• No results found

REFERENTIEWAARDEN AFDELING KLINISCHE CHEMIE. GELDIG DOCUMENT Bepaling Matrix Leeftijd M/V Eenheid Bron

N/A
N/A
Protected

Academic year: 2022

Share "REFERENTIEWAARDEN AFDELING KLINISCHE CHEMIE. GELDIG DOCUMENT Bepaling Matrix Leeftijd M/V Eenheid Bron"

Copied!
16
0
0

Bezig met laden.... (Bekijk nu de volledige tekst)

Hele tekst

(1)

VERSIE: 16

GELDIG DOCUMENT

Bepaling Matrix Leeftijd M/V Eenheid Bron

5-Hydroxy IndolAzijnzuur (HIA) urine 1 j tot 120 j 0,0-50,0 μmol/24h Simultaneous Liquid-Chromatographic Determination Clin Chem 1988; 34: 2504-2506.

Absolute neutrofielen count volbloed 1,5-7,5 x109/L Regionale uniformering van hem. ref.waarden Ned.Tijdschift klin Chem 1997, vol 22. no. 4

<6 m geen

ACE serum 6 m tot 18 j 29-112 U/L Bijsluiter firma Bühlmann

18 j tot 120 j 20-70

ALAT plasma >17 j 0-45 (M) U/L Franck Ned Tijdschr Klin Chem Labgeneesk 2010; 35: 240-243

>17 j 0-34 (V)

Albumine plasma 35-52 g/L Bijsluiter firma Roche, Regiobesluit Rijnmond

18 tot 61 j 0,0-1,7 (M) 18 tot 51 j 0,0-1,9 (V)

Albumine/Kreat ratio urine 51 tot 61 j 0,0-2,2 (V) mg/mmol Regiobesluit Rijnmond.

61 tot 70 j 0,0-2,0 (M) 61 tot 70 j 0,0-2,9 (V) 70 tot 120 j 0,0-2,4 (M) 70 tot 120 j 0,0-3,0 (V)

Alcohol serum <0,1= ‰ Diagnostisch Kompas 2003 pagina 1217

<2 mmol/L

Alfa-1-antitrypsine serum <1 j geen RBCC MaasstadLab. VD-2011/ANTI1-REF 2011-12-19.

1 tot 120 j 0,9-2,5 VD-2012/IMM8-AAT 2013-09-10.

Alfa-Foetoproteine serum <7,0 μg/L Bijsluiter Roche 2020

0 tot 2 w 83-248

2 w tot 1 j 122-469 1 tot 10 j 142-335

Alkalische Fosfatase plasma 10 tot 13 j 129-417 U/L Bijsluiter firma Roche

13 tot 15 j 116-468 15 tot 17 j 82-331 17 tot 19 j 55-149

>19 j 0-115 (M) Franck Ned Tijdschr Klin Chem Labgeneesk 2010; 35: 240-243

>19 j 0-98 (V)

Ammoniak plasma 16-60 (M) µmol/L Bijsluiter firma Roche

11-51 (V) 0,77-14,5 (M) 20 tot 24 j

(geen pil

gebruiken) 1,22-11,7 (V) 25 tot 29 j 0,890-9,85 (V)

Anti Mullerse Hormoon (AMH) serum 30 tot 34 j 0,576-8,13 (V) µg/L Bijsluiter Roche 2020

35 tot 39 j 0,147-7,49 (V) 40 tot 44 j 0,027-5,47 (V) 45 tot 50 j 0,010-2,71 (V) PCOS 1,860-18,9 (V) Antistoffen tegen AMA

(Mitochondriën) serum negatief

Bijsluiter Euroimmun Mosaic Basic Profile FA_1800-1_A_UK_C08 versie 2011-02-28. Guide to Autoimmuun testing Wieslab versie 2010-5 pg 89

g/L

(2)

gezonde personen <50 j negatief

gezonde personen >50 j Incidenteel >10%

Antistoffen tegen kern homogeen negatief

ANA (Nucleaire Antistoffen) kern gespikkeld negatief Tietz Clinical Guide to laboratory Test 4th edition.

kern nucleoli positief negatief Bijsluiter Euroimmun Mosaic HEp-20-10 Liver Monkey FA_1512-1_A_UK_C06 versie 2011-03-01.

