antiviral agents4-6. This holds promise for the development of anti-fibrotic therapies for liver diseases where the hepatotoxic factor is not easily neutralized, such as in auto-immune, cholestatic and metabolic liver diseases.
In recent years, administration of mesenchymal stromal cells (MSC) has been shown to ameliorate chronic liver injury and reverse liver fibrosis, and their mode of action was attributed to multiple mechanisms7,8. Also adipose tissue-derived stromal cells (ASC, fat-derived MSC) showed this therapeutic potential, as their administration improved liver function and prevented liver fibrosis in a mouse model of steatohepatitis-induced cirrhosis9. In fact, several clinical trials reported that administration of bone marrow- and umbilical cord-derived MSC improved liver function and regressed liver fibrosis in patients with viral hepatitis, primary biliary cirrhosis and/or decompensated cirrhosis10-14. MSC are typically applied intravenously, but data concerning the biodistribution and hepatic homing of MSC is limited. Several studies reported that the fibrotic liver releases factors that (chemo)attract MSC3,15,16, but the identity and cellular origin of these factors remain to be characterized. By making use of precision cut liver slices (hPCLS), as well as primary hepatocytes and hepatic stellate cells, we aimed to gain mechanistic insight in the migration of human adipose tissue-derived stromal cells (hASC) to the diseased liver.
2.2. MATERIAL AND METHODS
2.2.1. Human liver tissue
This study was approved by the Medical Ethical Committee of University Medical Centre Groningen, according to the Dutch legislation and the Code of Conduct for dealing responsibly with human material in the context of health research (https://www.federa.org/codes-conduct), refraining the need of written consent for the ‘further use’ of coded-anonymous human tissue. Clinically healthy liver tissue was obtained from surgical excess material acquired from donated livers that were unsuitable to transplant or from donors undergoing partial hepatectomy. Liver tissue was stored in ice-cold tissue preservation solution (University of Wisconsin) for 3 to 5 h before PCLS processing.
2.2.2.
Rat liver tissue
Pathogen-free male Wistar rats (Harlan PBC, Zeist, The Netherlands) were kept under standard laboratory conditions with free access to standard laboratory chow and water. All experiments were performed according to Dutch law on welfare of laboratory animals and guidelines of the ethics committee of University of Groningen for the care and use of laboratory animals.
2.2.3. Preparation of precision-cut liver slices (PCLS)
Human/rat precision-cut liver slices (hPCLS/rPCLS) (5 mm in diameter, 250-300 μm thick and 4-5 mg wet weight) were prepared as described previously 17. Slices were obtained with a Krumdieck slicer (Alabama Research and Development, Munford, AL, USA) in 4°C Krebs-Henseleit buffer supplemented with 25 mmol/L D-glucose (Merck, Darmstadt, Germany), 25 mmol/L NaHCO3 (Merck), 10 mmol/L HEPES (MP Biomedicals, Aurora, OH, USA) saturated with carbogen (95% O2/5% CO2) at pH 7.42. PCLS were incubated in Williams’ medium E (with L-glutamine, Fisher Scientific, Landsmeer, The Netherlands) supplemented with 25 mmol/L D-glucose and 50 μg/ml gentamycin (Invitrogen).
2.2.4.
Human Adipose tissue–derived Stromal Cell (hASC) isolation
and culture
Human subcutaneous adipose tissue was obtained under informed consent from healthy donors with BMI below 30 undergoing liposuction surgery (Bergman Clinics, The Netherlands). Adipose tissue was stored at 4°C and processed within 24 h post-surgery. hASC were isolated as described18 and seeded in culture flasks at 4x104 /cm2, expanded by passing three times and used for experiments. All experiments were performed using a pooled hASC from three donors. The use of
2
adipose tissue as the source of hASC was approved by the local Ethics Committee of University Medical Center Groningen, given the fact that it was considered the use of anonymized waste material.
