Decoding therapeutic roles of adipose tissue-derived stromal cells and their extracellular
vesicles in liver disease
Afsharzadeh, Danial
DOI:10.33612/diss.121499227
IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below.
Document Version
Publisher's PDF, also known as Version of record
Publication date: 2020
Link to publication in University of Groningen/UMCG research database
Citation for published version (APA):
Afsharzadeh, D. (2020). Decoding therapeutic roles of adipose tissue-derived stromal cells and their extracellular vesicles in liver disease. University of Groningen. https://doi.org/10.33612/diss.121499227
Copyright
Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).
Take-down policy
If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.
Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum.
CHAPTER
5
Extracellular vesicles
from adipose
tissue-derived stromal cells
reverse Western
diet-induced steatosis in mice
Danial Afsharzadeh1 Svenja Sydor2 Ali Canbay2 Lars P. Bechmann2 Martin C. Harmsen3 Klaas Nico Faber1,4Departments of 1Hepatology and Gastroenterology, 3Pathology and Medical Biology, and 4Laboratory Medicine, Center for Liver, Digestive and Metabolic Disease, University of Groningen, University Medical Center Groningen, Groningen, The Netherlands. 2Department of Gastroenterology, Hepatology and Infectious Diseases, Otto von Guericke University Magdeburg, Magdeburg, Germany.
ABSTRACT
Background & Aim: Non-alcoholic fatty liver disease (NAFLD) is characterized
by accumulation of triglycerides in hepatocytes and includes a spectrum of pathophysiological states from simple steatosis to non-alcoholic steatohepatitis (NASH) that may progress to end-stage cirrhosis. Human adipose-derived stromal cells (hASC) are able to reverse NASH and associated fibrosis, but the underlying mechanisms remain unknown. Here, we investigate the therapeutic potential of hASC-derived extracellular vesicles (EVs) to reverse early stages of NAFLD, e.g. simple steatosis.
Methods: Mice were fed control chow or a Western diet (WD) for 6 weeks and
treated (i.v.) with hASC-derived EVs in the final 3 weeks. Mouse livers were subjected to histochemical staining, and triglyceride and cholesterol measurements and assessed for markers of fat metabolism, inflammation and fibrosis. Serum was assessed for markers of liver damage, as well as for triglyceride and cholesterol levels.
Results: WD-feeding increased body and liver weight and caused hepatic lipid
accumulation when compared to chow-fed mice. Administration of hASC-derived EVs to WD-fed mice reduced the liver weight and hepatic fat accumulation, but did not alter body weight. Serum levels of ALT and AST were not changed in WD-fed mice nor did the administration of EVs. WD-feeding elevated hepatic and serum triglyceride and cholesterol. Administration of EVs reversed only the increased levels of hepatic triglycerides. Neither WD-feeding nor administration of EVs induced hepatic inflammation (expression of Tnfα, Itgam and Ccl2) and markers of hepatic fibrosis (Col1a1 and Acta2). WD-feeding increased the hepatic expression of Fabp-1 and administration of EVs normalized its level to that observed in chow-fed control mice.
Conclusion: hASC-derived EVs reverse murine hepatic steatosis in mice and are
5
5.1. INTRODUCTION
Non-alcoholic fatty liver disease (NAFLD) is a major cause of chronic liver injury that affects more than twenty percent of the general population worldwide. The prevalence of NAFLD increases and coincides with the rise in obesity and diabetes1-3. The underlying pathogenesis of NAFLD remains to
be fully elucidated. Current dogma dictates the ‘two-hit hypothesis’ to explain pathological changes in NAFLD4. The ‘first hit’ is the disruption of the normal
equilibrium in hepatocyte lipid metabolism, which results in accumulation of fat in the liver (steatosis). The ‘second hit’ comprises oxidative stress, mitochondrial dysfunction and inflammation, which aggravates the existing steatosis and leads to non‑alcoholic steatotic hepatitis (NASH)2,5. NASH features hepatocyte
apoptosis and activation of a fibrotic process that poses an increased risk for the development of hepatocellular carcinoma (HCC)6. To date, liver transplantation
is the only option to treat end-stage NASH. Hence, the therapeutic strategies that target specific pathways in the pathogenesis of steatosis/NASH are in urgent demand. Administration of mesenchymal stem / stromal cells (MSC) in animal models of NAFLD has been shown to prevent and even (partially) reverse NAFLD progression7-10. These findings warrant further exploration of MSC therapy to
treat NAFLD. So far, MSC therapy has been studied only in severe mouse models of NAFLD, were it was shown to suppress hepatic inflammation as well as fibrosis. A possible direct effect on the development of the early stages of NAFLD, e.g. simple steatosis, has not been specifically studied yet.