kern nucleair dots enk serum negatief

kern nucleair dots mrd negatief

kern centromeren negatief

kern nucleair membr negatief

cytoplasma granulair negatief

Antistoffen tegen ASMA (Smooth Muscle) serum negatief Bijsluiter Euroimmun Mosaic Basic Profile FA_1800-1_A_UK_C08 versie 2011-02-28

Antistoffen tegen negatief <7

Beta-2 glycoproteïne1 IgG en IgA serum dubieus 7-10 U/mL Phadia; Bijsluiter ELiATM ß2-Glycoproteine1-IgG, Versie 20, 2015-01 pg 3.

positief >10

Antistoffen tegen c-ANCA serum negatief Bijsluiter Euroimmun ANA Profile 3 Euroline DL_1590-3G_A_UK_C14 versie 2013-10-16

negatief <10

IgG dubieus 10-40 GPL-U/mL Firma Phadia; Bijsluiter ELiATM Cardiolipine IgG, Versie 20, 2015-01, pg 3.

Antistoffen tegen Cardiolipine serum positief >40

negatief <10

IgM dubieus 10-40 MPL-U/mL Firma Thermo Scientific Phadia; Bijsluiter ELiATM Cardiolipine IgM, versie 20, januari 2015 pg 3 positief >40

negatief <7

Antistoffen tegen CCP (Cyclisch Citrulline Peptide) serum dubieus 7-10 U/mL Firma Phadia; Bijsluiter ELiATM CCP, Versie 20, 2015-02 pg 3.

positief >10

Antistoffen tegen DNAseB serum 0,0-200,0 IE/ml Sanquin bloedvoorziening diagnostiek - DNAse B, antistoffen tegen.

kwalitatief (IFT) negatief Tietz Clinical Guide to laboratory Test 4th edition.

Antistoffen tegen dsDNA serum negatief <10

kwantitatief dubieus 10-15 IU/mL Firma Phadia; Bijsluiter ELiATM dsDNA, Versie 20, 2015-01 pg 3.

positief >15

Antistoffen tegen Intrinsic factor serum negatief <20 RU/mL Bijsluiter Anti Intrinsic Factor ELISA (IgG) Euroimmun (EA_1362G_A_UK_C02.doc versie:05-09-2011) pg 6 positief ≥20

Antistoffen tegen LKM (Liver Kidney Microsomes) serum negatief Tietz Clinical Guide to laboratory Test 4th edition.

kwalitatief (IFT) negatief

Antistoffen tegen MPO serum negatief <3,5 Firma Thermo Scientific Phadia; Bijsluiter ELiATM PR3S, versie 20, oktober 2014 pg 3.

(Myelo peroxidase) kwantitatief dubieus 3,5-5 IU/mL

positief >5

Antistoffen tegen p-ANCA serum negatief Interpretation of Diagnostic Tests, 8th Edition:, 2000 pg 23.

Antistoffen tegen PCA (Pariëtale Cellen) serum negatief Guide to Autoimmuun testing Wieslab versie 2010-5 pg 98.

kwalitatief (IFT) negatief Tietz Clinical Guide to laboratory Test 4th edition.

Antistoffen tegen PR3, serum negatief <2,0

Proteïnase 3 kwantitatief dubieus 2,0-3,0 IU/mL Firma Thermo Scientific Phadia; Bijsluiter ELiATM PR3S, versie 20, oktober 2014 pg 3.

positief >3,0

Antistoffen tegen TG (Thyreoglobuline) serum <100 ng/mL Bijsluiter DiaSorin LIAISON Anti-Tg (ref 311711), versie 7, 2016-03-22

Antistoffen tegen negatief <25

TPO (Thyroïdperoxidase) serum dubieus 25-35 IU/mL Phadia; Bijsluiter ImmunoCAP Thyroid Peroxidase, versie 250-5641-021, november 2016 pg 4.

positief >35

Antistoffen tegen TSH receptoren serum <3,3 IU/mL 2018-09, VR-2018/TSH-CAP250 - pg 07

(3)

negatief <7

Antistoffen tegen TTG (Tissue transglutaminase) serum dubieus 7-10 U/mL Phadia; Bijsluiter ELiATM Celikey, Versie 20, 2015-02 pg 3 positief >10

Anti Trombine plasma 80-120 % Verificatierapport Stolling, 5.3 referentiewaarden iDoc.