2.2.5. Isolation, culture and treatment of rat hepatic stellate cells (rHSC)
Specified pathogen-free male Wistar rats (350 – 400 g; Charles River Laboratories Inc., Wilmington, MA, USA) were kept under standard laboratory conditions with free access to standard laboratory chow and water. All experiments were performed according to Dutch law on welfare of laboratory animals and guidelines of the ethics committee of University of Groningen for the care and use of laboratory animals. Primary hepatocytes19 and rHSC20 were obtained as described before, the latter by perfusion of the liver with pronase (Merck, Amsterdam, the Netherlands) and collagenase-P (Roche, Almere, the Netherlands) and further purified by Nycodenz (Axis-ShieldPOC, Oslo, Norway) gradient centrifugation. rHSC were cultured in Iscove’s Modified Dulbecco’s Medium (IMDM) with Glutamax (Invitrogen, Brenda, the Netherlands) supplemented with 20% heat-inactivated fetal calf serum (Invitrogen), 1 mmol/L sodium pyruvate (Invitrogen), 1x nonessential amino acids (Invitrogen), 50 µg/ml gentamicin (Invitrogen), 100 U/ml penicillin (Lonza, Vervier, Belgium), 10 µg/ml streptomycin (Lonza) and 250 ng/ml fungizone (Lonza) in a humidified incubator at 37°C with 5% CO2.
2.2.6.
Preparation of rHSC-CM
Activated rHSC (arHSC) in passage 1-2 were cultured for 24 h and the conditioned medium (rHSC-CM) was collected and centrifuged at 500 xg for 10 min to remove cell debris and used for the further assays.
2.2.7. RNA isolation and qPCR
RNA was isolated using TRI reagent (Sigma-Aldrich) according to the manufacturer’s instructions. Reverse transcription was performed on 2.5 µg total RNA using random nanomers (Sigma-Aldrich) in a final volume of 50 µl. time semi-quantitative PCR (qPCR) was performed on the 7900HT Fast Real-TimePCR system (Applied Biosystems Europe, The Netherlands)21. mRNA levels were normalized to 18S and further normalized to the mean expression level of the control group (∆∆CT method). qPCR primers and probes are shown in Supplementary Table S1.
2.2.8. Real-time monitoring of cell migration
hASC migration to PCLS, primary rat HSC or hepatocytes and arHSC-CM was monitored using the xCELLigence system (RTCA DP; ACEA Biosciences,
Inc., San Diego, CA, USA). PCLS were placed in the lower compartment of CIM plates® and either hepatocytes19 or HSC20 were cultured overnight as it was described. Likewise, rHSC-CM was placed in the lower compartment of CIM plates®, and the culture media in the lower compartment considered as the control condition. 3x104 hASC were seeded in the upper compartment of CIM-plates® with interdigitated gold microelectrodes to constantly record the cell migration, according to manufacturer’s instructions22. hASC migration was monitored for 10 h and results were analyzed by the xCELLigence software.
2.2.9. Blocking CXCR2, CXCR3A and CXCR4
SB 22500223, NBI 7433024 and AMD 3465 hexahydrobromide25 (all at 500 µmol/L, all from Tocris Bioscience, Germany) were applied to antagonize CXCR2, CXCR3 and CXCR4, respectively.
2.2.10. Cell viability assay
MTT assay26 was performed on hASC and arHSC, which were pre-exposed to either SB 225002, NBI 74330 or AMD 3465 hexahydrobromide at a concentration of 500 µmol/L for the duration of 12 h.
2.2.11. Statistical analysis
Data are expressed as average with standard deviation. Statistical significance was determined using Mann-Whitney U test. All tests were performed with GraphPad Prism (v. 5.0; GraphPad Software, La Jolla, CA, USA). Differences were considered significant at P < 0.05.
2.3. RESULTS
2.3.1. Human ASC migrate to human and rat precision-cut liver slices (PCLS)
Human adipose tissue-derived stromal cells (hASC) were co-cultured with freshly cut human or rat PCLS in xCELLigence CIM-plates to analyze hASC migration (Figure 1). The hPCLS enhanced hASC migration compared to spontaneous migration in the absence of hPCLS (Figure 1A). hASC migration reached a plateau after approximately 5 h, both in the absence and presence of hPCLS, but the cell index (as proxy for hASC migration) had more than doubled in the presence of hPCLS (Figure 1A, bar graph). Essentially similar results were obtained when hASC were co-cultured with rPCLS, where the level of hASC migration was enhanced fourfold compared to spontaneous migration (Figure 1B).