Adipose tissue-derived stromal cells (ASC)11 are considered to be an attractive
and practical source for MSC-based therapy, because of their high abundance in easily-obtained fat tissue as compared to other tissue-specific MSC. hASC
are shown to reverse NAFLD by improving liver function and promoting lipid metabolism in mouse models of NAFLD12,13. MSC can differentiate into
hepatocytes in vitro14, but it remains unclear whether this is also a contributing
factor to improve liver function in vivo15,16. In fact, engraftment of administrated
MSC in injured livers is questioned17-19 and it seems more likely that MSC act in
a paracrine fashion rather than by differentiation to parenchymal cells20-25. Still,
little is known about such paracrine signaling mechanisms of MSC in NAFLD. In general, paracrine signaling is conveyed by soluble factors, such as growth factors, chemo/cytokines and hormones. Another relevant component of paracrine factors is comprised by extracellular vesicles (EVs)26. These are membrane-bound
vesicles that are released by virtually all cell types, including MSC27. EVs appear to
target specific cells and may modify their phenotype subsequently by delivering their cargo. This cargo consists of (regulatory) RNAs, including microRNAs,
and proteins such as growth factors26,28. EVs modulate cellular processes, such as
transcription, post transcriptional events and signal transduction in target cells on top of the canonical a(nta)gonists of signaling pathways29-35. Here, our aimed to
assess the therapeutic potential of hASC-derived EVs in a mouse model of simple steatosis, complementary to earlier studies that established their therapeutic value in advanced chronic liver disease and in acute liver failure (Chapter 3 and 4 and additional refs).
5.2. MATERIAL AND METHODS
5.2.1. Human Adipose tissue–derived Stromal Cell (hASC) isolation and culture
Human subcutaneous adipose tissue was obtained under informed consent from healthy donors with a BMI below 30 undergoing liposuction surgery (Bergman Clinics, The Netherlands). Adipose tissue was stored at 4°C and processed within 24 h post-surgery. hASC were isolated as described36 and seeded in culture flasks
at 4x104 /cm2, expanded by passing three times and used for experiments. All
experiments were performed using a pool of hASC from three donors. The use of adipose tissue as the source of hASC was approved by the local Ethics Committee of University Medical Center Groningen, given the fact that it was considered the use of anonymized waste material.
5.2.2. Isolation and identification of hASC-derived extracellular vesicles (EVs)
hASC-derived extracellular vesicles (EVs) were isolated by differential centrifugation37. Briefly, serum-free conditioned medium of 24 h hASC cultures
(hASC-CM) was centrifuged at 10,000 xg for 20 min to remove apoptotic bodies. The supernatant was collected and subjected to 100,000 xg for 60 min (optimal-XPN; Beckman Coulter). The EV-enriched pellet was washed in PBS and subjected to an additional round of ultracentrifugation at 100,000 xg for 60 min. EVs were resuspended in PBS and stored at -80°CQuantity and size distribution of EVs was confirmed using a nanoparticle tracking analyzer, NTA, (NanoSight NS500, Malvern, Worcestershire, UK), as described in chapter 3.
5.2.3. Mouse model of steatosis and injection of hASC-derived EVs
All mice (C57Bl/6) were inbred and housed in the animal facility of the Otto von Guericke University Magdeburg, Germany, according to the recommendations of the Federation of European Laboratory Animal Science Association (FELASA).
5
All procedures were approved by the Landesamt für Natur, Umwelt undVerbraucherschutz Nordrhein-Westfalen (LANUV NRW). Four- to six-week-old mice were fed either with a standard chow diet (SD) or with a western diet (WD) (TD.88137, Harlan; Madison WI, USA) ad libitum for 6 weeks. hASC-derived EVs (4 x 108) were resuspended in 100 µl PBS and injected intravenously once
per week during the last three weeks of the experiment (SD+EVs and WD+EVs, groups) (n=8), as described in chapter 3). Vehicle groups were administrated 100 µl PBS intravenously once per week during the last three weeks of the experiment (SD+Vehicle resp. WD+Vehicle groups) (n=8). At the end of the experiment, blood samples were taken, allowed to coagulate at room temperature, and the serum was stored at -80°C for the further analysis. Liver samples were fixed in 4.5% formalin, paraffin-embedded and sectioned or were snap-frozen in liquid nitrogen and stored at -80°C for the further analysis.
