University of Groningen Decoding therapeutic roles of adipose tissue-derived stromal cells and their extracellular vesicles in liver disease Afsharzadeh, Danial

(1)

University of Groningen

Decoding therapeutic roles of adipose tissue-derived stromal cells and their extracellular

vesicles in liver disease

Afsharzadeh, Danial

DOI:

10.33612/diss.121499227

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below.

Document Version

Publisher's PDF, also known as Version of record

Publication date: 2020

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA):

Afsharzadeh, D. (2020). Decoding therapeutic roles of adipose tissue-derived stromal cells and their extracellular vesicles in liver disease. University of Groningen. https://doi.org/10.33612/diss.121499227

Copyright

Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

Take-down policy

If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum.

(2)

Decoding therapeutic roles of adipose

tissue-derived stromal cells and their

(3)

The research described in this thesis was conducted at department of gastroenterology and hepatology, University Medical Center Groningen, The Netherlands, and department of gastroenterology, hepatology and infectiology, Otto von Guericke University Magdeburg, Germany. The studies in this research were financially supported by the Graduate School of Medical Sciences (GSMS) and European Association for the Study of the Liver (EASL). Printing of this thesis was financially supported by the university of Groningen, GSMS and Nederlandse Vereniging voor Hepatologie (NVH).

All rights reserved. No part of this book may be reproduced, sorted in a retrieval system, or transmitted in any form or by any means without written permission of the auther and the publisher holding the copyright of the published articles.

ISBN: 978-94-034-2535-1

Cover design: Danial Afsharzadeh, Hannah Steffen Layout design: Mirjam Lohuis

(4)

Decoding therapeutic roles of adipose tissue-derived stromal

cells and their extracellular vesicles in liver disease

PhD thesis

to obtain the degree of PhD at the University of Groningen

on the authority of the

Rector Magnificus Prof. C. Wijmenga and in accordance with

the decision by the College of Deans. This thesis will be defended in public on

Monday 6 April 2020 at 9:00 hours by

Danial Afsharzadeh

born on 21 January 1982

(5)

Supervisors

Prof. K.N. Faber

Prof. M.C. Harmsen

Prof. A. Canbay

Assessment committee

Prof. R. Bank

Prof. M. Arese

Prof. K. Bieback

Paranymphs

Svenja Sydor

Mirjam Lohuis

(6)

CHAPTER

1

Introduction and

aim of the thesis

Danial Afsharzadeh1 Martin C. Harmsen2 Klaas Nico Faber1,3

Departments of 1_{Hepatology and Gastroenterology,}2

Pathology and Medical Biology and 3_{Laboratory Medicine,}

Center for Liver, Digestive and Metabolic Disease, University of Groningen, University Medical Center Groningen Groningen, The Netherlands.

(9)

CHAPTER 1

1.1 INTRODUCTION

Liver disease is a significant health problem and accounts for over two million deaths per year worldwide1-4_{. In clinical practice, liver disease is divided into} acute and chronic forms, based on the (initial) presentation and persistence of liver injury. However, this classification is an oversimplification of the broad spectrum of the different types of liver diseases and chronic liver injury is, in part, the result of extended acute liver injury that has been continued over time5,6_{. Still,} chronic liver diseases are accompanied by additional pathological processes when compared to acute forms, which may require different therapeutic approaches. Acute liver damage is typically induced by viruses or toxins and is characterized by hepatocyte death that can lead to significant impairment of liver function and structure7_{. The mode of hepatocyte death can be either through necrosis,} apoptosis or mixed variants thereof, and is determined by the type of damage, etiology, duration and extent of liver injury. Acute liver injury can progress to acute liver failure (ALF), which is a critical condition with a mortality rate of more than 80%8_{. Drug intoxication is considered as the leading cause of ALF} and acetaminophen (APAP) overdose represents the most common cause of drug-induced ALF worldwide9_{. APAP-induced ALF may occur after taking a} large single oral dose of APAP (>7,500 mg) or after higher than recommended doses for several consecutive days9,10_{. Viral infection, with hepatitis A, B and} E, is another common cause of ALF. Autoimmune hepatitis, metabolic disease, non-viral infection and cancer are among less frequent causes of ALF9_{. Loss of} functional liver mass triggers the liver to regenerate, a remarkable feature of this organ. Patients may survive loss of over 50% of liver function and, if the cause of liver injury can be eradicated, the liver will regain to its original volume in several weeks. Thus, ALF only occurs when there is a misbalance between the disease-induced liver damage and the capacity of the liver to regenerate. The liver regeneration process comprises the proliferation of remaining healthy hepatocytes as well as activation, proliferation, differentiation and maturation of hepatic progenitor cells, thereby enabling restoration of the hepatic function and architecture11,12,12_{. Chronic liver injury is a result of continued hepatocyte injury} and death, which may slowly develop to liver failure over many years. Damaged hepatocytes release reactive oxygen species (ROS) and inflammatory mediators, such as TGF-β1, TNF-α, EGF and IGF that activate liver resident macrophages (Kupffer cells), recruit circulating macrophages and inflammatory T-cells. While this is a primary response to clear possible infections and initiate liver regeneration, persistent activation of these cells also leads to the activation of liver fibroblasts13_{, particularly hepatic stellate cells (HSC) and portal myofibroblasts} 8

(10)

1

Introduction and aim of the thesis

(PMF). In normal physiology, HSC are quiescent (qHSC) in the (healthy) liver, where these play a central role in controlling systemic vitamin A homeostasis. Upon liver injury, qHSC transdifferentiate to migratory and proliferative myofibroblasts (activated HSC; aHSC), a process in which the lose their vitamin A stores. The activated liver fibroblasts, both aHSC and PMF, produce and deposit extracellular matrix proteins (ECM), in particular collagen, fibronectin and laminin, in the liver, required for the healing of the damaged tissue. In a normal

Figure 1. Spectrum of non-alcoholic fatty liver disease (NAFLD). Non-alcoholic fatty

liver disease (NAFLD) is a spectrum of diseases ranging from fatty liver (simple steatosis), non-alcoholic steatohepatitis (NASH) and NASH-associated fibrosis and cirrhosis, which predisposes for the development of hepatocellular carcinoma.

(11)

CHAPTER 1

repair process, any excessive ECM is degraded by specific matrix metalloproteases (MMPs) and normal liver architecture is restored. However, persistent damage causes a misbalance in ECM production and turnover, because degradation is often insufficiently induced or even decreased. The excessive ECM deposition leads to formation of interstitial scar tissue, which is called fibrosis14_{. Over time,} fibrosis can spread throughout most of the liver, destroying the internal structure and impair liver regeneration and thereby reducing liver function. Such severe and irreversible scarring of the liver is called cirrhosis. Cirrhosis causes increased intrahepatic resistance to blood flow and portal hypertension, as well as hepatic insufficiency15_{. Advanced cirrhosis is a risk factor for developing hepatocellular} carcinoma16_{and most of the morbidity and mortality related to liver disease occur} after cirrhosis develops17_.

In a global perspective, non-alcoholic fatty liver disease (NAFLD) is the most common chronic liver disease affecting approximately 25% of the world population, in particular in Westernized countries. As the name implies, NAFLD is characterized by excessive fat accumulation in the liver, especially triglycerides and cholesterol, without a clear relationship with alcohol intake. Obesity is the main trigger for NAFLD, which is actually a spectrum of liver diseases, ranging from simple steatosis, non-alcoholic steatohepatitis (NASH) to NASH-associated fibrosis and cirrhosis that predisposes for hepatic carcinogenesis. In this spectrum, NASH distinguishes from simple steatosis by the presence hepatic inflammation, which may co-exist with different stages (F0-F4) of fibrosis. Hepatocyte damage and inflammation play leading roles in disease progression, amongst others via activation of liver fibroblasts and the resultant fibrosis18_{. Even though only 20%} of patients with NAFLD also meet the criteria for NASH18,19_{, the latter condition} is being considered the major cause of liver fibrosis and cirrhosis in patients with chronic liver disease (see Figure 1).