Ongefractioneerd heparine 0,3-0,7 U/mL

Apixaban geneesmiddel afhankelijk

1x daags 1,0-2,0 Referentiewaarden Laboratorium EMC, vs. 24 08 2012 pagina 1.

Anti-Xa Dalteparine plasma 2x daags kind 0,5-1,0 U/mL Vademecum Hematologie Antistollingsmedicatie

2x daags volw 0,6-1,0 profylactisch 0,2-0,6

Rivaroxaban geneesmiddel afhankelijk

APTT plasma 23-30 sec Verificatierapport Stolling 5.3 referentiewaarden iDoc.

ASAT plasma >17 j 0-35 (M) U/L Artikel P. Franck Ned Tijdschr Klin Chem Labgeneesk 2010; 35: 240-243

>17 j 0-31 (V)

Base Exces (BE) bloedgas -3 tot +3 mmol/L Regiobesluit Rijnmond.

0 tot 60 j 0,8-2,4

Beta-2-Microglobuline >60 j ≥3,0 mg/L Bijsluiter firma Roche

urine 0,00-0,30

Bicarbonaat (HCO3-) bloedgas 22-29 mmol/L Regiobesluit Rijnmond.

liquor 0,00-0,17 RBCC MaasstadLab

Direct plasma <1 m 0-10 μmol/L Soldin JS, Brugnara C, Wong EC. Pediatric Reference Intervals. AACC

>1 m 0-3,4 Press, 5th ed., 2005.

Bilirubine Direct index 20-50

0 tot 1 d 0-150

Totaal plasma 1 tot 2 d 0-200 μmol/L

2 tot 3 d 0-250 Fay DL, Schellhase KG, Suresh GK. Bilirubin screening for normal newborns: a critique of the hour-specific 3 tot 5 d 0-250 bilirubin nomogram. Pediatrics. 2009 Oct;124(4):1203-5.

5 tot 14 d 0-200

14 d tot 1 j 0-22

>1 j 0-17

0 j tot 1 j 77-168 (M) Paediatric reference values for the C-terminal fragment of fibroblast-growth factor-23, 79-178 (V) Annals of Clinical Biochemistry 2012; 49: 546–553.

1 j tot 2 j 71-161 (M)

Botfosfatase serum 78-178 (V) U/L

2 j tot 3 j 68-156 (M) 77-179 (V) 3 j tot 4 j 66-153 (M) 77-182 (V) 4 j tot 5 j 64-152 (M) 76-187 (V) 5 j tot 6 j 62-153 (M) 76-193 (V) 6 j tot 7 j 61-157 (M) 75-199 (V) 7 j tot 8 j 60-162 (M) 72-205 (V) 8 j tot 9 j 58-169 (M) 69-208 (V)

(4)

9 j tot 10 j 56-177 (M) 64-208 (V) 10 j tot 11 j 54-186 (M) 58-202 (V) 11 j tot 12 j 51-193 (M) 49-188 (V) 12 j tot 13 j 48-197 (M) 40-163 (V) 13 j tot 14 j 44-195 (M) 31-132 (V) 14 j tot 15 j 39-184 (M) 22-100 (V) 15 j tot 16 j 33-164 (M) 16-75 (V) 16 j tot 17 j 26-134 (M)

12-58 (V) 17 j tot 18 j 18-97 (M) 9-48 (V) 19 j tot 45 j 15-41 (M)

12-30 (V)

45 j tot 120 j 15-41 (M) Bone-specific alkaline phosphatase Technical Data sheet. Bone AF Isoenzyme and 14-43 (V) Carboxy-Terminal Propeptide of Type-I Procollagen; Clinical Chemistry 1999; 45: 136-138.

<8 d 0-2

8 d tot 10 j 0-13

BSE volbloed 10 j tot 50 j 0-15 (M) mm/u Farmacotherapeutisch Kompas tot Referentiewaarden klinische chemie 2015-10-01 pg 3.

0-20 (V) Diagnostisch Kompas 2003 pg 1218.

50 j tot 120 j 0-20 (M) 0-30 (V)

1e trim. 0-20

zwanger volbloed 2e trim. 0-20

3e trim. 0-30

125 serum <35 kU/L

CA (Cancer Antigen) 15-3 serum <26,2 Bijsluiter Roche 2020

19-9 plasma <34 U/mL

Calcium / Calcium gecorrigeerd plasma 2,20-2,65 mmol/L Regiobesluit Rijnmond.