5.2.4. RNA isolation and qPCR
RNA was isolated using TRI reagent (Sigma-Aldrich) according to the manufacturer’s instructions. Reverse transcription was performed on 2.5 µg total RNA using random nanomers (Sigma-Aldrich) in a final volume of 50 µl. Semi-quantitative PCR (qPCR) was performed on the 7900HT Fast Real-TimePCR system (Applied Biosystems Europe, The Netherlands) using the TaqMan or SYBR Green protocol38. Gene expression levels were normalized to 18S levels
and further normalized to the mean expression level of the control group (∆∆CT method). qPCR primers and probes are shown in Supplementary Tables S1 and S2.
5.2.5. Histopathological staining
Liver tissues were processed for paraffin embedding and were sectioned into 4-µm thick sections. The sections were stained with hematoxylin and eosin according to a standard protocol.
5.2.6. Cholesterol and triglyceride measurement
Liver lipids were extracted according to Bligh and Dyer39. Liver and plasma
cholesterol were assessed with an enzymatic method (Roche/Hitachi cat. No. 11876023, Roche Diagnostics GmbH, Mannheim, Germany) as described40.
Triglycerides were measured in liver and plasma samples using an enzymatic assay (Roche/Hitachi cat. No 11875540, Roche Diagnostics GmbH, Mannheim, Germany) as it was described40.
5.2.7. Serum assay
Serum aspartate transaminase (AST) and alanine aminotransferase (ALT) levels were measured with an automated biochemical analyzer (Cobas 6000 CE, Hitachi).
5.2.8. Statistical analysis
Data are expressed as average with standard deviation. Statistical analyses were performed using one-way ANOVA (with Tukey’s post-hoc test for individual experimental conditions). All tests were performed with GraphPad Prism (v. 5.0; GraphPad Software, La Jolla, CA, USA). Differences were considered significant at P < 0.05.
5.3. RESULTS
5.3.1. hASC-derived EVs prevent liver weight gain and hepatic injury in diet-induced steatosis in mice.
Mice were fed a high fat-high cholesterol diet (Western diet, WD) for 6 weeks to induce hepatic steatosis, as described earlier41. During the last three weeks,
treatment groups received weekly i.v. injections of EVs. Both body weight and liver weight had increased in the WD-fed mice (Figure 1A, B), which was associated with hepatic lipid accumulation and hepatocyte swelling (Figure
1C-b), compared to control-fed mice (Figure 1C-a). Serum levels of ALT and AST
were not different in WD-fed mice (Figure 1D, E) when compared to control-fed animals. Body and liver weight of mice on WD and receiving hASC-derived EVs were not significantly different from chow-fed mice (Figure 1A, B). EV-treatment reduced hepatic steatosis in mice on a WD, as determined by H&E staining (Figure 1C-c).
5.3.2. hASC-derived EVs reduce hepatic triglyceride levels.
Hepatic triglyeride and cholesterol levels were increased in WD mice compared to chow-fed mice (Figure 2A, B). EV-treatment of WD-fed mice led to a significant reduction in hepatic triglyceride levels (Figure 2A), while it did not lower cholesterol levels in the liver (Figure 2B). Serum triglyceride levels were also elevated in WD-fed mice, but EV-treatment did not affect these levels (Figure
2C). Serum cholesterol was not affected by WD or EV treatment (Figure 2D).
Mice on a chow diet receiving hASC-derived EVs had similar triglyceride and cholesterol levels in the liver and serum as sham-treated controls (Figure 2A-D).
5
5.3.3. hASC-derived EVs modulate hepatic gene expression in WD-fed mice.