Treatment options for patients with end-stage liver disease are still extremely limited, and liver transplantation remains as the only life-saving therapy20,21_. However, scarce availability of donor organs limit the number of patients who can benefit from this treatment. Moreover, liver transplantation remains a risky procedure, associated with high health care expenses, risks of complications related to the surgery, and the necessity for lifelong immunosuppression, which negatively impact the patient’s quality of life22_{. Thus, there is an evident need for} alternative therapeutic approaches for liver disease patients that otherwise can only be helped by liver transplantation. Therapies using mesenchymal stromal cells (MSC) have recently emerged as being one of the most promising options for patients with chronic liver disease, being a less aggressive procedure and potentially equally curative as liver transplantation23_{. MSC encompass a population} 10

(12)

1

of undifferentiated cells24_{that reside in virtually all tissues of the body, including} bone marrow25_{, umbilical cord}26_{and adipose tissue}27_{. As a common feature, MSC} are able to differentiate in vitro into cartilage, adipocytes and osteogenic cells. The yield of MSC isolated from different tissues varies considerably, between relatively low from bone marrow and high (around hundred million per liter) from fat tissue. The ease of obtaining subcutaneous adipose tissue by a minimally invasive method is a clear advantage of adipose tissue-derived mesenchymal stromal cells (ASC) over MSCs from other tissues29-31_{. Demonstration of clinical feasibility and}

Figure 2. Chemokine receptors in MSC. MSC chemokine receptors are represented in

blue. Chemokines able to stimulate MSC are beside their respective receptors (in green).

(13)

CHAPTER 1

therapeutic efficacy of MSC in the past two decades have opened doors for a large number of clinical trials applying MSC in a variety of common and life-threatening diseases, such as stroke32,33_{, heart failure}34_{, COPD}35_{and liver failure}36_{. Some trials} have indicated that the route of administration of MSC is a determining factor for their therapeutic efficacy37,38_{, but to date, no Gold Standard route of MSC delivery} has been established. Several studies proposed that systemic infusion of MSC is the preferred route of administration39-41_{, but improving tissue-specific homing of} MSC is still one of the major challenges in MSC-based therapies. Indeed, various imaging studies show that only a small percentage of intravenously administered MSC reach the target tissue42-44_{. A growing body of evidence ascribes this low} efficiency to the limited expression of homing molecules, i.e. chemokine receptors, during the in vitro expansion of MSC45,46_{. MSC are shown to be attracted to the} chemical gradient of chemokines which are being released at the site of injury47-49_. Chemokines are small secreted proteins ranging in size from 7 to 13 kDa. The arrangement of four amino terminal cysteines is used to group chemokines into structurally related families. Accordingly, four families of chemokines have been defined: the CCL family, the CXCL family, the CL family and the CX3CL family50_. Similarly, chemokine receptors are being categorized based on their interaction with specific chemokine families. Thus, CXCR receptors bind CXC chemokines, and CCR receptors bind CC chemokines. However, as there are fewer chemokine receptors than chemokines, a single chemokine receptor may bind several different chemokines, and a single chemokine also may bind more than one receptor47,50 (see Figure 2).

MSC administration has been shown to be beneficial to treat patients with end-stage liver disease in several studies, as evidenced by improved liver function, reduced hepatocyte apoptosis, enhanced hepatocyte proliferation, and most importantly, increased survival of patients with severe liver disease23,51,53,54_. Nevertheless, the clinical application of MSC holds multiple safety and ethical concerns that call for more in-depth investigation to define the factors that actually determine their therapeutic effect55,_{. A growing body of evidence indicates that} MSC-derived extracellular vesicles (EVs) are main carriers of the therapeutic factors and largely mirror the phenotype of their parent MSC56,57_{. Such} MSC-derived EVs could be the basis of a novel cell-free therapy for end-stage liver disease. EVs are released from a variety of cells (including MSC) and are classified into microvesicles (MVs), exosomes, and apoptotic bodies, according to various morphological (size and shape) and biochemical parameters58,59_. _{EVs contain} proteins, lipids and nucleic acids, which they can transport to specific tissues, as they can be captured by other cells via variety of ways, such as direct membrane 12

(14)

1

Figure 3. Mesenchymal stromal cell derived-extracellular vesicles (MSC-derived EVs) rescue the liver damage and ameliorate liver fibrosis. Chronic liver damage mediates by

progressive hepatocyte injury which spans for a long time. Damaged hepatocytes release reactive oxygen species (ROS) and inflammatory mediators, such as TGF-β1, TNF-α, EGF and IGF, inducing the recruitment of inflammatory cells and resulting in accumulation of activated liver fibroblast, particularly hepatic stellate cells (HSC) and portal myofibroblasts (PMF). Activated liver fibroblasts facilitate synthesizing large amounts of extracellular matrix proteins (ECM) which causes tissue fibrosis. MSC derived-EVs are able to rescue the liver damage and ameliorate liver fibrosis through alleviating hepatocyte damage and regression of activation in liver fibroblasts.

(15)

CHAPTER 1

fusion, receptor mediated fusion or endocytosis or a combination60-62_{. So far,} MSC‐derived EVs have shown multiple therapeutic effects, including in tissue regeneration, wound healing and immunomodulation63_{. Importantly, MSC‐} derived EVs have been shown to be less immunogenic and, compared to MSC, show a lower risk of allogenic immune rejection by the host63,64_{. Small non-coding} microRNA molecules (miRNAs, mostly 22 nucleotides long) have recently gained extra attention amongst EV-cargo, and a rapidly increasing number of reports attribute the therapeutic potential of MSC-derived EVs to miRNA transfer to affected cells of injured organs65-67_{. The therapeutic benefits of MSC-derived EVs} are being examined in a range of acute and chronic liver disease68,69_{. As it appears,} MSC-derived EVs are capable of alleviating hepatocyte damage and suppress the activation of liver fibroblasts (see Figure 3). Still, the therapeutic mechanisms of MSC-derived EVs are very much unexplored and need further investigation.

(16)

1 1.2. THE AIM AND OUTLINE OF THE THESIS

The overall aim of this thesis is to investigate the therapeutic potential of extracellular vesicles from human adipose-derived stromal cells (hASC-derived EVs) in the treatment of acute and chronic liver disease. In Chapter 2, we focused on the trafficking of hASC migration to injured and early-fibrotic liver tissue, ex vivo. We tested the migration potential of hASC to human precision-cut liver slices (PCLS). In order to distinguish the migratory signal in the fibrotic tissue, we analyzed the hASC migration towards hepatocytes, quiescent hepatic stellate cells (qHSC) and activated hepatic stellate cells (aHSC), separately. Moreover, using specific inhibitors of the chemokine receptors CXCR2, CXCR3 and CXCR4, we investigated the mechanisms controlling the migration of hASC to the fibrotic liver. In Chapter 3, we focused on the therapeutic capacity of hASC-derived EVs in liver fibrosis. Activation of hepatic fibroblasts is the hallmark for the onset of liver fibrosis. We first evaluated whether hASC suppress activation and proliferation of liver fibroblasts in a paracrine manner. As this was the case, we next evaluated the potential of hASC-derived EVs and EV-free conditioned medium to suppress activation and proliferation in liver fibroblasts in vitro, as well as in vivo mouse model of liver fibrosis and in a human ex vivo using human precision-cut liver slices. In addition, we analyzed the miRNA content of hASC-derived EVs with a focus on miRNAs with anti-fibrotic activities. In Chapter 4, we investigated the potential of hASC-derived EVs in alleviating acute liver damage in mice exposed to a single high dose of paracetamol (APAP) or CCl₄. Both the prophylactic and the therapeutic potential of hASC-derived EVs to prevent liver injury were evaluated. We analyzed liver histology and serum markers of liver damage, as well as markers of hepatic inflammation and early markers of fibrosis. In Chapter 5, we studied the potential of hASC-derived EVs to ameliorate simple steatosis in mice, being the first stage in the development of NAFLD. Mice were given a high fat-high cholesterol diet for 6 weeks and treated with hASC-derived EVs in the final 3 weeks. We evaluated body and liver weights of the mice and analyzed liver histology and serum markers of the liver damage. Moreover, we determined whether hASC-derived EVs affect Western-diet induced cholesterol and triglyceride levels in liver and in serum. Finally, transcript analysis was performed to reveal potential miRNAs involved in the hASC-EV-induced effects. In Chapter 6, we summarize the results obtained in the experimental studies of this thesis and provide an outlook for future directions of hASC-derived EV therapy for patients with liver disease.

(17)

CHAPTER 1

REFERENCES

1. Alejandra MR, Juan AB, Ana SR. Cell therapy for liver diseases: Current medicine and future promises. Expert Rev Gastroenterol Hepatol. 2015;9(6):837-850.

2. Wang FS, Fan JG, Zhang Z, Gao B, Wang HY. The global burden of liver disease: The major impact of china. Hepatology. 2014;60(6):2099-2108.

3. Mokdad AA, Lopez AD, Shahraz S, et al. Liver cirrhosis mortality in 187 countries between 1980 and 2010: A systematic analysis. BMC Med. 2014;12:145-014-0145-y.

4. Rowe IA. Lessons from epidemiology: The burden of liver disease. Dig Dis. 2017;35(4):304-309.

5. Zhang CY, Yuan WG, He P, Lei JH, Wang CX. Liver fibrosis and hepatic stellate cells: Etiology, pathological hallmarks and therapeutic targets. World J Gastroenterol. 2016;22(48):10512-10522.