Calcium urine 2,5-7,5 mmol/24h

Calcium 2+ bloedgas 36 u tot 60 u 1,06-1,34 mmol/lpw Neonate capillary blood gas reference values", Clinical Biochemistry, Vol no 38, 2005, pp 905-907.

60 u tot 120 j 1,15-1,32 The concentration of Free Ions in the Blood Plasma by O. Siggaard-Andersen IFCC workshop Kopenhagen '80.

Calcium 2+ post filter (controle CCVH) citraat ≤4,0 mmol/L kliniek ErasmusMC

<1 j <2,0 Guidelines on Urolithiasis, European Association of Urology 2014 pg 70.

urine 1 j tot 3 j <1,5

Calcium/Kreatinine ratio 3 j tot 5 j <1,1 mol/mol

5 j tot 7 j <0,8 7 j tot 120 j <0,6

Calprotectine feces 0-50 mg/kg Phadia; Bijsluiter ELiATM Calprotectine, Versie 20, 2014-11 pg 3/4.

Calreticuline mutatie volbloed afwezig Somatic Mutations of Calreticulin in Myeloproliferative Neopl. Med 2013; 369:2379-2390 Dec.19, 2013 pg 2382.

CD3+T-Cellen 0,70-1,90

CD4+T-Cellen volbloed 0,40-1,30 x109/L Vademecum Laboratorium Medische Immunologie Erasmus MC - pg 80

(5)

CD8+T-Cellen 0,20-0,70 20 j tot 39 j <4,7 40 j tot 69 j <5,2

CEA ex-rokers serum 20 j tot 39 j <3,8 μg/L Bijsluiter Roche 2020

40 j tot 69 j <5,0

rokers 20 j tot 39 j <5,5

40 j tot 69 j <6,5

Cellen mononucleaire cellen liquor 0-5 x106/L Handboek medische laboratoriumdiagnostiek by H. Hooijkaas; 2e druk 2013-04-16 pg 150-151.

polynucleaire cellen 0-1

plasma 97-107 mmol/L Regiobesluit Rijnmond.

Chloride urine 18 j tot 60 j 110-250 mmol/24h Tietz (4th Edition): 2006, pg 2260.

60 j tot 120 j 95-195

Cholesterol plasma 0,0-6,5 mmol/L Regiobesluit Rijnmond

ascites geen geen

CK plasma 0-171 (M) U/L Artikel P. Franck Ned Tijdschr Klin Chem Labgeneesk 2010; 35: 240-243

0-145 (V)

CK-MB plasma 4,9-6,2 (M) µg/L Bijsluiter Roche

3,6-4,9 (V)

COD serum 19,6-28,0 mm Hg Verslag Osmomat 050, R. vdr Tuyn, 11-2017

CoHb bloedgas 0-5 % Tietz (4th Edition): Carl A. Burtis; 2006 pagina 2259.

Complement eiwit C3 plasma 0,84-1,68 g/L Regiobesluit Rijnmond

C4 160-420 mg/L

Corrected count increment (CCI) 1 uurs >7,5 Richtlijn Bloedtransfusie

24 uurs >4,5

serum 6 tot 10 AM 133-537 nmol/L Bijsluiter Roche 2020

Cortisol 4 tot 8 PM 68,2-327

urine 15-133 nmol/24h Conform Catharina Ziekenhuis, zie validatierapport Document

CRP plasma 0-10 mg/L Regiobesluit Rijnmond

Cryoglobuline (screening) neg Henry's Clinical Diagnosis and Management 21st edition

D-dimeer plasma <0,50 mg/L CBO Richtlijn 2009.

blast 18 j tot 120 j 0,2-2,6

eosinofiele granulocyt 18 j tot 120 j 1,4-6,2

basofiele granulocyt 18 j tot 120 j 0,0-0,4

lymfocyten 18 j tot 120 j 7,6-25,4

pro-/monocyt 18 j tot 120 j 0,2-2,8 Referentiewaarden Erasmus MC Afdeling Klinische Chemie 21 januari 2015 pagina 19 en 20.

plasmacel 18 j tot 120 j 0,2-3,6 https://www.vademecumhematologie.nl/artikelen/overige-