Feeding mice a WD for 6 weeks doubled the hepatic expression of Fabp-1 (Figure 3A) compared to control-fed mice, as reported earlier41. Expression of
Figure 1. hASC-derived EVs prevent liver weight gain and hepatic injury in diet-induced steatosis in mice. (A) Body wight, and (B) liver weight of mice. (C) Hematoxylin
and eosin staining of liver sections in mice; (a) SD+Vehicle (-1); (b) WD+Vehicle (-1); (c) WD+ EVs; (d) SD+ EVs. (D) Serum levels of alanine aminotransferase (ALT), and (E) serum levels of aspartate aminotransferase (AST). Data shows mean value ± SD. *p ≤0.05, **p ≤0.01, ***p ≤0.001, ANOVA (with Tukey’s post-hoc test for individual experimental conditions).
A B
C
Cd36 and Pparα had not changed (Figure 3B, C). The 3-week EV-treatment in
the final 6 weeks of the WD reduced expression Fabp-1 to controls (Figure 3A), accompanied by similar trends for Cd36 and Pparα (Figure 3B, C). EV-treatment did not affect expression of those genes in control-fed mice (Figure 3A-C). Expression of markers of hepatic inflammation, like Tnfα, Itgam and Ccl2 (Figure
4A-C) and fibrosis (Figure 5A-B), were not elevated in WD-fed mice confirming
a NAFLD status of mild steatosis preceding NASH. EV-treatment did not affect hepatic expression of these marker genes in WD-fed mice, nor in control-fed mice (Figure 4A-C) and (Figure 5A-B).
Collectively, our data show that hASC-derived EVs ameliorate hepatic triglyceride accumulation in diet-induced hepatic steatosis in mice, without potential risk for enhanced hepatic inflammation.
Figure 2. hASC-derived EVs reduce hepatic triglyceride levels. Hepatic levels of (A)
triglyceride, and (B) cholesterol. Serum levels of (C) triglyceride, and (D) cholesterol. Data shows mean value ± SD. *p ≤0.05, **p ≤0.01, ***p ≤0.001, ANOVA (with Tukey’s post-hoc test for individual experimental conditions).
A B
5
5.4. DISCUSSION
In this study, we show that hASC-derived EVs suppress Western diet-induced steatosis in mice, even before it progresses to non-alcoholic steatohepatitis (NASH). Three weekly treatments with hASC-derived EVs reversed liver weight gain and hepatic triglyceride accumulation induced by the Western diet, and suppressed hepatic Fabp-1 mRNA levels, a key factor in fatty acid metabolism in the liver. The Western diet nor the EV-treatment enhanced the expression of markers of inflammation nor those of fibrosis, indicating that hASC-derived EVs show therapeutic effects already in early stages of NAFLD.
MSC-based therapies have shown promising results in preclinical models of liver disease, both in acute liver injury42 as well as in chronic liver disease43 MSC
were shown to have potent anti-inflammatory and anti-fibrotic properties, while
Figure 4. Western diet feeding for 6 weeks does not induce hepatic inflammation in mice. Hepatic expression of (A) Itgam; (B) Ccl2 and (C) Tnfα. Data shows mean value ±
SD. *p ≤0.05, **p ≤0.01, ***p ≤0.001, ANOVA (with Tukey’s post-hoc test for individual experimental conditions).
Figure 3. hASC-derived EVs enhances the fatty acid trafficking in the liver of steatosis-induced mice. Hepatic expression of (A) Fabp1; (B) Cd36; (C) Pparα. Data shows mean
value ± SD. *p ≤0.05, **p ≤0.01, ***p ≤0.001, ANOVA (with Tukey’s post-hoc test for individual experimental conditions).
promoting liver regeneration44,45. Part of these therapeutic effects have already
been ascribed to extracellular vesicles (EVs) secreted by MSC. With respect to NAFLD, multiple studies have already shown that MSC therapy suppresses inflammation and fibrosis in animal models of NASH7,9,46. MSC from different
sources, including bone marrow7,10, compact bone47 and adipose tissue46,48 have
been applied in different NAFLD models such as methionine-choline deficient10,47
but mostly in long-term high-fat diet9,10,48-50, Although hepatic lipid accumulation
was affected in most of these studies, it remains unclear whether this is a primary effect of MSCs or secondary to their anti-inflammatory and anti-fibrotic actions. Also, the putative role of MSC-derived EVs in regulating lipid metabolism in NAFLD was not established before. Our study using a pure simple steatosis model of NAFLD shows that hASC-derived EVs directly regulate hepatic triglyceride metabolism and suppresses diet-induced liver weight gain and hepatic steatosis independent of the co-existence of inflammation and/or fibrosis.