6. Hernandez-Gea V, Friedman SL. Pathogenesis of liver fibrosis. Annu Rev Pathol. 2011;6:425-456.

7. Koch DG, Speiser JL, Durkalski V, et al. The natural history of severe acute liver injury. Am J

Gastroenterol. 2017;112(9):1389-1396.

8. Rovegno M, Vera M, Ruiz A, Benitez C. Current concepts in acute liver failure. Ann Hepatol. 2019;18(4):543-552.

9. Fontana RJ. Acute liver failure including acetaminophen overdose. Med Clin North Am. 2008;92(4):761-94, viii.

10. Bernal W. Acute liver failure: Review and update. Int Anesthesiol Clin. 2017;55(2):92-106. 11. Best J, Dolle L, Manka P, Coombes J, van Grunsven LA, Syn WK. Role of liver progenitors in

acute liver injury. Front Physiol. 2013;4:258.

12. Rutherford A, Chung RT. Acute liver failure: Mechanisms of hepatocyte injury and regeneration. Semin Liver Dis. 2008;28(2):167-174.

13. Canbay A, Friedman S, Gores GJ. Apoptosis: The nexus of liver injury and fibrosis. Hepatology. 2004;39(2):273-278.

14. Vinas O, Bataller R, Sancho-Bru P, et al. Human hepatic stellate cells show features of antigen-presenting cells and stimulate lymphocyte proliferation. Hepatology. 2003;38(4):919-929. 15. Gines P, Cardenas A, Arroyo V, Rodes J. Management of cirrhosis and ascites. N Engl J Med.

2004;350(16):1646-1654.

16. Berenguer M, Prieto M, Palau A, et al. Severe recurrent hepatitis C after liver retransplantation for hepatitis C virus-related graft cirrhosis. Liver Transpl. 2003;9(3):228-235.

17. Poynard T, Bedossa P, Opolon P. Natural history of liver fibrosis progression in patients with chronic hepatitis C. the OBSVIRC, METAVIR, CLINIVIR, and DOSVIRC groups. Lancet. 1997;349(9055):825-832.

18. Torres DM, Harrison SA. Nonalcoholic steatohepatitis and noncirrhotic hepatocellular carcinoma: Fertile soil. Semin Liver Dis. 2012;32(1):30-38.

19. Hashimoto E, Tokushige K, Ludwig J. Diagnosis and classification of non-alcoholic fatty liver disease and non-alcoholic steatohepatitis: Current concepts and remaining challenges. Hepatol

Res. 2015;45(1):20-28.

20. Bernal W, Wendon J. Acute liver failure. N Engl J Med. 2013;369(26):2525-2534.

21. Manns MP. Liver cirrhosis, transplantation and organ shortage. Dtsch Arztebl Int. 2013;110(6):83-84.

22. Souza BS, Nogueira RC, de Oliveira SA, et al. Current status of stem cell therapy for liver diseases. Cell Transplant. 2009;18(12):1261-1279.

23. Wu DB, Chen EQ, Tang H. Stem cell transplantation for the treatment of end-stage liver disease. World J Hepatol. 2018;10(12):907-910.

24. Roberts I. Mesenchymal stem cells. Vox Sang. 2004;87 Suppl 2:38-41.

(18)

1

25. Jiang Y, Jahagirdar BN, Reinhardt RL, et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature. 2002;418(6893):41-49.

26. Hass R, Kasper C, Bohm S, Jacobs R. Different populations and sources of human mesenchymal stem cells (MSC): A comparison of adult and neonatal tissue-derived MSC. Cell Commun

Signal. 2011;9:12-811X-9-12.

27. Zuk PA, Zhu M, Ashjian P, et al. Human adipose tissue is a source of multipotent stem cells.

Mol Biol Cell. 2002;13(12):4279-4295.

28. O’Donoghue K, Chan J. Human fetal mesenchymal stem cells. Curr Stem Cell Res Ther. 2006;1(3):371-386.

29. Jung WY, Kang JH, Kim KG, et al. Human adipose-derived stem cells attenuate inflammatory bowel disease in IL-10 knockout mice. Tissue Cell. 2015;47(1):86-93.

30. Haniffa MA, Wang XN, Holtick U, et al. Adult human fibroblasts are potent immunoregulatory cells and functionally equivalent to mesenchymal stem cells. J Immunol. 2007;179(3):1595-1604.

31. Liu WH, Song FQ, Ren LN, et al. The multiple functional roles of mesenchymal stem cells in participating in treating liver diseases. J Cell Mol Med. 2015;19(3):511-520.

32. Bang OY, Lee JS, Lee PH, Lee G. Autologous mesenchymal stem cell transplantation in stroke patients. Ann Neurol. 2005;57(6):874-882.

33. Kim SJ, Moon GJ, Chang WH, Kim YH, Bang OY, STARTING-2 (STem cell Application Researches and Trials In NeuroloGy-2) collaborators. Intravenous transplantation of mesenchymal stem cells preconditioned with early phase stroke serum: Current evidence and study protocol for a randomized trial. Trials. 2013;14:317-6215-14-317.

34. Bartunek J, Behfar A, Dolatabadi D, et al. Cardiopoietic stem cell therapy in heart failure: The C-CURE (cardiopoietic stem cell therapy in heart failURE) multicenter randomized trial with lineage-specified biologics. J Am Coll Cardiol 2013 Jun 11+ADs-61(23):2329-38 doi: 10 1016/j

jacc 2013 02 071 Epub. 2013;61(23):2329-2338.

35. Weiss DJ, Casaburi R, Flannery R, LeRoux-Williams M, Tashkin DP. A placebo-controlled, randomized trial of mesenchymal stem cells in COPD. Chest. 2013;143(6):1590-1598. 36. Shi M, Zhang Z, Xu R, et al. Human mesenchymal stem cell transfusion is safe and improves

liver function in acute-on-chronic liver failure patients. Stem Cells Transl Med. 2012;1(10):725-731.

37. Kurtz A. Mesenchymal stem cell delivery routes and fate. Int J Stem Cells. 2008;1(1):1-7. 38. Kanelidis AJ, Premer C, Lopez J, Balkan W, Hare JM. Route of delivery modulates the efficacy

of mesenchymal stem cell therapy for myocardial infarction: A meta-analysis of preclinical studies and clinical trials. Circ Res. 2017;120(7):1139-1150.

39. Ra JC, Shin IS, Kim SH, et al. Safety of intravenous infusion of human adipose tissue-derived mesenchymal stem cells in animals and humans. Stem Cells Dev. 2011;20(8):1297-1308. 40. Le Blanc K, Frassoni F, Ball L, et al. Mesenchymal stem cells for treatment of steroid-resistant,

severe, acute graft-versus-host disease: A phase II study. Lancet. 2008;371(9624):1579-1586. 41. Kim SU, de Vellis J. Stem cell-based cell therapy in neurological diseases: A review. J Neurosci

Res. 2009;87(10):2183-2200.

42. Devine SM, Cobbs C, Jennings M, Bartholomew A, Hoffman R. Mesenchymal stem cells distribute to a wide range of tissues following systemic infusion into nonhuman primates.

Blood. 2003;101(8):2999-3001.

43. Barbash IM, Chouraqui P, Baron J, et al. Systemic delivery of bone marrow-derived mesenchymal stem cells to the infarcted myocardium: Feasibility, cell migration, and body distribution. Circulation. 2003;108(7):863-868.

44. Kraitchman DL, Tatsumi M, Gilson WD, et al. Dynamic imaging of allogeneic mesenchymal stem cells trafficking to myocardial infarction. Circulation. 2005;112(10):1451-1461.

(19)

CHAPTER 1

45. Wang Y, Fu W, Zhang S, et al. CXCR-7 receptor promotes SDF-1alpha-induced migration of bone marrow mesenchymal stem cells in the transient cerebral ischemia/reperfusion rat hippocampus. Brain Res. 2014;1575:78-86.

46. Du Z, Wei C, Cheng K, et al. Mesenchymal stem cell-conditioned medium reduces liver injury and enhances regeneration in reduced-size rat liver transplantation. J Surg Res. 2013;183(2):907-915.

47. Hocking AM. The role of chemokines in mesenchymal stem cell homing to wounds. Adv

Wound Care (New Rochelle). 2015;4(11):623-630.

48. da Silva Meirelles L, Caplan AI, Nardi NB. In search of the in vivo identity of mesenchymal stem cells. Stem Cells. 2008;26(9):2287-2299.