Differentiatie myeloid:erytroid ratio beenmerg 18 j tot 120 j 1,2-3,6 % richtlijnen-en-referentiewaarden/referentiewaarden-laboratoria/

totale erytropoiese:

pro-erytb,erytb,bas.erytb, 18 j tot 120 j 17,6-37,0

poly.erytb,orth.erytb

totale granulo.poiese: 18 j tot 120 j 35,2-75,0

(incl.eosinofielen,basofielen)

onrijpe granulo.poiese: 18 j tot 120 j 6,6-18,4

(promyelocyt + myelocyt) rijpe granulo.poiese:

(metamyel.,staafkern, 18 j tot 120 j 27,2-47,4

segm.kern gran.)

megakaryocyt 18 j tot 120 j 2-6 per veld

(6)

<6 m 0,0-2,0 eosinofiele granulocyten 6 m tot 7 j 0,0-0,8 7 j tot 120 j 0,0-0,5

basofiele granulocyten 0 d tot 120 j 0,0-0,2 Regionale uniformering van hematologische referentiewaarden by C. J. Pronk-Admiraal, 0 d tot 4 d 5,0-20,0 x109/L J.M. van Alphen-Jager en M.H. Herruer; Ned.Tijdschift klin Chem 1997, vol 22. no. 4

Differentiatie 4 d tot 6 m 1,0-8,5

6 m tot 3 j 1,0-9,0 3 j tot 7 j 1,5-9,0 7 j tot 16 j 1,5-8,0 neutrofiele granulocyten 16 j tot 120 j 1,5-7,5

<1 j 9-47

volbloed 1 j tot 2 j 14-56

2 j tot 3 j 18-62 % Erasmus MC Referentiewaarden kinderen Klinische Chemie, Hematologie en Endocrinologie september 2005 3 j tot 4 j 19-63

4 j tot 10 j 28-64 10 j tot 17 j 32-64

17 j tot 120 j 40-80 EMC Referentiewaarden volwassenen september 2003

Immature granulocyten 0,0-0,1 Florin et al. Establishment of common reference intervals for hematology parameters in adults, measured in a multicenter study on the Sysmex XN-series analyzer. Int J Lab Hematol 2020

<4 d 2,0-10,0

4 d tot 6 m 4,0-13,5 x109/L

6 m tot 3 j 1,5-8,0 Regionale uniformering van hematologische referentiewaarden by C. J. Pronk-Admiraal, 3 j tot 7 j 1,0-6,5 J.M. van Alphen-Jager en M.H. Herruer; Ned.Tijdschift klin Chem 1997, vol 22. no. 4

lymfocyten 7 j tot 16 j 1,0-5,0

16 j tot 120 j 1,0-3,5 0 j tot 1 j 43-79

1 j tot 2 j 35-75 Erasmus MC Referentiewaarden kinderen Klinische Chemie, Hematologie en Endocrinologie september 2005

2 j tot 4 j 27-73 %

4 j tot 17 j 24-58

17 j tot 120 j 15-50 EMC Referentiewaarden volwassenen september 2003

monocyten <4 d 0,0-2,0 x109/L Regionale uniformering van hematologische ref.waarden Ned.Tijdschift klin Chem 1997, vol 22. no. 4 4 d tot 120 j 0,1-1,0

Differentiatie mononucleaire cellen capd 0 % RBCC MaasstadLab

polymorfnucleaire cellen 0

albumine 34-50

Eiwitspectrum alfa1-globuline serum 1-3 g/L RBCC MaasstadLab

alfa2-globuline 5-10

beta-globuline 5,5-9,5

gamma-globuline 5,5-16,5

geen pancreas insufficiëntie >0,200

Elastase milde tot ernstige pancreas feces 0,100-0,200 mg/G Bijsluiter Liaison Elastase-1; 2019-03 insufficiëntie

ernstige pancreas insufficiëntie <0,100

ENA’s betreffende ENA blot, ALD blot, syst sclerose blot serum negatief Bijsluiters Euroimmun ANA Profile 3 Euroline DL_1590-3G_A_UK_C14 versie 2013-10-16, Euroimmun Liver

en myositis blot. Diseases IgG Euroline DL_1300-4G_A_UK_C06 versie 2014-12-03 en Euroimmun Myositis Profile 3 Euroline

<6 m 0,0-2,0

Eosinofielen absoluut volbloed 6 m tot 7 j 0,0-0,8 x109/L Regionale uniformering van hematologische referentiewaarden Ned.Tijdschift klin Chem 1997, vol 22. no. 4 7 j tot 120 j 0,0-0,5

(7)

<4 d 4,0-6,0 4 d tot 6 m 3,0-4,5

Erytrocyten volbloed 6 m tot 7 j 3,5-5,3 x1012/L Regionale uniformering van hematologische referentiewaarden Ned.Tijdschift klin Chem 1997, vol 22. no. 4 7 j tot 16 j 3,8-5,6

16 j tot 120 j 4,5-5,5

liquor 0-1 x106/L Handboek medische laboratoriumdiagnostiek by H. Hooijkaas; 2e druk 2013-04-16 pagina 150-151.

