Decoding therapeutic roles of adipose tissue-derived stromal cells and their extracellular
vesicles in liver disease
Afsharzadeh, Danial
DOI:10.33612/diss.121499227
IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below.
Document Version
Publisher's PDF, also known as Version of record
Publication date: 2020
Link to publication in University of Groningen/UMCG research database
Citation for published version (APA):
Afsharzadeh, D. (2020). Decoding therapeutic roles of adipose tissue-derived stromal cells and their extracellular vesicles in liver disease. University of Groningen. https://doi.org/10.33612/diss.121499227
Copyright
Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).
Take-down policy
If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.
Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum.
CHAPTER
4
Extracellular vesicles
from adipose
tissue-derived stromal cells
ameliorate APAP- and
CCl
4
-induced acute liver
injury
Danial Afsharzadeh1 Svenja Sydor2 Ali Canbay2 Lars P. Bechmann2 Martin C. Harmsen3Klaas Nico Faber1,4
Departments of 1Hepatology and Gastroenterology, 3Pathology and Medical Biology, and 4Laboratory Medicine,
Center for Liver, Digestive and Metabolic Disease, University of Groningen, University Medical Center Groningen, Groningen, The Netherlands. 2Department of
Gastroenterology, Hepatology and Infectious Diseases, Otto von Guericke University Magdeburg, Magdeburg, Germany.
ABSTRACT
Background & Aim: Acute liver failure is a life threating disease where the
damaged liver fails within days to weeks. Administration of human adipose tissue-derived stromal cells (hASC) promotes liver regeneration and improves liver function, but their mode of action is largely unresolved. Here, we studied the prophylactic and therapeutic potential of hASC-derived extracellular vesicles (EVs) to attenuate the acute liver damage in APAP- and CCl4-induced murine models for acute liver injury.
Methods: APAP- and CCl4-treated mice were prophylactically and therapeutically administrated with hASC-derived EVs. Liver pathology was assessed by histochemical staining while the mechanism was studied via markers for inflammation, oxidative stress and fibrosis. Systemic influence of EVs was determined via markers of liver damage, ALT and AST, in sera.
Results: Prophylactic treatment with hASC-derived EVs reduced CCl4-induced serum ALT and AST levels and prevented the liver damage as seen in sections. In contrast, therapeutic application of hASC-derived EVs did not influence ALT and AST levels and neither resolved CCl4-induced liver damage. Similarly, prophylactic administration of hASC-derived EVs reduced the CCl4-induced hepatic expression of Tnfα, Nos2, Col1a1 and Pai1 while the therapeutic treatment reduced the hepatic expression of only Col1a1 and Pai1. In contrast to CCl4-induced liver damage, ALT and AST levels remained normal or were reduced respectively after both prophylactically or therapeutically administered hASC-derived EVs in APAP-induced acute liver damage. This coincided with a normal appearance of liver histology. Similar to CCl4-induced liver damage, both prophylactic and therapeutic treatment with hASC-derived EVs suppressed the hepatic expression of Tnfα and Nos2, and prevented the APAP-induced reduction of the hepatic GSH/GSSG ratio.
Conclusion: hASC-derived EVs alleviated injury in two mouse models of acute
liver injury and thus hold promise as a novel of-the-shelf therapy to treat patients with ALF.
4
4.1. INTRODUCTION
Acute liver failure (ALF) indicates loss of liver function and requires immediate liver transplantation because no definitive therapy exists.Drug intoxication is the leading cause of ALF, and acetaminophen (APAP) overdose represents the most common cause of drug-induced ALF, worldwide1. Fortunately, the liver has a large
regeneration capacity2-4 to recover from damage induced by injury. Both the level
and duration of injury may be too large and limit sufficient regeneration which is the onset of frequently lethal ALF5. The shortage of liver donations and
post-transplantation complications urge the advent of novel regeneration-promoting therapies to combat ALF6. Regenerative therapy depends on generation of new
liver tissue, thus stem cells such as multipotent mesenchymal stromal cells (MSC) are likely candidates to support this process7-10. The past decade, MSC
therapy showed promising therapeutic results in preclinical and clinical studies on acute liver failure8-9. Administration MSC promoted liver regeneration and
improved liver function10,11.Much of these beneficial effects likely do not rely on
hepatic differentiation of MSC although this is possible in vitro12. Yet, it remains
controversial in vivo13,14. Transplanted MSC even do not necessarily stably or
permanently engraft at the site of liver injury15-17. The contribution of MSC to
liver regeneration is at least partially in a reconstructive fashion i.e. through differentiation in collagen-depositing fibrocytes18,19.Current dogma dictates that
MSC-related therapeutic effects are predominantly instructive i.e. paracrine 20-25.