49. Cornelissen AS, Maijenburg MW, Nolte MA, Voermans C. Organ-specific migration of mesenchymal stromal cells: Who, when, where and why? Immunol Lett. 2015;168(2):159-169. 50. Martins-Green M, Petreaca M, Wang L. Chemokines and their receptors are key players in the orchestra that regulates wound healing. Adv Wound Care (New Rochelle). 2013;2(7):327-347. 51. Shi M, Zhang Z, Xu R, et al. Human mesenchymal stem cell transfusion is safe and improves

liver function in acute-on-chronic liver failure patients. Stem Cells Transl Med. 2012;1(10):725-731.

52. Squillaro T, Peluso G, Galderisi U. Clinical trials with mesenchymal stem cells: An update. Cell

Transplant. 2016;25(5):829-848.

53. Chen B, Wang YH, Qian JQ, Wu DB, Chen EQ, Tang H. Human mesenchymal stem cells for hepatitis B virus-related acute-on-chronic liver failure: A systematic review with meta-analysis. Eur J Gastroenterol Hepatol. 2018;30(10):1224-1229.

54. Huang B, Cheng X, Wang H, et al. Mesenchymal stem cells and their secreted molecules predominantly ameliorate fulminant hepatic failure and chronic liver fibrosis in mice respectively. J Transl Med. 2016;14:45-016-0792-1.

55. Charo RA, Sipp D. Rejuvenating regenerative medicine regulation. N Engl J Med. 2018;378(6):504-505.

56. Gnecchi M, Danieli P, Malpasso G, Ciuffreda MC. Paracrine mechanisms of mesenchymal stem cells in tissue repair. Methods Mol Biol. 2016;1416:123-146.

57. Gnecchi M, He H, Liang OD, et al. Paracrine action accounts for marked protection of ischemic heart by akt-modified mesenchymal stem cells. Nat Med. 2005;11(4):367-368.

58. Phinney DG, Di Giuseppe M, Njah J, et al. Mesenchymal stem cells use extracellular vesicles to outsource mitophagy and shuttle microRNAs. Nat Commun. 2015;6:8472.

59. Wen D, Peng Y, Liu D, Weizmann Y, Mahato RI. Mesenchymal stem cell and derived exosome as small RNA carrier and immunomodulator to improve islet transplantation. J Control

Release. 2016;238:166-175.

60. Arslan F, Lai RC, Smeets MB, et al. Mesenchymal stem cell-derived exosomes increase ATP levels, decrease oxidative stress and activate PI3K/akt pathway to enhance myocardial viability and prevent adverse remodeling after myocardial ischemia/reperfusion injury. Stem Cell Res. 2013;10(3):301-312.

61. Lin KC, Yip HK, Shao PL, et al. Combination of adipose-derived mesenchymal stem cells (ADMSC) and ADMSC-derived exosomes for protecting kidney from acute ischemia-reperfusion injury. Int J Cardiol. 2016;216:173-185.

62. Kim DK, Nishida H, An SY, Shetty AK, Bartosh TJ, Prockop DJ. Chromatographically isolated CD63+CD81+ extracellular vesicles from mesenchymal stromal cells rescue cognitive impairments after TBI. Proc Natl Acad Sci U S A. 2016;113(1):170-175.

63. Baek G, Choi H, Kim Y, Lee HC, Choi C. Mesenchymal stem cell-derived extracellular vesicles as therapeutics and as a drug delivery platform. Stem Cells Transl Med. 2019;8(9):880-886. 64. Ankrum JA, Ong JF, Karp JM. Mesenchymal stem cells: Immune evasive, not immune

privileged. Nat Biotechnol. 2014;32(3):252-260.

(20)

1

65. Rani S, Ryan AE, Griffin MD, Ritter T. Mesenchymal stem cell-derived extracellular vesicles: Toward cell-free therapeutic applications. Mol Ther. 2015;23(5):812-823.

66. Sork H, Corso G, Krjutskov K, et al. Heterogeneity and interplay of the extracellular vesicle small RNA transcriptome and proteome. Sci Rep. 2018;8(1):10813-018-28485-9.

67. Bronisz A, Godlewski J, Chiocca EA. Extracellular vesicles and MicroRNAs: Their role in tumorigenicity and therapy for brain tumors. Cell Mol Neurobiol. 2016;36(3):361-376. 68. Li T, Yan Y, Wang B, et al. Exosomes derived from human umbilical cord mesenchymal stem

cells alleviate liver fibrosis. Stem Cells Dev. 2013;22(6):845-854.

69. Haga H, Yan IK, Takahashi K, Matsuda A, Patel T. Extracellular vesicles from bone marrow-derived mesenchymal stem cells improve survival from lethal hepatic failure in mice. Stem

Cells Transl Med. 2017;6(4):1262-1272.

(21)

(22)

CHAPTER

2

Adipose tissue-derived

stromal cells are

attracted to activated

hepatic stellate cells

through CXCR2- and

CXCR3-mediated

signaling

Danial Afsharzadeh1 Svenja Sydor2 Ali Saeed1 Ali Canbay2 Peter Olinga3 Lars P. Bechmann2 Martin C. Harmsen4 Klaas Nico Faber1,5

Departments of 1_{Hepatology and Gastroenterology,}

4_{Pathology and Medical Biology,}3_{Pharmaceutical}

Technology and Biopharmacy and 5_{Laboratory Medicine,}

Center for Liver, Digestive and Metabolic Disease, University of Groningen, University Medical Center

Groningen, Groningen, The Netherlands. 2_{Department of}

Gastroenterology, Hepatology and Infectious Diseases, Otto von Guericke University Magdeburg, Magdeburg, Germany.

(23)

CHAPTER 2

ABSTRACT

Background & Aim: Hepatic stellate cells (HSC) are the major driver of hepatic

fibrogenesis. Under physiological conditions, HSC are quiescent but these are activated by chronic injury. Activated HSC (aHSC) express higher levels of fibrogenic factors including chemoattractants. Experimental liver fibrosis in rodents is alleviated after systemic administration of mesenchymal stromal cells (MSC) yet the type and cellular origin of these hepatic chemoattractants are largely unknown. Here, we investigated hypothesized that activated HSC attract human adipose tissue-derived stromal cells (hASC) by secretion of chemokines.

Methods: hASC migration was monitored using the xCELLigence system and

precision-cut human and rat liver slices (PCLS). hASC were analyzed for the expression of CXCR2, CXCR3 and CXCR4, and the expression of respective ligands was compared between quiescent rat HSC (qrHSC) and activated rat HSC (arHSC). Potent and selective antagonists were used to block hASC-derived CXCR2, CXCR3 and CXCR4 and identify their role in migration.

Results: Human and rat PCLS strongly enhanced hASC migration. Rat

hepatocytes and qrHSC did not stimulate hASC migration while arHSC did. qrHSC highly expressed Cxcl12, while expression of Cxcl1 and Cxcl2 was low. In contrast, arHSC had upregulated expression of Cxcl1 and Cxcl2, while expression of Cxcl12 was low. In arHSC, expression of Cxcl9, Cxcl10 and Cxcl11 was low too. hASC expressed all three assessed chemokine receptors. Antagonists specific for CXCR2 and CXCR3, suppressed hASC migration towards arHSC while antagonizing CXCR4 did not influence hASC migration. Conditioned medium of arHSC promoted hASC migration to similar levels as co-culturing with arHSC. Blocking CXCR2 suppressed this migration while no effect was observed with the CXCR3 and CXCR4 antagonists.

Conclusion: Activation of HSC promotes hASC attraction to liver via CXCR2,

and identifies this as a pivotal receptor in MSC therapy of liver fibrosis.

(24)

2

Activation of HSC promotes hASC attraction

2.1. INTRODUCTION

Chronic liver disease is commonly accompanied by the development of liver fibrosis, e.g. the formation of scar tissue that disturbs the liver architecture and may ultimately lead to cirrhosis and liver failure. Hepatic stellate cells (HSC) are considered to be the main drivers of liver fibrogenesis1_{. HSC are located in the} space of Disse and are referred to as quiescent HSC (qHSC) in the healthy liver where they play a key role in regulating vitamin A homeostasis. As a result of chronic injury, HSC are activated, start to proliferate and secrete excessive amounts of extracellular matrix (ECM) proteins, in particular collagens and fibronectins2_, as well as growth factors, cytokines and chemokines with mitogenic activity1_. At this moment, the only curative and life-saving treatment for end‐stage liver cirrhosis is liver transplantation. However, this is a complex and costly procedure, with limited availability of donor organs and risk for immunologic rejection of the graft3_{. Fortunately, increasing evidence indicates that liver fibrosis is largely} reversible prior to the phase of cirrhosis. Scar tissue in liver can be resolved when the hepatotoxic insult is neutralized, as observed after treatment of hepatitis C patients with antiviral agents4-6_{. This holds promise for the development of} anti-fibrotic therapies for liver diseases where the hepatotoxic factor is not easily neutralized, such as in auto-immune, cholestatic and metabolic liver diseases.