The hASC-derived EVs were injected via the peripheral circulation, but still the therapeutic effects were observed in the liver. The biodistribution in vivo of EVs is similar to that of synthetic membranous nanoparticles, i.e. liposomes, as they are similar in size and structure of the lipophilic outer layer51-54. . Liposomes injected
i.v. accumulate predominantly in the liver and spleen rather than other organs55,56.
Given the fact that hepatic fat accumulation was clearly affected, we suggest that also the hASC-derived EVs end up significantly in the liver. The question remains what liver cell types take up the hASC-derived EVs. Earlier studies have shown that MSC-derived EVs target stellate cells57 and hepatocytes27 Our earlier studies
indeed also revealed that hASC-derived EVs strongly affect hepatic stellate cells,
Figure 5. Western diet feeding for 6 weeks does not induce hepatic fibrosis in mice.
Hepatic expression of (A) Col1a1 and (B) Acta2. Data shows mean value ± SD. *p ≤0.05, **p ≤0.01, ***p ≤0.001, ANOVA (with Tukey’s post-hoc test for individual experimental conditions).
5
portal myofibroblasts and hepatocytes (Chapter 3 and 4). Our previousmiRNA-seq analysis (Chapter 3) showed that hASC-derived EVs contain more than 1,000 different miRNAs of which only 27 constitute to at least 0.5% of the total. Among those, miR-103, miR-107, mir-150, mir-221 and mir-222 are involved in regulation of fatty acid metabolism. miR-107 orchestrates lipid accumulation by post-transcriptional regulation of fatty acid synthase in hepatocytes58 and others
have reported miR-103 as a regulator of adipogenesis59. miR-150 regulates hepatic
steatosis and insulin resistance in NAFLD via targeting of apoptosis regulators60.
Targeting hepatic miR-221 /222 for the therapeutic intervention of NAFLD in mice showed that these two miRNAs are pivotal in the progression of NASH61.
The specific set of abundant microRNAs in hASC-derived EV-contained might therefore target several pathways that are involved in the development of NAFLD and may comprise an alternative future off-the-shelf therapy to treat patients with NAFLD.
REFERENCES
1. Vuppalanchi R, Chalasani N. Nonalcoholic fatty liver disease and nonalcoholic steatohepatitis: Selected practical issues in their evaluation and management. Hepatology. 2009;49(1):306-317. 2. Ibrahim MA, Kelleni M, Geddawy A. Nonalcoholic fatty liver disease: Current and potential
therapies. Life Sci. 2013;92(2):114-118.
3. de Alwis NM, Day CP. Non-alcoholic fatty liver disease: The mist gradually clears. J Hepatol. 2008;48 Suppl 1:S104-12.
4. Henao-Mejia J, Elinav E, Jin C, et al. Inflammasome-mediated dysbiosis regulates progression of NAFLD and obesity. Nature. 2012;482(7384):179-185.
5. Shaker M, Tabbaa A, Albeldawi M, Alkhouri N. Liver transplantation for nonalcoholic fatty liver disease: New challenges and new opportunities. World J Gastroenterol. 2014;20(18):5320-5330.
6. Baffy G. Hepatocellular carcinoma in non-alcoholic fatty liver disease: Epidemiology, pathogenesis, and prevention. J Clin Transl Hepatol. 2013;1(2):131-137.
7. Winkler S, Christ B. Treatment of NASH with human mesenchymal stem cells in the immunodeficient mouse. Methods Mol Biol. 2014;1213:51-56.
8. Seki A, Sakai Y, Komura T, et al. Adipose tissue-derived stem cells as a regenerative therapy for a mouse steatohepatitis-induced cirrhosis model. Hepatology. 2013;58(3):1133-1142.
9. Ezquer M, Ezquer F, Ricca M, Allers C, Conget P. Intravenous administration of multipotent stromal cells prevents the onset of non-alcoholic steatohepatitis in obese mice with metabolic syndrome. J Hepatol. 2011;55(5):1112-1120.
10. Pelz S, Stock P, Bruckner S, Christ B. A methionine-choline-deficient diet elicits NASH in the immunodeficient mouse featuring a model for hepatic cell transplantation. Exp Cell Res. 2012;318(3):276-287.