Several MSC-secreted trophic molecules were shown to be anti-inflammatory, anti-apoptotic and anti-fibrotic26-29. Another component of the MSC secretome,
extracellular vesicles (EVs) has not been thoroughly investigated. EVs are carriers of coding and regulatory RNAs including microRNAs and proteins such as growth factors and cyto/chemokines. EVs may target cells and are able to deliver theirs cargo intracellularly. The cargo of EVs modulates transcription, post transcriptional events and signal transduction in the recipient cells30-36.Currently,
adipose-derived stem cells (hASC) are being considered as an attractive candidate for MSC-based therapies against acute liver failure37-39. Compared to other sources
of MSC such as bone marrow, hASC are easy to obtain in abundant quantities from lipoaspirates, which renders these suitable for therapeutic use40. Here, we studied
the prophylactic and therapeutic potential of hASC-derived EVs to attenuate the acute liver damage in APAP- and a CCl4-induced murine models of acute liver injury.
4.2. MATERIAL AND METHODS
4.2.1. Human Adipose tissue–derived Stromal Cell (hASC) isolation and culture
Human subcutaneous adipose tissue was obtained under informed consent from healthy donors with BMI below 30 undergoing liposuction surgery (Bergman Clinics, The Netherlands). Adipose tissue was stored at 4°C and processed within 24 h post-surgery. hASC were isolated as described41 and seeded in culture flasks
at 4x104 /cm2, expanded by passing three times and used for experiments. All
experiments were performed using a pool of hASC from three donors. The use of adipose tissue as the source of hASC was approved by the local Ethics Committee of University Medical Center Groningen, given the fact that it was considered the use of anonymized waste material.
4.2.2. Isolation and identification of hASC-derived extracellular vesicles (EVs)
hASC-derived extracellular vesicles (EVs) were isolated by differential centrifugation method, essentially as described before42. Briefly, serum-free
hASC-CM was centrifuged at 10,000 xg for 20 min to remove apoptotic bodies. The supernatant was collected and subjected to 100,000 xg for 60 min (optimal-XPN; Beckman Coulter). The EV-enriched pellet was washed in PBS and subjected to an additional round of ultracentrifugation at 100,000 xg for 60 min. EVs were resuspended in PBS and stored at -80°C. Quantity and size distribution of EVs was confirmed using a nanoparticle tracking analyzer, NTA, (NanoSight NS500, Malvern, Worcestershire, UK), as described in chapter 3.
4.2.3. Animals
All mice were bred and housed in the animal facility of the University Hospital Essen (ZTL), University of Duisburg-Essen, Germany according to the recommendations of the Federation of European Laboratory Animal Science Association (FELASA). All procedures were approved by the Landesamt für Natur, Umwelt und Verbraucherschutz Nordrhein-Westfalen (LANUV NRW).
4.2.4. CCl4-induced mouse model of liver injury and injection of
hASC-derived EVs
Mice (Four- to six-week-old C57Bl/6) were subjected to a single intraperitoneal injection of corn oil/ 10 ml/kg CCl4 (Sigma-Aldrich) in corn oil. 100 µl PBS/ 4x108 resuspended hASC-derived EVs in PBS was intravenously injected either
4
(CCl4+Vehicle groups) (n=8). The control group received corn oil (control group) (n=6). Mice were sacrificed 48 hours after the CCl4 administration and blood samples were taken, serum prepared and stored at -80°C. Liver samples were fixed in 4.5% formalin solution, paraffin-embedded and sectioned.
4.2.5. APAP-induced mouse model of liver injury and injection of hASC-derived EVs
All mice (Four- to six-week-old male C57Bl/6) were subjected to a single intraperitoneal injection of 300 mg/kg APAP (Sigma-Aldrich, Germany). hASC-derived EVs (4x108) resuspended in 100 µl PBS were injected via the tail vein either
one hour before or one hour after the APAP administration (APAP+EVs groups) and (APAP+Vehicle groups) (n=8). The control groups (no APAP administration) were injected with only EVs or only PBS (EVs +Vehicle groups) (n=6). Mice were sacrificed 8 hours after the APAP administration and blood samples were taken, serum prepared and stored at -80°C. Liver samples were fixed in 4.5% formalin solution, paraffin-embedded and sectioned.