In recent years, administration of mesenchymal stromal cells (MSC) has been shown to ameliorate chronic liver injury and reverse liver fibrosis, and their mode of action was attributed to multiple mechanisms7,8_{. Also adipose tissue-derived}

stromal cells (ASC, fat-derived MSC) showed this therapeutic potential, as their administration improved liver function and prevented liver fibrosis in a mouse model of steatohepatitis-induced cirrhosis9_{. In fact, several clinical trials reported}

that administration of bone marrow- and umbilical cord-derived MSC improved liver function and regressed liver fibrosis in patients with viral hepatitis, primary biliary cirrhosis and/or decompensated cirrhosis10-14_{. MSC are typically applied}

intravenously, but data concerning the biodistribution and hepatic homing of MSC is limited. Several studies reported that the fibrotic liver releases factors that (chemo)attract MSC3,15,16_{, but the identity and cellular origin of these factors}

remain to be characterized. By making use of precision cut liver slices (hPCLS), as well as primary hepatocytes and hepatic stellate cells, we aimed to gain mechanistic insight in the migration of human adipose tissue-derived stromal cells (hASC) to the diseased liver.

(25)

CHAPTER 2

2.2. MATERIAL AND METHODS

2.2.1. Human liver tissue

This study was approved by the Medical Ethical Committee of University Medical Centre Groningen, according to the Dutch legislation and the Code of Conduct for dealing responsibly with human material in the context of health research (https://www.federa.org/codes-conduct), refraining the need of written consent for the ‘further use’ of coded-anonymous human tissue. Clinically healthy liver tissue was obtained from surgical excess material acquired from donated livers that were unsuitable to transplant or from donors undergoing partial hepatectomy. Liver tissue was stored in ice-cold tissue preservation solution (University of Wisconsin) for 3 to 5 h before PCLS processing.

2.2.2.

Rat liver tissue

Pathogen-free male Wistar rats (Harlan PBC, Zeist, The Netherlands) were kept under standard laboratory conditions with free access to standard laboratory chow and water. All experiments were performed according to Dutch law on welfare of laboratory animals and guidelines of the ethics committee of University of Groningen for the care and use of laboratory animals.

2.2.3. Preparation of precision-cut liver slices (PCLS)

Human/rat precision-cut liver slices (hPCLS/rPCLS) (5 mm in diameter, 250-300 μm thick and 4-5 mg wet weight) were prepared as described previously 17_{. Slices} were obtained with a Krumdieck slicer (Alabama Research and Development, Munford, AL, USA) in 4°C Krebs-Henseleit buffer supplemented with 25 mmol/L D-glucose (Merck, Darmstadt, Germany), 25 mmol/L NaHCO₃ (Merck), 10 mmol/L HEPES (MP Biomedicals, Aurora, OH, USA) saturated with carbogen (95% O₂/5% CO₂) at pH 7.42. PCLS were incubated in Williams’ medium E (with L-glutamine, Fisher Scientific, Landsmeer, The Netherlands) supplemented with 25 mmol/L D-glucose and 50 μg/ml gentamycin (Invitrogen).

2.2.4.

Human Adipose tissue–derived Stromal Cell (hASC) isolation

and culture

Human subcutaneous adipose tissue was obtained under informed consent from healthy donors with BMI below 30 undergoing liposuction surgery (Bergman Clinics, The Netherlands). Adipose tissue was stored at 4°C and processed within 24 h post-surgery. hASC were isolated as described18_{and seeded in culture flasks} at 4x104_/cm2_{, expanded by passing three times and used for experiments. All} experiments were performed using a pooled hASC from three donors. The use of 24

(26)

2

adipose tissue as the source of hASC was approved by the local Ethics Committee of University Medical Center Groningen, given the fact that it was considered the use of anonymized waste material.

2.2.5. Isolation, culture and treatment of rat hepatic stellate cells (rHSC)

Specified pathogen-free male Wistar rats (350 – 400 g; Charles River Laboratories Inc., Wilmington, MA, USA) were kept under standard laboratory conditions with free access to standard laboratory chow and water. All experiments were performed according to Dutch law on welfare of laboratory animals and guidelines of the ethics committee of University of Groningen for the care and use of laboratory animals. Primary hepatocytes19_{and rHSC}20_{were obtained as described} before, the latter by perfusion of the liver with pronase (Merck, Amsterdam, the Netherlands) and collagenase-P (Roche, Almere, the Netherlands) and further purified by Nycodenz (Axis-ShieldPOC, Oslo, Norway) gradient centrifugation. rHSC were cultured in Iscove’s Modified Dulbecco’s Medium (IMDM) with Glutamax (Invitrogen, Brenda, the Netherlands) supplemented with 20% heat-inactivated fetal calf serum (Invitrogen), 1 mmol/L sodium pyruvate (Invitrogen), 1x nonessential amino acids (Invitrogen), 50 µg/ml gentamicin (Invitrogen), 100 U/ml penicillin (Lonza, Vervier, Belgium), 10 µg/ml streptomycin (Lonza) and 250 ng/ml fungizone (Lonza) in a humidified incubator at 37°C with 5% CO₂.

2.2.6.

Preparation of rHSC-CM

Activated rHSC (arHSC) in passage 1-2 were cultured for 24 h and the conditioned medium (rHSC-CM) was collected and centrifuged at 500 xg for 10 min to remove cell debris and used for the further assays.

2.2.7. RNA isolation and qPCR

RNA was isolated using TRI reagent (Sigma-Aldrich‎) according to the manufacturer’s instructions. Reverse transcription was performed on 2.5 µg total RNA using random nanomers (Sigma-Aldrich) in a final volume of 50 µl. time semi-quantitative PCR (qPCR) was performed on the 7900HT Fast Real-TimePCR system (Applied Biosystems Europe, The Netherlands)21_{. mRNA levels} were normalized to 18S and further normalized to the mean expression level of the control group (∆∆C_T method). qPCR primers and probes are shown in Supplementary Table S1.

2.2.8. Real-time monitoring of cell migration

hASC migration to PCLS, primary rat HSC or hepatocytes and arHSC-CM was monitored using the xCELLigence system (RTCA DP; ACEA Biosciences, 25

(27)

CHAPTER 2

Inc., San Diego, CA, USA). PCLS were placed in the lower compartment of CIM plates®_{and either hepatocytes}19_{or HSC}20_{were cultured overnight as it was} described. Likewise, rHSC-CM was placed in the lower compartment of CIM plates®_{, and the culture media in the lower compartment considered as the control} condition. 3x104_{hASC were seeded in the upper compartment of CIM-plates}® with interdigitated gold microelectrodes to constantly record the cell migration, according to manufacturer’s instructions22_{. hASC migration was monitored for 10} h and results were analyzed by the xCELLigence software.

2.2.9. Blocking CXCR2, CXCR3A and CXCR4

SB 22500223_{, NBI 74330}24_{and AMD 3465 hexahydrobromide}25_{(all at 500 µmol/L,} all from Tocris Bioscience, Germany) were applied to antagonize CXCR2, CXCR3 and CXCR4, respectively.

2.2.10. Cell viability assay

MTT assay26_{was performed on hASC and arHSC, which were pre-exposed to} either SB 225002, NBI 74330 or AMD 3465 hexahydrobromide at a concentration of 500 µmol/L for the duration of 12 h.

2.2.11. Statistical analysis

Data are expressed as average with standard deviation. Statistical significance was determined using Mann-Whitney U test. All tests were performed with GraphPad Prism (v. 5.0; GraphPad Software, La Jolla, CA, USA). Differences were considered significant at P < 0.05.

2.3. RESULTS

2.3.1. Human ASC migrate to human and rat precision-cut liver slices (PCLS)

Human adipose tissue-derived stromal cells (hASC) were co-cultured with freshly cut human or rat PCLS in xCELLigence CIM-plates to analyze hASC migration (Figure 1). The hPCLS enhanced hASC migration compared to spontaneous migration in the absence of hPCLS (Figure 1A). hASC migration reached a plateau after approximately 5 h, both in the absence and presence of hPCLS, but the cell index (as proxy for hASC migration) had more than doubled in the presence of hPCLS (Figure 1A, bar graph). Essentially similar results were obtained when hASC were co-cultured with rPCLS, where the level of hASC migration was enhanced fourfold compared to spontaneous migration (Figure 1B).

(28)

2

Figure 1. Human hASC migrate to human and rat precision-cut liver slices (PCLS).