2
Figure 1. Human hASC migrate to human and rat precision-cut liver slices (PCLS).
Migration of human ASC to (A) human precision cut liver slices (hPCLS) and (B) rat precision cut liver slices (rPCLS). Data shows mean value ± SD of 3 experiments. *p ≤0.05, **p ≤0.01, ***p ≤0.001, Mann-Whitney U test.
Figure 2. hASC migrate to activated hepatic stellate cells, but not to hepatocytes.
Migration of human hASC to rat hepatocytes, quiescent rat HSC (qrHSC), and activated rat HSC (arHSC). Data shows mean value ± SD of 3 experiments. *p ≤0.05, **p ≤0.01, ***p ≤0.001, Mann-Whitney U test.
2.3.2. hASC migrate to activated hepatic stellate cells, but not to hepatocytes
Next, we analyzed which liver cell types promote hASC migration, using primary liver cells from rat. hASC were co-cultured with equal numbers of primary rat hepatocytes, quiescent HSC (1-day cultured; qrHSC) or activated HSC (7-day cultured; arHSC). No significant stimulation of hASC migration was observed if co-cultured with primary hepatocytes or qrHSC compared to medium controls (Figure 2). In contrast, arHSC promoted hASC migration and caused a fourfold increase in the cell index after 5 h of incubation compared to controls (Figure 2, bar graph).
2.3.3. Activated HSC express CXCR2 ligands
Based on earlier reports27,28, we analyzed the gene expression profile of candidate chemokines in arHSC and qrHSC (Figure 3). qrHSC most dominantly expressed
Cxcl12 (SDF-1, ligand for CXCR4 and CXCR7). In addition, expression of Cxcl1
and Cxcl2 was detected (Figure 3A). In contrast, activation strongly upregulated
Figure 3: Activated HSC express CXCR-2 ligands. Gene expression profile of (A)
quiescent rat HSC and (B) activated rat HSC for selected chemokines. (C) characterization of activated versus quiescent HSC. (D) Gene expression of hASC-derived chemokine receptors. Data shows mean value ± SD of 3 experiments. *p ≤0.05, **p ≤0.01, ***p ≤0.001, Mann-Whitney U test.
2
expression of Cxcl1 and Cxcl2, these are the rat orthologs of human chemokines Gro-α and Gro-β and IL-8 which are ligands of CXCR2. Activation of HSC reduced expression of Cxcl12, but upregulated expression of Cxcl9, Cxcl10 and Cxcl11 (ligands for CXCR3) (Figure 3B). As expected, activation strongly downregulated expression of Lrat which encodes lecithin retinol acyltransferase a key enzyme in vitamin A synthesis while fibrotic genes such as Acta2 and Col1A1 were upregulated in activated HSC (Figure 3C). hASC expressed receptors relevant for the chemokines expressed by rHSC (Figure 3D).
2.3.4. hASC migration to arHSC depends on CXCR2 and CXCR3
The CXCR2-specific antagonist SB 225002 effectively suppressed hASC migration towards arHSC by ~80% (Figure 4). A lower (~20%), but still significant reduction in hASC-to-arHSC migration was detected with CXCR3 antagonist (NBI 74330). Antagonizing CXCR4 (by AMD 3465 hexahydrobromide) did not affect hASC migration towards arHSC. Importantly, none of the antagonists reduced the cell viability of hASC, nor of the arHSC (Supplementary Figure S1).
2.3.5. CXCR2 promotes hASC migration to arHSC-CM
To eliminate any potential effect of the CXCR antagonists on arHSC, we also analyzed hASC migration towards conditioned medium of arHSC (arHSC-CM). arHSC-CM promoted hASC migration to similar levels as live arHSC (Figure
5A). Like in the hASC-HSC coculture experiments, blocking CXCR2 strongly
Figure 4. hASC migration to arHSC depends on CXCR2 and CXCR3. Blocking hASC
migration to arHSC using specific antagonists for CXCR2, CXCR3 and CXCR4. Data shows mean value ± SD of 3 experiments. *p ≤0.05, **p ≤0.01, ***p ≤0.001, Mann-Whitney U test.
suppressed hASC migration, while hASC migration was not affected by CXCR3 and CXCR4 antagonists (Figure 5B).