4.2.6. RNA isolation and gene expression analysis
RNA was isolated using TRI reagent (Sigma-Aldrich) according to the manufacturer’s instructions. Reverse transcription was performed on 2.5 µg total RNA using random nanomers (Sigma-Aldrich) in a final volume of 50 µl. Real-time semi-quantitative PCR (qPCR) was performed on the 7900HT Fast Real-TimePCR system (Applied Biosystems Europe, The Netherlands) using the TaqMan or SYBR Green protocol43. mRNA levels were normalized to housekeeping
gene and further normalized to the mean expression level of the control group (∆∆CT method). qPCR primers and probes are shown in Supplementary Tables S1 and S2.
4.2.7. Histochemical staining
Liver tissues were processed for paraffin embedding and were sectioned into 4 µm thick sections. The sections were stained with hematoxylin and eosin according to the standard protocol.
4.2.8. Serum assay
Serum aspartate transaminase (AST) and alanine aminotransferase (ALT) levels were measured with an automated biochemical analyzer (Cobas 6000 CE, Hitachi).
4.2.9. Statistical analysis
Data are expressed as average with standard deviation. Statistical significance was determined using by one-way ANOVA (with Tukey’s post-hoc test for individual experimental conditions). All tests were performed with GraphPad Prism (v. 5.0; GraphPad Software, La Jolla, CA, USA). Differences were considered significant at P < 0.05.
4.3. RESULTS
4.3.1. hASC-derived EVs alleviate CCl4- and APAP-induced acute liver injury
in mice.
In order to determine a potential therapeutic benefit of hASC-derived EVs in acute liver injury, we treated mice with a single high dose of CCl4 and cotreated the animals with hASC-derived EVs either one hour before (-1 h; prophylactic
Figure 1. hASC-derived EVs alleviate CCl4-induced acute liver injury in mice. Serum
levels of (A) alanine aminotransferase (ALT) and (B) Aspartate aminotransferase (AST) in mice with CCl4-induced liver injury. (C) Hematoxylin and eosin staining of liver sections. (a) Corn oil; (b) CCl4+vehicle (-1h); (c) CCl4+EVs (-1h); (d) CCl4+vehicle (+3h); (e)
CCl4+EVs (+3h). Data shows mean value ± SD. *p ≤0.05, **p ≤0.01, ***p ≤0.001, ANOVA
(with Tukey’s post-hoc test for individual experimental conditions).
A B
4
assessment) or three hours after (+3h; therapeutic assessment) the CCl4-induced liver injury. Mice were sacrificed 48 h after CCl4 treatment. As expected, CCl4 caused acute liver damage as evidenced by strongly increased serum levels of ALT and AST (Figure 1A, B). Prophylactic treatment with hASC-derived EVs led to reduced CCl4-induced serum ALT levels (Figure 1A) compared to controls. Reduction of serum AST did not reach significance compared to controls (Figure
1B). In contrast, therapeutic application of hASC-derived EVs (3 h after CCl4) did not reduce CCl4-induced serum ALT and AST levels (Figure 1A,B). The CCl4 -induced liver damage was observed histologically as widespread ballooning and necrosis of hepatocytes (Figure 1C-b, d), which was absent in sham (corn oil)-treated control livers (Figure 1C-a). Preemptive administration of hASC-derived EVs largely prevented this gross hepatocyte-associated liver damage. (Figure
Figure 2. Prophylactic hASC-derived EVs suppress markers of inflammation and early fibrosis. Hepatic expression of (A) Tnfα, (B) Nos2 (C) Col1a1 and (D) Pai1 in mice with CCl4-induced liver injury. Data shows mean value ± SD. *p ≤0.05, **p ≤0.01, ***p ≤0.001, ANOVA (with Tukey’s post-hoc test for individual experimental conditions).
B A
D C
A B
C
E D
4
1C-c). In contrast, hepatic damage was not resolved by hASC-derived EVs whenadministered 3 h after CCl4 injection (Figure 1C-e).