Migration of human ASC to (A) human precision cut liver slices (hPCLS) and (B) rat precision cut liver slices (rPCLS). Data shows mean value ± SD of 3 experiments. *p ≤0.05, **p ≤0.01, ***p ≤0.001, Mann-Whitney U test.

Figure 2. hASC migrate to activated hepatic stellate cells, but not to hepatocytes.

Migration of human hASC to rat hepatocytes, quiescent rat HSC (qrHSC), and activated rat HSC (arHSC). Data shows mean value ± SD of 3 experiments. *p ≤0.05, **p ≤0.01, ***p ≤0.001, Mann-Whitney U test.

(29)

CHAPTER 2

2.3.2. hASC migrate to activated hepatic stellate cells, but not to hepatocytes

Next, we analyzed which liver cell types promote hASC migration, using primary liver cells from rat. hASC were co-cultured with equal numbers of primary rat hepatocytes, quiescent HSC (1-day cultured; qrHSC) or activated HSC (7-day cultured; arHSC). No significant stimulation of hASC migration was observed if co-cultured with primary hepatocytes or qrHSC compared to medium controls (Figure 2). In contrast, arHSC promoted hASC migration and caused a fourfold increase in the cell index after 5 h of incubation compared to controls (Figure 2, bar graph).

2.3.3. Activated HSC express CXCR2 ligands

Based on earlier reports27,28_{, we analyzed the gene expression profile of candidate} chemokines in arHSC and qrHSC (Figure 3). qrHSC most dominantly expressed Cxcl12 (SDF-1, ligand for CXCR4 and CXCR7). In addition, expression of Cxcl1 and Cxcl2 was detected (Figure 3A). In contrast, activation strongly upregulated

Figure 3: Activated HSC express CXCR-2 ligands. Gene expression profile of (A)

quiescent rat HSC and (B) activated rat HSC for selected chemokines. (C) characterization of activated versus quiescent HSC. (D) Gene expression of hASC-derived chemokine receptors. Data shows mean value ± SD of 3 experiments. *p ≤0.05, **p ≤0.01, ***p ≤0.001, Mann-Whitney U test.

(30)

2

expression of Cxcl1 and Cxcl2, these are the rat orthologs of human chemokines Gro-α and Gro-β and IL-8 which are ligands of CXCR2. Activation of HSC reduced expression of Cxcl12, but upregulated expression of Cxcl9, Cxcl10 and Cxcl11 (ligands for CXCR3) (Figure 3B). As expected, activation strongly downregulated expression of Lrat which encodes lecithin retinol acyltransferase a key enzyme in vitamin A synthesis while fibrotic genes such as Acta2 and Col1A1 were upregulated in activated HSC (Figure 3C). hASC expressed receptors relevant for the chemokines expressed by rHSC (Figure 3D).

2.3.4. hASC migration to arHSC depends on CXCR2 and CXCR3

The CXCR2-specific antagonist SB 225002 effectively suppressed hASC migration towards arHSC by ~80% (Figure 4). A lower (~20%), but still significant reduction in hASC-to-arHSC migration was detected with CXCR3 antagonist (NBI 74330). Antagonizing CXCR4 (by AMD 3465 hexahydrobromide) did not affect hASC migration towards arHSC. Importantly, none of the antagonists reduced the cell viability of hASC, nor of the arHSC (Supplementary Figure S1).

2.3.5. CXCR2 promotes hASC migration to arHSC-CM

To eliminate any potential effect of the CXCR antagonists on arHSC, we also analyzed hASC migration towards conditioned medium of arHSC (arHSC-CM). arHSC-CM promoted hASC migration to similar levels as live arHSC (Figure

5A). Like in the hASC-HSC coculture experiments, blocking CXCR2 strongly

Figure 4. hASC migration to arHSC depends on CXCR2 and CXCR3. Blocking hASC

migration to arHSC using specific antagonists for CXCR2, CXCR3 and CXCR4. Data shows mean value ± SD of 3 experiments. *p ≤0.05, **p ≤0.01, ***p ≤0.001, Mann-Whitney U test.

(31)

CHAPTER 2

suppressed hASC migration, while hASC migration was not affected by CXCR3 and CXCR4 antagonists (Figure 5B).

In summary, our data show that activated HSC may secrete CXCR2 agonistic chemokines that attract hASC.

2.4. DISCUSSION

In this study, we show that hASC migrate to human and rat precision-cut liver slices (PCLS) that undergo early induction of fibrosis ex vivo. Moreover, culture-induced activation of primary hepatic stellate cells (HSC) strongly enhanced the attraction of hASC compared to quiescent HSC or to primary hepatocytes. The hASC-chemoattractant properties were contained in the secretome of activated HSC and were predominantly mediated through CXCR2 and to a lesser extent via CXCR3 signaling.

MSC29,30_{, including ASC}31_{, harbor therapeutic properties against chronic} liver disease. Upon systemic infusion, MSC home and migrate to the injured liver 32-34_{, however, the main drivers of this migration remain to be unraveled.} The use of PCLS provides a unique opportunity to study primary mechanisms of MSC migration to the fibrotic tissue, having all liver cells in their original environment35,36_{. Although the viability of PCLS is preserved for several days}37_, the slicing process induces tissue and cellular (hepatocyte) damage, inflammatory signaling, tissue repair mechanisms, and the early onset of fibrosis35_{. So far, PCLS}

Figure 5. CXCR2 promotes hASC migration to aHSC-CM. (A) hASC migration to

arHSC-CM. (B) Blocking hASC migration to arHSC-CM using specific antagonists for CXCR2, CXCR3 and CXCR4. Data shows mean value ± SD of 3 experiments. *p ≤0.05, **p ≤0.01, ***p ≤0.001, Mann-Whitney U test.

(32)

2

have been applied to analyze drug metabolism37_{and served as models of} drug-induced cholestatic38_{, metabolic}39_{, and fibrotic}35_{liver disease, but this is the} first-time application of these tissue slices as a chemotactic model. Our primary data show that hASC migrated to both human and rat PCLS. In order to identify the source of migratory signals in the fibrotic liver, we investigated hASC migration to either primary hepatocytes, qHSC and aHSC. Furthermore, our data show that hASC migration was effectively blocked by CXCR2 antagonists and to a lesser extent by CXCR3 antagonists, inspiring to analyze the putative CXCLs involved. Others showed that HSC activation is associated with a rapid increase in the production of cytokines and chemokines in these cells40,41_{. In line with} effects of antagonists, our data reveal a sharp increase in the expression of HSC-derived ligands for CXCR2, namely Cxcl1 and Cxcl2. CXCL1 is a key fibrogenic chemokine42_{and also promotes autocrine activation of HSC}27_{. A recent study} suggests that the secretion of CXCL1 by activated HSC is regulated by CD147 via PI3K/AKT signaling. Furthermore, it has been shown that the specific deletion of CD147 in HSC, suppresses CXCL1 expression and, therefore, inhibits HSC activation and alleviates CCl₄-induced liver fibrosis in mice27_.

In the fibrotic liver, CXCL1 is also released by infiltrated neutrophils. It is shown that blocking the neutrophils infiltration reduces CXCL1 levels and protects liver against fibrosis in mice43,44_{. It is well-documented that release of CXCL2 is} increased in the diseased liver, mainly produced by Kupffer cells and activated HSC. CXCL2 is known to have major roles in attracting inflammatory cells, mainly neutrophils, to the fibrotic liver45,46_{. Here, increased secretion of CXCL1 and} CXCL2 in aHSC might explain the efficient migration of hASC to aHSC as well as to PCLS. We found that qHSC only express CXCL12 which was suppressed in culture-activated HSC. CXCL12, the ligand for CXCR4, is constitutively expressed in healthy liver. However, its expression is enhanced following acute and chronic liver injury47_{. Considering our data, it is conceivable that other cell types rather} than HSC are main producers of CXCL12 in injured liver. Sinusoidal endothelial cells, HSC, and malignant hepatocytes are other main sources of CXCL12 in diseased liver47_{. However, this contrast between in vitro and in vivo expression} of CXCL12 may also originate from diversities between culture-activated and in vivo-activated HSC48,49_{. In humans, CXCL8 (e.g. IL-8) is an important ligand} for CXCR1 and CXCR2 and a potent chemoattractant for neutrophils and to a lesser extent monocytes. Thus, CXCL8/IL-8 is well-recognized to contribute to the accumulation of macrophages in both acute inflammation and chronic liver disease50,51_._{IL-8 is produced by virtually all nucleated human cell types}50,51_. Remarkable, an important for our study, rodents do not harbor a true homolog gene for CXCL852_{. Hepatic and serum levels of IL-8 are increased in patients with} 31

(33)

CHAPTER 2

alcoholic liver disease, promoting hepatic neutrophil accumulation53,54_{. Moreover,} serum levels of IL-8 in patients with chronic hepatitis are tightly associated with the liver disease progression55_{. Several studies have indicated that IL-8 is not only} a chemoattractant in the liver, but also possesses direct profibrogenic functions. For instance, HCV-derived core protein-transduced Huh-7 cells were capable of stimulating HSC in an IL-8 dependent manner56_{. Likewise, IL-8 signaling is shown} to be linked to organ fibrosis in prostate, pancreas and lungs57-59_{. Overall, elevated} IL-8 due to the liver injury is expected to enhance hASC attraction to the diseased liver. Our results shed light on determining roles of CXCR2 in hASC migration and therefore suggest prospective targets for the future of hASC-therapy in liver disease.