In summary, our data show that activated HSC may secrete CXCR2 agonistic chemokines that attract hASC.
2.4. DISCUSSION
In this study, we show that hASC migrate to human and rat precision-cut liver slices (PCLS) that undergo early induction of fibrosis ex vivo. Moreover, culture-induced activation of primary hepatic stellate cells (HSC) strongly enhanced the attraction of hASC compared to quiescent HSC or to primary hepatocytes. The hASC-chemoattractant properties were contained in the secretome of activated HSC and were predominantly mediated through CXCR2 and to a lesser extent via CXCR3 signaling.
MSC29,30, including ASC31, harbor therapeutic properties against chronic liver disease. Upon systemic infusion, MSC home and migrate to the injured liver 32-34, however, the main drivers of this migration remain to be unraveled. The use of PCLS provides a unique opportunity to study primary mechanisms of MSC migration to the fibrotic tissue, having all liver cells in their original environment35,36. Although the viability of PCLS is preserved for several days37, the slicing process induces tissue and cellular (hepatocyte) damage, inflammatory signaling, tissue repair mechanisms, and the early onset of fibrosis35. So far, PCLS
Figure 5. CXCR2 promotes hASC migration to aHSC-CM. (A) hASC migration to
arHSC-CM. (B) Blocking hASC migration to arHSC-CM using specific antagonists for CXCR2, CXCR3 and CXCR4. Data shows mean value ± SD of 3 experiments. *p ≤0.05, **p ≤0.01, ***p ≤0.001, Mann-Whitney U test.
2
have been applied to analyze drug metabolism37 and served as models of drug-induced cholestatic38, metabolic39, and fibrotic35 liver disease, but this is the first-time application of these tissue slices as a chemotactic model. Our primary data show that hASC migrated to both human and rat PCLS. In order to identify the source of migratory signals in the fibrotic liver, we investigated hASC migration to either primary hepatocytes, qHSC and aHSC. Furthermore, our data show that hASC migration was effectively blocked by CXCR2 antagonists and to a lesser extent by CXCR3 antagonists, inspiring to analyze the putative CXCLs involved. Others showed that HSC activation is associated with a rapid increase in the production of cytokines and chemokines in these cells40,41. In line with effects of antagonists, our data reveal a sharp increase in the expression of HSC-derived ligands for CXCR2, namely Cxcl1 and Cxcl2. CXCL1 is a key fibrogenic chemokine42 and also promotes autocrine activation of HSC27. A recent study suggests that the secretion of CXCL1 by activated HSC is regulated by CD147 via PI3K/AKT signaling. Furthermore, it has been shown that the specific deletion of CD147 in HSC, suppresses CXCL1 expression and, therefore, inhibits HSC activation and alleviates CCl₄-induced liver fibrosis in mice27.
In the fibrotic liver, CXCL1 is also released by infiltrated neutrophils. It is shown that blocking the neutrophils infiltration reduces CXCL1 levels and protects liver against fibrosis in mice43,44. It is well-documented that release of CXCL2 is increased in the diseased liver, mainly produced by Kupffer cells and activated HSC. CXCL2 is known to have major roles in attracting inflammatory cells, mainly neutrophils, to the fibrotic liver45,46. Here, increased secretion of CXCL1 and CXCL2 in aHSC might explain the efficient migration of hASC to aHSC as well as to PCLS. We found that qHSC only express CXCL12 which was suppressed in culture-activated HSC. CXCL12, the ligand for CXCR4, is constitutively expressed in healthy liver. However, its expression is enhanced following acute and chronic liver injury47. Considering our data, it is conceivable that other cell types rather than HSC are main producers of CXCL12 in injured liver. Sinusoidal endothelial cells, HSC, and malignant hepatocytes are other main sources of CXCL12 in diseased liver47. However, this contrast between in vitro and in vivo expression of CXCL12 may also originate from diversities between culture-activated and in vivo-activated HSC48,49. In humans, CXCL8 (e.g. IL-8) is an important ligand for CXCR1 and CXCR2 and a potent chemoattractant for neutrophils and to a lesser extent monocytes. Thus, CXCL8/IL-8 is well-recognized to contribute to the accumulation of macrophages in both acute inflammation and chronic liver disease50,51.IL-8 is produced by virtually all nucleated human cell types50,51. Remarkable, an important for our study, rodents do not harbor a true homolog gene for CXCL852. Hepatic and serum levels of IL-8 are increased in patients with
alcoholic liver disease, promoting hepatic neutrophil accumulation53,54. Moreover, serum levels of IL-8 in patients with chronic hepatitis are tightly associated with the liver disease progression55. Several studies have indicated that IL-8 is not only a chemoattractant in the liver, but also possesses direct profibrogenic functions. For instance, HCV-derived core protein-transduced Huh-7 cells were capable of stimulating HSC in an IL-8 dependent manner56. Likewise, IL-8 signaling is shown to be linked to organ fibrosis in prostate, pancreas and lungs57-59. Overall, elevated IL-8 due to the liver injury is expected to enhance hASC attraction to the diseased liver. Our results shed light on determining roles of CXCR2 in hASC migration and therefore suggest prospective targets for the future of hASC-therapy in liver disease.