4.3.2. Prophylactic hASC-derived EVs suppress markers of inflammation and early fibrosis
A single dose of CCl4 enhanced the hepatic mRNA levels of Tnfα and Nos2, marking an inflammatory response (Figure 2A,B). Prophylactic administration of hASC-derived EVs 1 h prior to the CCl4 treatment significantly suppressed hepatic Tnfα and Nos2 expression, which was not observed in mice given hASC-derived EVs 3 hours after the CCl4 treatment (Figure 2A,B). In contrast, both prophylactic as well as therapeutic application of hASC-derived EVs significantly suppressed the expression of CCl4-induced Col1a1 and Pai1, being early markers of fibrosis (Figure 2C,D).
4.3.3. hASC-derived EVs potently suppress APAP-induced acute liver injury in mice.
The therapeutic efficacy of hASC-derived EVs to prevent or reverse the consequences of acute liver injury was further assessed in the murine model of acute APAP-induced liver intoxication. Mice were injected with hASC-derived EVs one hour prior (-1h; prophylactic) or one hour after (+1h; therapeutic intervention) APAP administration and sacrificed eight hours later. Administration of APAP caused a strong increase in serum ALT and AST levels compared to sham (EV-only)-treated animals (Figure 3A, B). Both prophylactic and therapeutic administration of hASC-derived EVs suppressed the APAP-induced levels of ALT and AST to basal levels of sham-treated mice (Figure 3A, B). This was corroborated by the H&E-stained liver sections in which APAP-treated animals showed ballooning and necrosis of hepatocytes (Figure 3C-a, d), which was almost fully resolved in mice receiving hASC-derived EVs 1 hour before or after the induction of APAP (Figure 3C-b,e). Given either prophylactically or therapeutically, hASC-derived EVs suppressed hepatic expression of inflammatory markers Tnfα and Nos2, albeit not to the expression levels in sham-treated mice (Figure 3D, E). APAP-toxicity is primarily caused by acute depletion of hepatic reduced glutathione (GSH) levels. previous page: Figure 3. hASC-derived EVs alleviate APAP-induced acute liver injury in mice. Serum levels of (A) alanine aminotransferase (ALT) and (B) Aspartate aminotransferase (AST) mice with APAP-induced liver injury. (C) Hematoxylin and eosin staining of liver sections. (a) APAP+vehicle (-1); (b) APAP+EVs (-1); (c) EVs+vehicle (-1); (d) APAP+vehicle (+1); (e) APAP+EVs (+1); (f) EVs+vehicle (+1). Hepatic expression of (D) Tnfα and (E) Nos2 in mice with APAP-induced liver injury. Data shows mean value ± SD. *p ≤0.05, **p ≤0.01, ***p ≤0.001, ANOVA (with Tukey’s post-hoc test for individual experimental conditions).
Indeed, APAP-treated mice showed a significant reduction in the hepatic ratio of reduced versus oxidized glutathione (GSH/GSSG ratio), when compared to sham (EV-only)-treated animals (Figure 4). Both prophylactic and therapeutic application of hASC-derived EVs prevented the APAP-induced reduction of the hepatic GSH/GSSG ratio (Figure 4).
4.4. DISCUSSION
In this study, we show the prophylactic and therapeutic potential of hASC-derived EVs to attenuate acute liver damage in two murine models for acute liver injury, i.e. through induction with APAP or CCl4.
The APAP causes acute liver injury model due to increased ROS levels and also associates with acutely disturbed proteostasis due to crosslinking of liver proteins44,45. Conjugation of APAP-reactive metabolites with glutathione
(GSH) causes depletion of this ROS scavenger and results in rapid necrosis and inflammation in the hepatic centrilobular cells46. The CCl
4-induced liver injury
model relies on the rapid formation of free radical metabolites from CCl4. These free radicals can covalently bind to macro-molecules in liver cells, cause lipid peroxidation which compromises the integrity of membrane systems in the liver. This results in necrosis and inflammation of liver cells47,48. The conditioned
medium of mesenchymal stem cells (MSC-conditioned medium) has been shown Figure 4. Prophylactic and therapeutic application of hASC-derived EV prevented the APAP-induced reduction of the hepatic GSH/GSSG ratio. GSH/GSSG ratio in the mice with APAP-induced liver injury. Data shows mean value ± SD. *p ≤0.05, **p ≤0.01, ***p ≤0.001, ANOVA (with Tukey’s post-hoc test for individual experimental conditions).