(34)

2 REFERENCES

1. Friedman SL. Liver fibrosis -- from bench to bedside. J Hepatol. 2003;38 Suppl 1:S38-53. 2. Sato M, Suzuki S, Senoo H. Hepatic stellate cells: Unique characteristics in cell biology and

phenotype. Cell Struct Funct. 2003;28(2):105-112.

3. Hu C, Zhao L, Duan J, Li L. Strategies to improve the efficiency of mesenchymal stem cell transplantation for reversal of liver fibrosis. J Cell Mol Med. 2019;23(3):1657-1670.

4. Bachofner JA, Valli PV, Kroger A, et al. Direct antiviral agent treatment of chronic hepatitis C results in rapid regression of transient elastography and fibrosis markers fibrosis-4 score and aspartate aminotransferase-platelet ratio index. Liver Int. 2017;37(3):369-376.

5. Fehily SR, Papaluca T, Thompson AJ. Long-term impact of direct-acting antiviral agent therapy in HCV cirrhosis: Critical review. Semin Liver Dis. 2019;39(3):341-353.

6. Laursen TL, Siggaard CB, Kazankov K, et al. Time-dependent improvement of liver inflammation, fibrosis and metabolic liver function after successful direct-acting antiviral therapy of chronic hepatitis C. J Viral Hepat. 2019.

7. Vainshtein JM, Kabarriti R, Mehta KJ, Roy-Chowdhury J, Guha C. Bone marrow-derived stromal cell therapy in cirrhosis: Clinical evidence, cellular mechanisms, and implications for the treatment of hepatocellular carcinoma. Int J Radiat Oncol Biol Phys. 2014;89(4):786-803. 8. Zhang Y, Li Y, Zhang L, Li J, Zhu C. Mesenchymal stem cells: Potential application for the

treatment of hepatic cirrhosis. Stem Cell Res Ther. 2018;9(1):59-018-0814-4.

9. Seki A, Sakai Y, Komura T, et al. Adipose tissue-derived stem cells as a regenerative therapy for a mouse steatohepatitis-induced cirrhosis model. Hepatology. 2013;58(3):1133-1142.

10. Zhang Z, Lin H, Shi M, et al. Human umbilical cord mesenchymal stem cells improve liver function and ascites in decompensated liver cirrhosis patients. J Gastroenterol Hepatol. 2012;27 Suppl 2:112-120.

11. Wang L, Han Q, Chen H, et al. Allogeneic bone marrow mesenchymal stem cell transplantation in patients with UDCA-resistant primary biliary cirrhosis. Stem Cells Dev. 2014;23(20):2482-2489.

12. El-Ansary M, Abdel-Aziz I, Mogawer S, et al. Phase II trial: Undifferentiated versus differentiated autologous mesenchymal stem cells transplantation in egyptian patients with HCV induced liver cirrhosis. Stem Cell Rev. 2012;8(3):972-981.

13. Xu L, Gong Y, Wang B, et al. Randomized trial of autologous bone marrow mesenchymal stem cells transplantation for hepatitis B virus cirrhosis: Regulation of treg/Th17 cells. J

Gastroenterol Hepatol. 2014;29(8):1620-1628.

14. Salama H, Zekri AR, Medhat E, et al. Peripheral vein infusion of autologous mesenchymal stem cells in egyptian HCV-positive patients with end-stage liver disease. Stem Cell Res Ther. 2014;5(3):70.

15. Deng C, Qin A, Zhao W, Feng T, Shi C, Liu T. Up-regulation of CXCR4 in rat umbilical mesenchymal stem cells induced by serum from rat with acute liver failure promotes stem cells migration to injured liver tissue. Mol Cell Biochem 2014 Nov+ADs-396(1-2):107-16 doi:

10 1007/s11010-014-2147-7 Epub. 2014;396(1-2):107-116.

16. Xie J, Wang W, Si JW, et al. Notch signaling regulates CXCR4 expression and the migration of mesenchymal stem cells. Cell Immunol. 2013;281(1):68-75.

17. de Graaf IA, Olinga P, de Jager MH, et al. Preparation and incubation of precision-cut liver and intestinal slices for application in drug metabolism and toxicity studies. Nat Protoc. 2010;5(9):1540-1551.

18. Przybyt E, Krenning G, Brinker MG, Harmsen MC. Adipose stromal cells primed with hypoxia and inflammation enhance cardiomyocyte proliferation rate in vitro through STAT3 and Erk1/2. J Transl Med. 2013;11:39-5876-11-39.

(35)

CHAPTER 2

19. Woudenberg-Vrenken TE, Buist-Homan M, Conde de la Rosa L, Faber KN, Moshage H. Anti-oxidants do not prevent bile acid-induced cell death in rat hepatocytes. Liver Int. 2010;30(10):1511-1521.

20. Moshage H, Casini A, Lieber CS. Acetaldehyde selectively stimulates collagen production in cultured rat liver fat-storing cells but not in hepatocytes. Hepatology. 1990;12(3 Pt 1):511-518. 21. Shajari S, Laliena A, Heegsma J, Tunon MJ, Moshage H, Faber KN. Melatonin suppresses

activation of hepatic stellate cells through RORalpha-mediated inhibition of 5-lipoxygenase. J

Pineal Res. 2015;59(3):391-401.

22. Ge Y, Deng T, Zheng X. Dynamic monitoring of changes in endothelial cell-substrate adhesiveness during leukocyte adhesion by microelectrical impedance assay. Acta Biochim

Biophys Sin (Shanghai). 2009;41(3):256-262.

23. Catusse J, Liotard A, Loillier B, Pruneau D, Paquet JL. Characterization of the molecular interactions of interleukin-8 (CXCL8), growth related oncogen alpha (CXCL1) and a non-peptide antagonist (SB 225002) with the human CXCR2. Biochem Pharmacol. 2003;65(5):813-821.

24. Verzijl D, Storelli S, Scholten DJ, et al. Noncompetitive antagonism and inverse agonism as mechanism of action of nonpeptidergic antagonists at primate and rodent CXCR3 chemokine receptors. J Pharmacol Exp Ther. 2008;325(2):544-555.

25. Rosenkilde MM, Gerlach LO, Hatse S, et al. Molecular mechanism of action of monocyclam versus bicyclam non-peptide antagonists in the CXCR4 chemokine receptor. J Biol Chem. 2007;282(37):27354-27365.

26. van Meerloo J, Kaspers GJ, Cloos J. Cell sensitivity assays: The MTT assay. Methods Mol Biol. 2011;731:237-245.

27. Shi WP, Ju D, Li H, et al. CD147 promotes CXCL1 expression and modulates liver fibrogenesis.

Int J Mol Sci. 2018;19(4):10.3390/ijms19041145.

28. Harvey SA, Dangi A, Tandon A, Gandhi CR. The transcriptomic response of rat hepatic stellate cells to endotoxin: Implications for hepatic inflammation and immune regulation. PLoS One. 2013;8(12):e82159.

29. Fiore EJ, Dominguez LM, Bayo J, Garcia MG, Mazzolini GD. Taking advantage of the potential of mesenchymal stromal cells in liver regeneration: Cells and extracellular vesicles as therapeutic strategies. World J Gastroenterol. 2018;24(23):2427-2440.

30. Kim G, Eom YW, Baik SK, et al. Therapeutic effects of mesenchymal stem cells for patients with chronic liver diseases: Systematic review and meta-analysis. J Korean Med Sci. 2015;30(10):1405-1415.

31. Volarevic V, Nurkovic J, Arsenijevic N, Stojkovic M. Concise review: Therapeutic potential of mesenchymal stem cells for the treatment of acute liver failure and cirrhosis. Stem Cells. 2014;32(11):2818-2823.

32. Kidd S, Spaeth E, Dembinski JL, et al. Direct evidence of mesenchymal stem cell tropism for tumor and wounding microenvironments using in vivo bioluminescent imaging. Stem Cells. 2009;27(10):2614-2623.