11. Tsuji W, Rubin JP, Marra KG. Adipose-derived stem cells: Implications in tissue regeneration.
World J Stem Cells. 2014;6(3):312-321.
12. Liao N, Pan F, Wang Y, et al. Adipose tissue-derived stem cells promote the reversion of non-alcoholic fatty liver disease: An in vivo study. Int J Mol Med. 2016;37(5):1389-1396.
13. Seki A, Sakai Y, Komura T, et al. Adipose tissue-derived stem cells as a regenerative therapy for a mouse steatohepatitis-induced cirrhosis model. Hepatology. 2013;58(3):1133-1142.
14. Lee KD, Kuo TK, Whang-Peng J, et al. In vitro hepatic differentiation of human mesenchymal stem cells. Hepatology. 2004;40(6):1275-1284.
15. Meier RP, Muller YD, Morel P, Gonelle-Gispert C, Buhler LH. Transplantation of mesenchymal stem cells for the treatment of liver diseases, is there enough evidence? Stem Cell Res. 2013;11(3):1348-1364.
16. Puglisi MA, Tesori V, Lattanzi W, et al. Therapeutic implications of mesenchymal stem cells in liver injury. J Biomed Biotechnol. 2011;2011:860578.
17. Chang YS, Choi SJ, Sung DK, et al. Intratracheal transplantation of human umbilical cord blood-derived mesenchymal stem cells dose-dependently attenuates hyperoxia-induced lung injury in neonatal rats. Cell Transplant. 2011;20(11-12):1843-1854.
18. Ahn SY, Chang YS, Sung DK, et al. Mesenchymal stem cells prevent hydrocephalus after severe intraventricular hemorrhage. Stroke. 2013;44(2):497-504.
19. Togel F, Westenfelder C. Adult bone marrow-derived stem cells for organ regeneration and repair. Dev Dyn. 2007;236(12):3321-3331.
20. Vizoso FJ, Eiro N, Cid S, Schneider J, Perez-Fernandez R. Mesenchymal stem cell secretome: Toward cell-free therapeutic strategies in regenerative medicine. Int J Mol Sci. 2017;18(9):10.3390/ijms18091852.
5
21. Banas A, Teratani T, Yamamoto Y, et al. IFATS collection: In vivo therapeutic potential ofhuman adipose tissue mesenchymal stem cells after transplantation into mice with liver injury.
Stem Cells. 2008;26(10):2705-2712.
22. Togel F, Weiss K, Yang Y, Hu Z, Zhang P, Westenfelder C. Vasculotropic, paracrine actions of infused mesenchymal stem cells are important to the recovery from acute kidney injury. Am J
Physiol Renal Physiol. 2007;292(5):F1626-35.
23. Camussi G, Deregibus MC, Bruno S, Cantaluppi V, Biancone L. Exosomes/microvesicles as a mechanism of cell-to-cell communication. Kidney Int. 2010;78(9):838-848.
24. Kapur SK, Katz AJ. Review of the adipose derived stem cell secretome. Biochimie. 2013;95(12):2222-2228.
25. Gimble JM, Bunnell BA, Guilak F. Human adipose-derived cells: An update on the transition to clinical translation. Regen Med. 2012;7(2):225-235.
26. De Jong OG, Van Balkom BW, Schiffelers RM, Bouten CV, Verhaar MC. Extracellular vesicles: Potential roles in regenerative medicine. Front Immunol. 2014;5:608.
27. Keshtkar S, Azarpira N, Ghahremani MH. Mesenchymal stem cell-derived extracellular vesicles: Novel frontiers in regenerative medicine. Stem Cell Res Ther. 2018;9(1):63-018-0791-7.
28. Murphy DE, de Jong OG, Brouwer M, et al. Extracellular vesicle-based therapeutics: Natural versus engineered targeting and trafficking. Exp Mol Med. 2019;51(3):32-019-0223-5.
29. Hyun J, Wang S, Kim J, Kim GJ, Jung Y. MicroRNA125b-mediated hedgehog signaling influences liver regeneration by chorionic plate-derived mesenchymal stem cells. Sci Rep. 2015;5:14135.
30. Tetta C, Ghigo E, Silengo L, Deregibus MC, Camussi G. Extracellular vesicles as an emerging mechanism of cell-to-cell communication. Endocrine. 2013;44(1):11-19.