4
to alleviate oxidative stress, such as caused by exposure of hepatocytes to hydrogen peroxide49. Others confirmed that MSC-conditioned medium suppresses the
oxidative stress and enhances the liver regeneration in the murine models of acute liver failure50-52. In this study, we investigated the therapeutic effects of
hASC-derived EVs in the APAP- and CCl4-induced mouse models of acute liver injury. A single injection of APAP/CCl4 induced hepatic necrosis and inflammation which resembles pathological features of clinical ALF. Interestingly, EVs injected via the peripheral circulation still showed beneficial influences on liver pathology. This suggests that EVs harbor a potent systemic effect or target to the liver or a combination. The biodistribution of EVs is similar to that of synthetic membranous nanoparticles i.e. liposomes, due to the similarity in size and the structure of the lipophilic outer layer53-56. The fact that most of i.v. injected liposomes are captured
by the liver and spleen rather than other organs57,58, might predict that in our
hands hASC-derived EVs also were captured by liver cells. Wiklander et al., showed that EVs generally distribute to organs of the mononuclear phagocyte system with highest accumulation in the liver, followed by spleen, GI-tract and lungs59. In this study, beneficial effects of hASC-derived EVs in the protection/
recovery of hepatocytes and attenuation of acute liver damage were apparent in rather a short period after the administration of them. Therefore, we assume that hepatocytes are also a direct target of hASC-derived EVs. Our earlier miRNA-seq analysis unveiled that hASC-derived EVs contain more than 10,000 types of miRNAs in the cargo (Chapter 3). Among those, miR-125b, miR-15b and miR16 have been shown to be involved in the regulation of cell death60,61. Yang et al.,
identified that miR-125b-5p as a regulator of cell death attenuates paracetamol-induced and FAS-paracetamol-induced toxicity in mouse and human hepatocytes. Importantly, directly administration of miR-125b-5p into the liver has been shown to prevent the liver damage and improves the survival in murine models of ALF. Functional studies have shown that miR-125b ameliorates ALF by directly regulating kelch-like ECH-associated protein 1, in turn elevating expression of nuclear factor-E2-related factor 2, a known regulator in ALF60. Others confirmed that
miR-15b and miR-16 regulate TNF-mediated hepatocyte apoptosis via BCL2 in acute liver failure61. Interestingly, miR-15b has been shown to be involved also
in the mitochondrial ROS production62, which might highlight the role of this
miRNA in the prophylactic and therapeutic effects of hASC-derived EVs against the APAP- and CCl4-induced liver damage. Findings of our study indicate that beneficial influence of hASC-derived EVs on suppression of CCl4-induced liver damage is only prophylactic, while both prophylactic and therapeutic application of EVs recovered APAP-induced livers to a nearly normal condition. Moreover, our data show that both prophylactic and therapeutic administration of
hASC-derived EVs suppresses the early onset of liver fibrosis induced by the acute dose of CCl4. Considering that beneficial effects of hASC-derived EVs on hepatocytes of CCl4-induced livers were only prophylactic, it is so likely that liver fibroblasts are also a direct target of these EVs. These results are attractive as EV-based cell-free therapy decreases risks and complications of the cell therapy. hASC-derived EVs may provide a novel alternative therapy for the patients with ALF.
Funding:
This study was funded by EASL Entry-Level fellowship and De Stichting De Cock-Hadders.
4
REFERENCES
1. Fontana RJ. Acute liver failure including acetaminophen overdose. Med Clin North Am. 2008;92(4):761-94, viii.
2. Michalopoulos GK, DeFrances MC. Liver regeneration. Science. 1997;276(5309):60-66. 3. Taub R. Liver regeneration: From myth to mechanism. Nat Rev Mol Cell Biol.
2004;5(10):836-847.
4. Fausto N. Liver regeneration and repair: Hepatocytes, progenitor cells, and stem cells.
Hepatology. 2004;39(6):1477-1487.
5. Canbay A, Tacke F, Hadem J, Trautwein C, Gerken G, Manns MP. Acute liver failure: A life-threatening disease. Dtsch Arztebl Int. 2011;108(42):714-720.
6. Bernal W, Wendon J. Acute liver failure. N Engl J Med. 2013;369(26):2525-2534.
7. Owen A, Newsome PN. Mesenchymal stromal cell therapy in liver disease: Opportunities and lessons to be learnt? Am J Physiol Gastrointest Liver Physiol. 2015;309(10):G791-800.
8. Wu DB, Chen EQ, Tang H. Stem cell transplantation for the treatment of end-stage liver disease. World J Hepatol. 2018;10(12):907-910.