33. Sasaki M, Abe R, Fujita Y, Ando S, Inokuma D, Shimizu H. Mesenchymal stem cells are recruited into wounded skin and contribute to wound repair by transdifferentiation into multiple skin cell type. J Immunol. 2008;180(4):2581-2587.

34. Fiore EJ, Dominguez LM, Bayo J, Garcia MG, Mazzolini GD. Taking advantage of the potential of mesenchymal stromal cells in liver regeneration: Cells and extracellular vesicles as therapeutic strategies. World J Gastroenterol. 2018;24(23):2427-2440.

35. Westra IM, Oosterhuis D, Groothuis GM, Olinga P. Precision-cut liver slices as a model for the early onset of liver fibrosis to test antifibrotic drugs. Toxicol Appl Pharmacol. 2014;274(2):328-338.

(36)

2

36. Graaf IA, Groothuis GM, Olinga P. Precision-cut tissue slices as a tool to predict metabolism of novel drugs. Expert Opin Drug Metab Toxicol. 2007;3(6):879-898.

37. Starokozhko V, Vatakuti S, Schievink B, et al. Erratum to: Maintenance of drug metabolism and transport functions in human precision-cut liver slices during prolonged incubation for 5 days. Arch Toxicol. 2017;91(7):2711-016-1895-4.

38. Starokozhko V, Greupink R, van de Broek P, et al. Rat precision-cut liver slices predict drug-induced cholestatic injury. Arch Toxicol. 2017;91(10):3403-3413.

39. Costa A, Sarmento B, Seabra V. An evaluation of the latest in vitro tools for drug metabolism studies. Expert Opin Drug Metab Toxicol. 2014;10(1):103-119.

40. Friedman SL. Stellate cell activation in alcoholic fibrosis--an overview. Alcohol Clin Exp Res. 1999;23(5):904-910.

41. Friedman SL. Molecular regulation of hepatic fibrosis, an integrated cellular response to tissue injury. J Biol Chem. 2000;275(4):2247-2250.

42. Sahin H, Wasmuth HE. Chemokines in tissue fibrosis. Biochim Biophys Acta. 2013;1832(7):1041-1048.

43. Zaldivar MM, Pauels K, von Hundelshausen P, et al. CXC chemokine ligand 4 (Cxcl4) is a platelet-derived mediator of experimental liver fibrosis. Hepatology. 2010;51(4):1345-1353. 44. Zhou Z, Xu MJ, Cai Y, et al. Neutrophil-hepatic stellate cell interactions promote fibrosis in

experimental steatohepatitis. Cell Mol Gastroenterol Hepatol. 2018;5(3):399-413.

45. Moles A, Murphy L, Wilson CL, et al. A TLR2/S100A9/CXCL-2 signaling network is necessary for neutrophil recruitment in acute and chronic liver injury in the mouse. J Hepatol. 2014;60(4):782-791.

46. Mochizuki A, Pace A, Rockwell CE, et al. Hepatic stellate cells orchestrate clearance of necrotic cells in a hypoxia-inducible factor-1alpha-dependent manner by modulating macrophage phenotype in mice. J Immunol. 2014;192(8):3847-3857.

47. Liepelt A, Tacke F. Stromal cell-derived factor-1 (SDF-1) as a target in liver diseases. Am J

Physiol Gastrointest Liver Physiol. 2016;311(2):G203-9.

48. Kristensen DB, Kawada N, Imamura K, et al. Proteome analysis of rat hepatic stellate cells.

Hepatology. 2000;32(2):268-277.

49. Maubach G, Lim MC, Chen J, Yang H, Zhuo L. miRNA studies in in vitro and in vivo activated hepatic stellate cells. World J Gastroenterol. 2011;17(22):2748-2773.

50. Kaplanski G, Farnarier C, Kaplanski S, et al. Interleukin-1 induces interleukin-8 secretion from endothelial cells by a juxtacrine mechanism. Blood. 1994;84(12):4242-4248.

51. Hashimoto S, Yoda M, Yamada M, Yanai N, Kawashima T, Motoyoshi K. Macrophage colony-stimulating factor induces interleukin-8 production in human monocytes. Exp Hematol. 1996;24(2):123-128.

52. Asfaha S, Dubeykovskiy AN, Tomita H, et al. Mice that express human interleukin-8 have increased mobilization of immature myeloid cells, which exacerbates inflammation and accelerates colon carcinogenesis. Gastroenterology. 2013;144(1):155-166.

53. Huang YS, Chan CY, Wu JC, Pai CH, Chao Y, Lee SD. Serum levels of interleukin-8 in alcoholic liver disease: Relationship with disease stage, biochemical parameters and survival. J Hepatol. 1996;24(4):377-384.

54. Hill DB, Marsano LS, McClain CJ. Increased plasma interleukin-8 concentrations in alcoholic hepatitis. Hepatology. 1993;18(3):576-580.

55. Polyak SJ, Khabar KS, Rezeiq M, Gretch DR. Elevated levels of interleukin-8 in serum are associated with hepatitis C virus infection and resistance to interferon therapy. J Virol. 2001;75(13):6209-6211.

56. Clement S, Pascarella S, Conzelmann S, Gonelle-Gispert C, Guilloux K, Negro F. The hepatitis C virus core protein indirectly induces alpha-smooth muscle actin expression in hepatic stellate cells via interleukin-8. J Hepatol. 2010;52(5):635-643.

(37)

CHAPTER 2

57. Motoo Y, Xie MJ, Mouri H, Sawabu N. Expression of interleukin-8 in human obstructive pancreatitis. JOP. 2004;5(3):138-144.

58. Schauer IG, Ressler SJ, Tuxhorn JA, Dang TD, Rowley DR. Elevated epithelial expression of interleukin-8 correlates with myofibroblast reactive stroma in benign prostatic hyperplasia.

Urology. 2008;72(1):205-213.

59. Carre PC, Mortenson RL, King TE,Jr, Noble PW, Sable CL, Riches DW. Increased expression of the interleukin-8 gene by alveolar macrophages in idiopathic pulmonary fibrosis. A potential mechanism for the recruitment and activation of neutrophils in lung fibrosis. J Clin Invest. 1991;88(6):1802-1810.

(38)

2 SUPPLEMENTARY TABLES AND FIGURES

Supplementary table S1. Primers and probes used for real-time quantitative PCR analysis

Gene Primer and probe

CXCR2 (human) Hs01011557_M1 CXCR3 (human) Hs00171041_M1 CXCR4 (human) Hs00976734_M1 Cxcl12 (rat) Rn00573260_M1 Cxcl10 (rat) Rn00594648_M1 Cxcl1 (rat) Rn00578225_M1 Cxcl2 (rat) Rn00586403_M1 Cxcl9 (rat) Rn00595504_M1 Cxcl11 (rat) Rn00595504_M1 Cxcl6 (rat) Rn00573587_G1 Ppbp (rat) Rn00596603_G1 Cxcl3 (rat) RN01414231_M1

18S (rat) For (5’-3’): CGGCTACCACATCCAAGGA Rev (5’-3’): CCAATTACAGGGCCTCGAAA Probe (5’-3’): CGCGCAAATTACCCACTCCCGA

Supplementary Figure S1: Antagonists are not toxic to arHSC and hASC. Cell viability of

(A) arHSC, and (B) hASC after 12 h exposure to each antagonist. Data shows mean value ± SD of 3 experiments. p ≤0.05, **p ≤0.01, ***p ≤0.001, ANOVA (with Tukey’s post-hoc test for individual experimental conditions).

A

B

(39)

(40)

CHAPTER

3

Adipose tissue-derived

stromal cells suppress

liver fibrosis in an

extracellular

vesicle-mediated fashion

Danial Afsharzadeh1 Svenja Sydor2 Emilia Gore3 Julian Friedrich4 Guido Krenning4 Patrick Van Rijn5 Ali Canbay2 Peter Olinga3 Lars P. Bechmann2 Martin C. Harmsen4 Klaas Nico Faber1,6

Departments of 1_{Hepatology and Gastroenterology,}

4_{Pathology and Medical Biology,}3_{Pharmaceutical}

Technology and Biopharmacy, Biomedical Engineering5_,

and 6_{Laboratory Medicine, Center for Liver, Digestive and}

Metabolic Disease, University of Groningen, University Medical Center Groningen, Groningen, The Netherlands.

2_{Department of Gastroenterology, Hepatology and}

Infectious Diseases, Otto von Guericke University Magdeburg, Magdeburg, Germany.

University of Groningen Decoding therapeutic roles of adipose tissue-derived stromal cells and their extracellular vesicles in liver disease Afsharzadeh, Danial