2
REFERENCES
1. Friedman SL. Liver fibrosis -- from bench to bedside. J Hepatol. 2003;38 Suppl 1:S38-53. 2. Sato M, Suzuki S, Senoo H. Hepatic stellate cells: Unique characteristics in cell biology and
phenotype. Cell Struct Funct. 2003;28(2):105-112.
3. Hu C, Zhao L, Duan J, Li L. Strategies to improve the efficiency of mesenchymal stem cell transplantation for reversal of liver fibrosis. J Cell Mol Med. 2019;23(3):1657-1670.
4. Bachofner JA, Valli PV, Kroger A, et al. Direct antiviral agent treatment of chronic hepatitis C results in rapid regression of transient elastography and fibrosis markers fibrosis-4 score and aspartate aminotransferase-platelet ratio index. Liver Int. 2017;37(3):369-376.
5. Fehily SR, Papaluca T, Thompson AJ. Long-term impact of direct-acting antiviral agent therapy in HCV cirrhosis: Critical review. Semin Liver Dis. 2019;39(3):341-353.
6. Laursen TL, Siggaard CB, Kazankov K, et al. Time-dependent improvement of liver inflammation, fibrosis and metabolic liver function after successful direct-acting antiviral therapy of chronic hepatitis C. J Viral Hepat. 2019.
7. Vainshtein JM, Kabarriti R, Mehta KJ, Roy-Chowdhury J, Guha C. Bone marrow-derived stromal cell therapy in cirrhosis: Clinical evidence, cellular mechanisms, and implications for the treatment of hepatocellular carcinoma. Int J Radiat Oncol Biol Phys. 2014;89(4):786-803. 8. Zhang Y, Li Y, Zhang L, Li J, Zhu C. Mesenchymal stem cells: Potential application for the
treatment of hepatic cirrhosis. Stem Cell Res Ther. 2018;9(1):59-018-0814-4.
9. Seki A, Sakai Y, Komura T, et al. Adipose tissue-derived stem cells as a regenerative therapy for a mouse steatohepatitis-induced cirrhosis model. Hepatology. 2013;58(3):1133-1142.
10. Zhang Z, Lin H, Shi M, et al. Human umbilical cord mesenchymal stem cells improve liver function and ascites in decompensated liver cirrhosis patients. J Gastroenterol Hepatol. 2012;27 Suppl 2:112-120.
11. Wang L, Han Q, Chen H, et al. Allogeneic bone marrow mesenchymal stem cell transplantation in patients with UDCA-resistant primary biliary cirrhosis. Stem Cells Dev. 2014;23(20):2482-2489.
12. El-Ansary M, Abdel-Aziz I, Mogawer S, et al. Phase II trial: Undifferentiated versus differentiated autologous mesenchymal stem cells transplantation in egyptian patients with HCV induced liver cirrhosis. Stem Cell Rev. 2012;8(3):972-981.
13. Xu L, Gong Y, Wang B, et al. Randomized trial of autologous bone marrow mesenchymal stem cells transplantation for hepatitis B virus cirrhosis: Regulation of treg/Th17 cells. J
Gastroenterol Hepatol. 2014;29(8):1620-1628.