9. Volarevic V, Nurkovic J, Arsenijevic N, Stojkovic M. Concise review: Therapeutic potential of mesenchymal stem cells for the treatment of acute liver failure and cirrhosis. Stem Cells. 2014;32(11):2818-2823.
10. Liu WH, Song FQ, Ren LN, et al. The multiple functional roles of mesenchymal stem cells in participating in treating liver diseases. J Cell Mol Med. 2015;19(3):511-520.
11. Zare H, Jamshidi S, Dehghan MM, Saheli M, Piryaei A. Bone marrow or adipose tissue mesenchymal stem cells: Comparison of the therapeutic potentials in mice model of acute liver failure. J Cell Biochem. 2018;119(7):5834-5842.
12. Lee KD, Kuo TK, Whang-Peng J, et al. In vitro hepatic differentiation of human mesenchymal stem cells. Hepatology. 2004;40(6):1275-1284.
13. Meier RP, Muller YD, Morel P, Gonelle-Gispert C, Buhler LH. Transplantation of mesenchymal stem cells for the treatment of liver diseases, is there enough evidence? Stem Cell Res. 2013;11(3):1348-1364.
14. Puglisi MA, Tesori V, Lattanzi W, et al. Therapeutic implications of mesenchymal stem cells in liver injury. J Biomed Biotechnol. 2011;2011:860578.
15. Chang YS, Choi SJ, Sung DK, et al. Intratracheal transplantation of human umbilical cord blood-derived mesenchymal stem cells dose-dependently attenuates hyperoxia-induced lung injury in neonatal rats. Cell Transplant. 2011;20(11-12):1843-1854.
16. Ahn SY, Chang YS, Sung DK, et al. Mesenchymal stem cells prevent hydrocephalus after severe intraventricular hemorrhage. Stroke. 2013;44(2):497-504.
17. Togel F, Westenfelder C. Adult bone marrow-derived stem cells for organ regeneration and repair. Dev Dyn. 2007;236(12):3321-3331.
18. di Bonzo LV, Ferrero I, Cravanzola C, et al. Human mesenchymal stem cells as a two-edged sword in hepatic regenerative medicine: Engraftment and hepatocyte differentiation versus profibrogenic potential. Gut. 2008;57(2):223-231.
19. Thorgeirsson SS, Grisham JW. Hematopoietic cells as hepatocyte stem cells: A critical review of the evidence. Hepatology. 2006;43(1):2-8.
20. Vizoso FJ, Eiro N, Cid S, Schneider J, Perez-Fernandez R. Mesenchymal stem cell secretome: Toward cell-free therapeutic strategies in regenerative medicine. Int J Mol Sci. 2017;18(9):10.3390/ijms18091852.
21. Banas A, Teratani T, Yamamoto Y, et al. IFATS collection: In vivo therapeutic potential of human adipose tissue mesenchymal stem cells after transplantation into mice with liver injury.
22. Kapur SK, Katz AJ. Review of the adipose derived stem cell secretome. Biochimie. 2013;95(12):2222-2228.
23. Gimble JM, Bunnell BA, Guilak F. Human adipose-derived cells: An update on the transition to clinical translation. Regen Med. 2012;7(2):225-235.
24. Togel F, Weiss K, Yang Y, Hu Z, Zhang P, Westenfelder C. Vasculotropic, paracrine actions of infused mesenchymal stem cells are important to the recovery from acute kidney injury. Am J
Physiol Renal Physiol. 2007;292(5):F1626-35.
25. Camussi G, Deregibus MC, Bruno S, Cantaluppi V, Biancone L. Exosomes/microvesicles as a mechanism of cell-to-cell communication. Kidney Int. 2010;78(9):838-848.
26. Kupcova Skalnikova H. Proteomic techniques for characterisation of mesenchymal stem cell secretome. Biochimie. 2013;95(12):2196-2211.
27. Parekkadan B, van Poll D, Megeed Z, et al. Immunomodulation of activated hepatic stellate cells by mesenchymal stem cells. Biochem Biophys Res Commun. 2007;363(2):247-252. 28. Wang J, Bian C, Liao L, et al. Inhibition of hepatic stellate cells proliferation by mesenchymal
stem cells and the possible mechanisms. Hepatol Res. 2009;39(12):1219-1228.
29. Lin N, Hu K, Chen S, et al. Nerve growth factor-mediated paracrine regulation of hepatic stellate cells by multipotent mesenchymal stromal cells. Life Sci. 2009;85(7-8):291-295. 30. Li T, Yan Y, Wang B, et al. Exosomes derived from human umbilical cord mesenchymal stem
cells alleviate liver fibrosis. Stem Cells Dev. 2013;22(6):845-854.