31. Lou G, Chen Z, Zheng M, Liu Y. Mesenchymal stem cell-derived exosomes as a new therapeutic strategy for liver diseases. Exp Mol Med. 2017;49(6):e346.
32. Haney MJ, Klyachko NL, Zhao Y, et al. Exosomes as drug delivery vehicles for parkinson’s disease therapy. J Control Release. 2015;207:18-30.
33. Sun D, Zhuang X, Xiang X, et al. A novel nanoparticle drug delivery system: The anti-inflammatory activity of curcumin is enhanced when encapsulated in exosomes. Mol Ther. 2010;18(9):1606-1614.
34. Li J, Ghazwani M, Zhang Y, et al. miR-122 regulates collagen production via targeting hepatic stellate cells and suppressing P4HA1 expression. J Hepatol. 2013;58(3):522-528.
35. Johnsen KB, Gudbergsson JM, Skov MN, Pilgaard L, Moos T, Duroux M. A comprehensive overview of exosomes as drug delivery vehicles - endogenous nanocarriers for targeted cancer therapy. Biochim Biophys Acta. 2014;1846(1):75-87.
36. Przybyt E, Krenning G, Brinker MG, Harmsen MC. Adipose stromal cells primed with hypoxia and inflammation enhance cardiomyocyte proliferation rate in vitro through STAT3 and Erk1/2. J Transl Med. 2013;11:39-5876-11-39.
37. Momen-Heravi F, Balaj L, Alian S, et al. Current methods for the isolation of extracellular vesicles. Biol Chem. 2013;394(10):1253-1262.
38. Shajari S, Laliena A, Heegsma J, Tunon MJ, Moshage H, Faber KN. Melatonin suppresses activation of hepatic stellate cells through RORalpha-mediated inhibition of 5-lipoxygenase. J
Pineal Res. 2015;59(3):391-401.
39. BLIGH EG, DYER WJ. A rapid method of total lipid extraction and purification. Can J Biochem
Physiol. 1959;37(8):911-917.
40. Triolo M, Annema W, de Boer JF, Tietge UJ, Dullaart RP. Simvastatin and bezafibrate increase cholesterol efflux in men with type 2 diabetes. Eur J Clin Invest. 2014;44(3):240-248.
41. Sydor S, Gu Y, Schlattjan M, et al. Steatosis does not impair liver regeneration after partial hepatectomy. Lab Invest. 2013;93(1):20-30.
42. Wang YH, Wu DB, Chen B, Chen EQ, Tang H. Progress in mesenchymal stem cell-based therapy for acute liver failure. Stem Cell Res Ther. 2018;9(1):227-018-0972-4.
43. Tsuchiya A, Takeuchi S, Watanabe T, et al. Mesenchymal stem cell therapies for liver cirrhosis: MSCs as “conducting cells” for improvement of liver fibrosis and regeneration. Inflamm Regen. 2019;39:18-019-0107-z. eCollection 2019.
44. Wang Y, Yu X, Chen E, Li L. Liver-derived human mesenchymal stem cells: A novel therapeutic source for liver diseases. Stem Cell Res Ther. 2016;7(1):71-016-0330-3.
45. Berardis S, Dwisthi Sattwika P, Najimi M, Sokal EM. Use of mesenchymal stem cells to treat liver fibrosis: Current situation and future prospects. World J Gastroenterol. 2015;21(3):742-758.
46. Seki A, Sakai Y, Komura T, et al. Adipose tissue-derived stem cells as a regenerative therapy for a mouse steatohepatitis-induced cirrhosis model. Hepatology. 2013;58(3):1133-1142.
47. Wang H, Wang D, Yang L, et al. Compact bone-derived mesenchymal stem cells attenuate nonalcoholic steatohepatitis in a mouse model by modulation of CD4 cells differentiation. Int
Immunopharmacol. 2017;42:67-73.
48. Shree N, Venkategowda S, Venkatranganna MV, Datta I, Bhonde RR. Human adipose tissue mesenchymal stem cells as a novel treatment modality for correcting obesity induced metabolic dysregulation. Int J Obes (Lond). 2019;43(10):2107-2118.
49. Ji AT, Chang YC, Fu YJ, Lee OK, Ho JH. Niche-dependent regulations of metabolic balance in high-fat diet-induced diabetic mice by mesenchymal stromal cells. Diabetes. 2015;64(3):926-936.