14. Salama H, Zekri AR, Medhat E, et al. Peripheral vein infusion of autologous mesenchymal stem cells in egyptian HCV-positive patients with end-stage liver disease. Stem Cell Res Ther. 2014;5(3):70.
15. Deng C, Qin A, Zhao W, Feng T, Shi C, Liu T. Up-regulation of CXCR4 in rat umbilical mesenchymal stem cells induced by serum from rat with acute liver failure promotes stem cells migration to injured liver tissue. Mol Cell Biochem 2014 Nov+ADs-396(1-2):107-16 doi:
10 1007/s11010-014-2147-7 Epub. 2014;396(1-2):107-116.
16. Xie J, Wang W, Si JW, et al. Notch signaling regulates CXCR4 expression and the migration of mesenchymal stem cells. Cell Immunol. 2013;281(1):68-75.
17. de Graaf IA, Olinga P, de Jager MH, et al. Preparation and incubation of precision-cut liver and intestinal slices for application in drug metabolism and toxicity studies. Nat Protoc. 2010;5(9):1540-1551.
18. Przybyt E, Krenning G, Brinker MG, Harmsen MC. Adipose stromal cells primed with hypoxia and inflammation enhance cardiomyocyte proliferation rate in vitro through STAT3 and Erk1/2. J Transl Med. 2013;11:39-5876-11-39.
19. Woudenberg-Vrenken TE, Buist-Homan M, Conde de la Rosa L, Faber KN, Moshage H. Anti-oxidants do not prevent bile acid-induced cell death in rat hepatocytes. Liver Int. 2010;30(10):1511-1521.
20. Moshage H, Casini A, Lieber CS. Acetaldehyde selectively stimulates collagen production in cultured rat liver fat-storing cells but not in hepatocytes. Hepatology. 1990;12(3 Pt 1):511-518. 21. Shajari S, Laliena A, Heegsma J, Tunon MJ, Moshage H, Faber KN. Melatonin suppresses
activation of hepatic stellate cells through RORalpha-mediated inhibition of 5-lipoxygenase. J
Pineal Res. 2015;59(3):391-401.
22. Ge Y, Deng T, Zheng X. Dynamic monitoring of changes in endothelial cell-substrate adhesiveness during leukocyte adhesion by microelectrical impedance assay. Acta Biochim
Biophys Sin (Shanghai). 2009;41(3):256-262.
23. Catusse J, Liotard A, Loillier B, Pruneau D, Paquet JL. Characterization of the molecular interactions of interleukin-8 (CXCL8), growth related oncogen alpha (CXCL1) and a non-peptide antagonist (SB 225002) with the human CXCR2. Biochem Pharmacol. 2003;65(5):813-821.
24. Verzijl D, Storelli S, Scholten DJ, et al. Noncompetitive antagonism and inverse agonism as mechanism of action of nonpeptidergic antagonists at primate and rodent CXCR3 chemokine receptors. J Pharmacol Exp Ther. 2008;325(2):544-555.
25. Rosenkilde MM, Gerlach LO, Hatse S, et al. Molecular mechanism of action of monocyclam versus bicyclam non-peptide antagonists in the CXCR4 chemokine receptor. J Biol Chem. 2007;282(37):27354-27365.
26. van Meerloo J, Kaspers GJ, Cloos J. Cell sensitivity assays: The MTT assay. Methods Mol Biol. 2011;731:237-245.
27. Shi WP, Ju D, Li H, et al. CD147 promotes CXCL1 expression and modulates liver fibrogenesis.
Int J Mol Sci. 2018;19(4):10.3390/ijms19041145.
28. Harvey SA, Dangi A, Tandon A, Gandhi CR. The transcriptomic response of rat hepatic stellate cells to endotoxin: Implications for hepatic inflammation and immune regulation. PLoS One. 2013;8(12):e82159.
29. Fiore EJ, Dominguez LM, Bayo J, Garcia MG, Mazzolini GD. Taking advantage of the potential of mesenchymal stromal cells in liver regeneration: Cells and extracellular vesicles as therapeutic strategies. World J Gastroenterol. 2018;24(23):2427-2440.