31. Hyun J, Wang S, Kim J, Kim GJ, Jung Y. MicroRNA125b-mediated hedgehog signaling influences liver regeneration by chorionic plate-derived mesenchymal stem cells. Sci Rep. 2015;5:14135.
32. Li J, Ghazwani M, Zhang Y, et al. miR-122 regulates collagen production via targeting hepatic stellate cells and suppressing P4HA1 expression. J Hepatol. 2013;58(3):522-528.
33. Lou G, Chen Z, Zheng M, Liu Y. Mesenchymal stem cell-derived exosomes as a new therapeutic strategy for liver diseases. Exp Mol Med. 2017;49(6):e346.
34. Haney MJ, Klyachko NL, Zhao Y, et al. Exosomes as drug delivery vehicles for parkinson’s disease therapy. J Control Release. 2015;207:18-30.
35. Sun D, Zhuang X, Xiang X, et al. A novel nanoparticle drug delivery system: The anti-inflammatory activity of curcumin is enhanced when encapsulated in exosomes. Mol Ther. 2010;18(9):1606-1614.
36. Johnsen KB, Gudbergsson JM, Skov MN, Pilgaard L, Moos T, Duroux M. A comprehensive overview of exosomes as drug delivery vehicles - endogenous nanocarriers for targeted cancer therapy. Biochim Biophys Acta. 2014;1846(1):75-87.
37. Chen G, Jin Y, Shi X, et al. Adipose-derived stem cell-based treatment for acute liver failure.
Stem Cell Res Ther. 2015;6:40-015-0040-2.
38. Esrefoglu M. Role of stem cells in repair of liver injury: Experimental and clinical benefit of transferred stem cells on liver failure. World J Gastroenterol. 2013;19(40):6757-6773.
39. Fu Y, Deng J, Jiang Q, et al. Rapid generation of functional hepatocyte-like cells from human adipose-derived stem cells. Stem Cell Res Ther. 2016;7(1):105-016-0364-6.
40. Gimble JM, Bunnell BA, Frazier T, et al. Adipose-derived stromal/stem cells: A primer.
Organogenesis. 2013;9(1):3-10.
41. Przybyt E, Krenning G, Brinker MG, Harmsen MC. Adipose stromal cells primed with hypoxia and inflammation enhance cardiomyocyte proliferation rate in vitro through STAT3 and Erk1/2. J Transl Med. 2013;11:39-5876-11-39.
42. Momen-Heravi F, Balaj L, Alian S, et al. Current methods for the isolation of extracellular vesicles. Biol Chem. 2013;394(10):1253-1262.
43. Shajari S, Laliena A, Heegsma J, Tunon MJ, Moshage H, Faber KN. Melatonin suppresses activation of hepatic stellate cells through RORalpha-mediated inhibition of 5-lipoxygenase. J
4
44. McGill MR, Sharpe MR, Williams CD, Taha M, Curry SC, Jaeschke H. The mechanism underlying acetaminophen-induced hepatotoxicity in humans and mice involves mitochondrial damage and nuclear DNA fragmentation. J Clin Invest. 2012;122(4):1574-1583. 45. Reid AB, Kurten RC, McCullough SS, Brock RW, Hinson JA. Mechanisms of acetaminophen-induced hepatotoxicity: Role of oxidative stress and mitochondrial permeability transition in freshly isolated mouse hepatocytes. J Pharmacol Exp Ther. 2005;312(2):509-516.
46. James LP, Mayeux PR, Hinson JA. Acetaminophen-induced hepatotoxicity. Drug Metab
Dispos. 2003;31(12):1499-1506.
47. Zhang JQ, Shi L, Xu XN, et al. Therapeutic detoxification of quercetin against carbon tetrachloride-induced acute liver injury in mice and its mechanism. J Zhejiang Univ Sci B. 2014;15(12):1039-1047.
48. Weber LW, Boll M, Stampfl A. Hepatotoxicity and mechanism of action of haloalkanes: Carbon tetrachloride as a toxicological model. Crit Rev Toxicol. 2003;33(2):105-136.
49. Xu X, Li D, Li X, Shi Q, Ju X. Mesenchymal stem cell conditioned medium alleviates oxidative stress injury induced by hydrogen peroxide via regulating miR143 and its target protein in hepatocytes. BMC Immunol. 2017;18(1):51-017-0232-x.