50. Lee CW, Hsiao WT, Lee OK. Mesenchymal stromal cell-based therapies reduce obesity and metabolic syndromes induced by a high-fat diet. Transl Res. 2017;182:61-74.e8.
51. Lopez-Berestein G, Kasi L, Rosenblum MG, et al. Clinical pharmacology of 99mTc-labeled liposomes in patients with cancer. Cancer Res. 1984;44(1):375-378.
52. Rank A, Nieuwland R, Crispin A, et al. Clearance of platelet microparticles in vivo. Platelets. 2011;22(2):111-116.
53. Liu D, Mori A, Huang L. Role of liposome size and RES blockade in controlling biodistribution and tumor uptake of GM1-containing liposomes. Biochim Biophys Acta. 1992;1104(1):95-101. 54. Ostro MJ, Cullis PR. Use of liposomes as injectable-drug delivery systems. Am J Hosp Pharm.
1989;46(8):1576-1587.
55. Senior JH. Fate and behavior of liposomes in vivo: A review of controlling factors. Crit Rev
Ther Drug Carrier Syst. 1987;3(2):123-193.
56. Woodle MC, Lasic DD. Sterically stabilized liposomes. Biochim Biophys Acta. 1992;1113(2):171-199.
57. Povero D, Pinatel EM, Leszczynska A, et al. Human induced pluripotent stem cell-derived extracellular vesicles reduce hepatic stellate cell activation and liver fibrosis. JCI Insight. 2019;5:10.1172/jci.insight.125652.
58. Bhatia H, Verma G, Datta M. miR-107 orchestrates ER stress induction and lipid accumulation by post-transcriptional regulation of fatty acid synthase in hepatocytes. Biochim Biophys Acta. 2014;1839(4):334-343.
59. Peng Y, Xiang H, Chen C, et al. MiR-224 impairs adipocyte early differentiation and regulates fatty acid metabolism. Int J Biochem Cell Biol. 2013;45(8):1585-1593.
60. Zhuge B, Li G. MiR-150 deficiency ameliorated hepatosteatosis and insulin resistance in nonalcoholic fatty liver disease via targeting CASP8 and FADD-like apoptosis regulator.
Biochem Biophys Res Commun. 2017;494(3-4):687-692.
61. Jiang X, Jiang L, Shan A, et al. Targeting hepatic miR-221/222 for therapeutic intervention of nonalcoholic steatohepatitis in mice. EBioMedicine. 2018;37:307-321.
5
Supplementary Table S1. Mouse primers and probes used for real-time quantitative PCR analysis (TaqMan protocol)
Gene Primer sequence (5’-3’) Probe sequence (5’-3’) 18S For: CGGCTACCACATCCAAGGA
Rev: CCAATTACAGGGCCTCGAAA
CGCGCAAATTACCCACTCCCGA Tnfα For: GTAGCCCACGTCGTAGCAAAC
Rev: AGTTGGTTGTCTTTGAGATCCATG CGCTGGCTCAGCCACTCCAGC Col1a1 For: TGGTGAACGTGGTGTACAAGGT
Rev: CAGTATCACCCTTGGCACCAT TCCTGCTGGTCCCCGAGGAAACA Acta2 For: TTCGTGTGGCCCCTGAAG
Rev: GGACAGCACAGCCTGAATAGC
TTGAGACCTTCAATGTCCCCGCCA Fabp-1 For: CGGAAATCGTGCAGAATGG
Rev: CCGTGAATTCGTTTTGGATCA
AGCACTTCAAGTTCACCATCACCGCTG Cd36 For: GATCGGAACTGTGGGCTCAT
Rev: GGTTCCTTCTTCAAGGACAACTTC
AGAATGCCTCCAAACACAGCCAGGAC Itgam For: TCAGGGCCTTGTTCCTTTAAGTC
Rev: GTGTCCAGATTGAAGCCATGAC AGCTCTTCTGGTCACAGCCCTAGCCTTG Ccl2 For: GGCTCAGCCAGATGCAGTTAA
Rev: AGCCTACTC ATTGGGATCATCTT CCCCACTCACCTGCTGCTACTCATTCA Pparα For: TATTCGGCTGAAGCTGGTGTAC
Rev: CTGGCATTTGTTCCGGTTCT
CTGAATCTTGCAGCTCCGATCACACTTG