30. Kim G, Eom YW, Baik SK, et al. Therapeutic effects of mesenchymal stem cells for patients with chronic liver diseases: Systematic review and meta-analysis. J Korean Med Sci. 2015;30(10):1405-1415.
31. Volarevic V, Nurkovic J, Arsenijevic N, Stojkovic M. Concise review: Therapeutic potential of mesenchymal stem cells for the treatment of acute liver failure and cirrhosis. Stem Cells. 2014;32(11):2818-2823.
32. Kidd S, Spaeth E, Dembinski JL, et al. Direct evidence of mesenchymal stem cell tropism for tumor and wounding microenvironments using in vivo bioluminescent imaging. Stem Cells. 2009;27(10):2614-2623.
33. Sasaki M, Abe R, Fujita Y, Ando S, Inokuma D, Shimizu H. Mesenchymal stem cells are recruited into wounded skin and contribute to wound repair by transdifferentiation into multiple skin cell type. J Immunol. 2008;180(4):2581-2587.
34. Fiore EJ, Dominguez LM, Bayo J, Garcia MG, Mazzolini GD. Taking advantage of the potential of mesenchymal stromal cells in liver regeneration: Cells and extracellular vesicles as therapeutic strategies. World J Gastroenterol. 2018;24(23):2427-2440.
35. Westra IM, Oosterhuis D, Groothuis GM, Olinga P. Precision-cut liver slices as a model for the early onset of liver fibrosis to test antifibrotic drugs. Toxicol Appl Pharmacol. 2014;274(2):328-338.
2
36. Graaf IA, Groothuis GM, Olinga P. Precision-cut tissue slices as a tool to predict metabolismof novel drugs. Expert Opin Drug Metab Toxicol. 2007;3(6):879-898.
37. Starokozhko V, Vatakuti S, Schievink B, et al. Erratum to: Maintenance of drug metabolism and transport functions in human precision-cut liver slices during prolonged incubation for 5 days. Arch Toxicol. 2017;91(7):2711-016-1895-4.
38. Starokozhko V, Greupink R, van de Broek P, et al. Rat precision-cut liver slices predict drug-induced cholestatic injury. Arch Toxicol. 2017;91(10):3403-3413.
39. Costa A, Sarmento B, Seabra V. An evaluation of the latest in vitro tools for drug metabolism studies. Expert Opin Drug Metab Toxicol. 2014;10(1):103-119.
40. Friedman SL. Stellate cell activation in alcoholic fibrosis--an overview. Alcohol Clin Exp Res. 1999;23(5):904-910.
41. Friedman SL. Molecular regulation of hepatic fibrosis, an integrated cellular response to tissue injury. J Biol Chem. 2000;275(4):2247-2250.
42. Sahin H, Wasmuth HE. Chemokines in tissue fibrosis. Biochim Biophys Acta. 2013;1832(7):1041-1048.
43. Zaldivar MM, Pauels K, von Hundelshausen P, et al. CXC chemokine ligand 4 (Cxcl4) is a platelet-derived mediator of experimental liver fibrosis. Hepatology. 2010;51(4):1345-1353. 44. Zhou Z, Xu MJ, Cai Y, et al. Neutrophil-hepatic stellate cell interactions promote fibrosis in
experimental steatohepatitis. Cell Mol Gastroenterol Hepatol. 2018;5(3):399-413.
45. Moles A, Murphy L, Wilson CL, et al. A TLR2/S100A9/CXCL-2 signaling network is necessary for neutrophil recruitment in acute and chronic liver injury in the mouse. J Hepatol. 2014;60(4):782-791.
46. Mochizuki A, Pace A, Rockwell CE, et al. Hepatic stellate cells orchestrate clearance of necrotic cells in a hypoxia-inducible factor-1alpha-dependent manner by modulating macrophage phenotype in mice. J Immunol. 2014;192(8):3847-3857.
47. Liepelt A, Tacke F. Stromal cell-derived factor-1 (SDF-1) as a target in liver diseases. Am J
Physiol Gastrointest Liver Physiol. 2016;311(2):G203-9.