50. Du Z, Wei C, Cheng K, et al. Mesenchymal stem cell-conditioned medium reduces liver injury and enhances regeneration in reduced-size rat liver transplantation. J Surg Res. 2013;183(2):907-915.
51. Chen L, Zhang J, Yang L, Zhang G, Wang Y, Zhang S. The effects of conditioned medium derived from mesenchymal stem cells cocultured with hepatocytes on damaged hepatocytes and acute liver failure in rats. Stem Cells Int. 2018;2018:9156560.
52. Xagorari A, Siotou E, Yiangou M, et al. Protective effect of mesenchymal stem cell-conditioned medium on hepatic cell apoptosis after acute liver injury. Int J Clin Exp Pathol. 2013;6(5):831-840.
53. Lopez-Berestein G, Kasi L, Rosenblum MG, et al. Clinical pharmacology of 99mTc-labeled liposomes in patients with cancer. Cancer Res. 1984;44(1):375-378.
54. Rank A, Nieuwland R, Crispin A, et al. Clearance of platelet microparticles in vivo. Platelets. 2011;22(2):111-116.
55. Liu D, Mori A, Huang L. Role of liposome size and RES blockade in controlling biodistribution and tumor uptake of GM1-containing liposomes. Biochim Biophys Acta. 1992;1104(1):95-101. 56. Ostro MJ, Cullis PR. Use of liposomes as injectable-drug delivery systems. Am J Hosp Pharm.
1989;46(8):1576-1587.
57. Senior JH. Fate and behavior of liposomes in vivo: A review of controlling factors. Crit Rev
Ther Drug Carrier Syst. 1987;3(2):123-193.
58. Woodle MC, Lasic DD. Sterically stabilized liposomes. Biochim Biophys Acta. 1992;1113(2):171-199.
59. Wiklander OP, Nordin JZ, O’Loughlin A, et al. Extracellular vesicle in vivo biodistribution is determined by cell source, route of administration and targeting. J Extracell Vesicles. 2015;4:26316.
60. Yang D, Yuan Q, Balakrishnan A, et al. MicroRNA-125b-5p mimic inhibits acute liver failure.
Nat Commun. 2016;7:11916.
61. An F, Gong B, Wang H, et al. miR-15b and miR-16 regulate TNF mediated hepatocyte apoptosis via BCL2 in acute liver failure. Apoptosis. 2012;17(7):702-716.
62. Lang A, Grether-Beck S, Singh M, et al. MicroRNA-15b regulates mitochondrial ROS production and the senescence-associated secretory phenotype through sirtuin 4/SIRT4.
Aging (Albany NY). 2016;8(3):484-505.
63. Poisson J, Lemoinne S, Boulanger C, et al. Liver sinusoidal endothelial cells: Physiology and role in liver diseases. J Hepatol. 2017;66(1):212-227.
64. Wisse E. An electron microscopic study of the fenestrated endothelial lining of rat liver sinusoids. J Ultrastruct Res. 1970;31(1):125-150.
4
SUPPLEMENTARY TABLES
Supplementary Table 1. Mouse primers and probes used for real-time quantitative PCR analysis (TaqMan protocol)
Gene Primer sequence (5’-3’) Probe sequence (5’-3’)
18S For: CGGCTACCACATCCAAGGA Rev: CCAATTACAGGGCCTCGAAA
CGCGCAAATTACCCACTCCCGA
Nos2 For: CTATCTCCATTCTACTACTACCAGATCGA Rev: CCTGGGCCTCAGCTTCTCAT
CCC TGG AAG ACC CAC ATC TGG CAG
Tnfα For: GTAGCCCACGTCGTAGCAAAC Rev: AGTTGGTTGTCTTTGAGATCCATG
CGCTGGCTCAGCCACTCCAGC
Col1a1 For: TGGTGAACGTGGTGTACAAGGT
Rev: CAGTATCACCCTTGGCACCAT
TCCTGCTGGTCCCCGAGGAAACA
Supplementary table 2. Mouse primers used for real-time quantitative PCR analysis (CYBR Green protocol)
Gene Primer sequence (5’-3’)
Pai1 For: GCCAGATTTATCATCAATGACTGGG Rev: GGAGAGGTGCACATCTTTCTCAAAG
18S For: GTAACCCGTTGAACCCCATT Rev: CCATCCAATCGGTAGTAGCG