48. Kristensen DB, Kawada N, Imamura K, et al. Proteome analysis of rat hepatic stellate cells.
Hepatology. 2000;32(2):268-277.
49. Maubach G, Lim MC, Chen J, Yang H, Zhuo L. miRNA studies in in vitro and in vivo activated hepatic stellate cells. World J Gastroenterol. 2011;17(22):2748-2773.
50. Kaplanski G, Farnarier C, Kaplanski S, et al. Interleukin-1 induces interleukin-8 secretion from endothelial cells by a juxtacrine mechanism. Blood. 1994;84(12):4242-4248.
51. Hashimoto S, Yoda M, Yamada M, Yanai N, Kawashima T, Motoyoshi K. Macrophage colony-stimulating factor induces interleukin-8 production in human monocytes. Exp Hematol. 1996;24(2):123-128.
52. Asfaha S, Dubeykovskiy AN, Tomita H, et al. Mice that express human interleukin-8 have increased mobilization of immature myeloid cells, which exacerbates inflammation and accelerates colon carcinogenesis. Gastroenterology. 2013;144(1):155-166.
53. Huang YS, Chan CY, Wu JC, Pai CH, Chao Y, Lee SD. Serum levels of interleukin-8 in alcoholic liver disease: Relationship with disease stage, biochemical parameters and survival. J Hepatol. 1996;24(4):377-384.
54. Hill DB, Marsano LS, McClain CJ. Increased plasma interleukin-8 concentrations in alcoholic hepatitis. Hepatology. 1993;18(3):576-580.
55. Polyak SJ, Khabar KS, Rezeiq M, Gretch DR. Elevated levels of interleukin-8 in serum are associated with hepatitis C virus infection and resistance to interferon therapy. J Virol. 2001;75(13):6209-6211.
56. Clement S, Pascarella S, Conzelmann S, Gonelle-Gispert C, Guilloux K, Negro F. The hepatitis C virus core protein indirectly induces alpha-smooth muscle actin expression in hepatic stellate cells via interleukin-8. J Hepatol. 2010;52(5):635-643.
57. Motoo Y, Xie MJ, Mouri H, Sawabu N. Expression of interleukin-8 in human obstructive pancreatitis. JOP. 2004;5(3):138-144.
58. Schauer IG, Ressler SJ, Tuxhorn JA, Dang TD, Rowley DR. Elevated epithelial expression of interleukin-8 correlates with myofibroblast reactive stroma in benign prostatic hyperplasia.
Urology. 2008;72(1):205-213.
59. Carre PC, Mortenson RL, King TE,Jr, Noble PW, Sable CL, Riches DW. Increased expression of the interleukin-8 gene by alveolar macrophages in idiopathic pulmonary fibrosis. A potential mechanism for the recruitment and activation of neutrophils in lung fibrosis. J Clin Invest. 1991;88(6):1802-1810.
2
SUPPLEMENTARY TABLES AND FIGURES
Supplementary table S1. Primers and probes used for real-time quantitative PCR analysis
Gene Primer and probe
CXCR2 (human) Hs01011557_M1 CXCR3 (human) Hs00171041_M1 CXCR4 (human) Hs00976734_M1 Cxcl12 (rat) Rn00573260_M1 Cxcl10 (rat) Rn00594648_M1 Cxcl1 (rat) Rn00578225_M1 Cxcl2 (rat) Rn00586403_M1 Cxcl9 (rat) Rn00595504_M1 Cxcl11 (rat) Rn00595504_M1 Cxcl6 (rat) Rn00573587_G1 Ppbp (rat) Rn00596603_G1 Cxcl3 (rat) RN01414231_M1
18S (rat) For (5’-3’): CGGCTACCACATCCAAGGA Rev (5’-3’): CCAATTACAGGGCCTCGAAA Probe (5’-3’): CGCGCAAATTACCCACTCCCGA
Supplementary Figure S1: Antagonists are not toxic to arHSC and hASC. Cell viability of
(A) arHSC, and (B) hASC after 12 h exposure to each antagonist. Data shows mean value ± SD of 3 experiments. p ≤0.05, **p ≤0.01, ***p ≤0.001, ANOVA (with Tukey’s post-hoc test for individual experimental conditions).