Ethanol plasma 0,0-0,1 0/00 Regiobesluit Rijnmond

Factor II (protrombinemutatie) volbloed negatief CBO Richtlijn 2009

Factor V-Leiden volbloed negatief CBO Richtlijn 2009

Ferritine plasma 30-400 (M) μg/L Roche bijsluiter

20-150 (V) Roche bijsluiter + Clin Chem Lab Med 2012;50(8):1343–1350

Fibrinogeen plasma 2,0-4,0 g/L Verificatierapport Stolling, 5.3 referentiewaarden iDoc.

Fibronectine vaginaal <50 ng/ml Ned. Tijdschr. Geneesk.2009;153:B398

vocht

<1 j geen

Foetale erytrocyten volbloed 1 j tot 120 j 0-1 (V) ‰ The estimation of fetomaternal haemorrhage:Transfusion Medicine, 1999, 9, 87–92.

0,0-4,0 (V) ml foet.bloed

Foliumzuur plasma >8,8 nmol/L Bijsluiter firma Roche

1 tot 30 d 1,25-2,25 (M) 1,40-2,50 (V) 1 tot 12 m 1,15-2,15 (M)

Fosfaat plasma 1,20-2,10 (V) mmol/L Bijsluiter firma Roche

1 tot 3 j 1,00-1,95 (M) 1,10-1,95 (V) 4 tot 6 j 1,05-1,80 7 tot 9 j 0,95-1,75 (M)

1,00-1,80 (V) 10 tot 12 j 1,05-1,85 (M) 1,05-1,70 (V) 13 tot 15 j 0,95-1,65 (M) 0,90-1,55 (V) 16 tot 18 j 0,85-1,60 (M) 0,80-1,55 (V)

>18 j 0,8-1,4 Regiobesluit Rijnmond

urine 12,9-42,0 mmol/24h Bijsluiter firma Roche

vrije kappa 3,3-19,4

Free Light Chain serum vrije lambda 5,7-26,3 mg/L Serum Free Light Chain Analysis 7th edition (revised 2015) - pagina 51.

serum K/Lratio 0,26-1,65 1,5-12,4 (M) foll. fase 3,5-12,5

FSH serum ovul. fase 4,7-21,5 U/L Bijsluiter Roche 2020

lut. fase 1,7-7,7

post. meno. 25,8-134,8

<1 m 16-50

FT4 (vrij T4) plasma 1 tot 11 m 14-22 pmol/L CALIPER database online voor kinderen.

1-18 j 13-21

>18 j 12-22 Bijsluiter Roche 2020

(8)

Gamma-GT plasma 0-55 (M) U/L Artikel P. Franck Ned Tijdschr Klin Chem Labgeneesk 2010; 35: 240-243 0-38 (V)

GFR-EPI >90 ml/min/1.73m2Levey AS et al. A new equation to estimate glomerular filtration rate. Ann Intern Med 2009; 150: 604–612.

Glucose plasma 4,1-6,1 mmol/L Bijsluiter firma Roche

Haptoglobine plasma 0,3-2,0 g/L Regiobesluit Rijnmond. + Bijsluiter firma Roche

HbA1c (glyco-Hb) volbloed 29-42 mmol/mol Bijsluiter firma Roche

HbA <1 j 10,0-100,0 Wintrobe's Clinical Hematology 11th edition, pagina 2205.

1 j tot 120 j 96,5-100,0

0 d tot 30 d 0,0-1,0 Wintrobe's Clinical Hematology 11th edition, pagina 2205. Diagnostic Pediatric Hematopathology

Hb-elektroforese HbA2 volbloed 30 d tot 1 j 2,0-3,5 % by Owen P. Smith, (kinderen.)

>1 j 2,0-3,5

HbC 0-0 Haemoglobinopathy Diagnosis, 2nd edition, 2004 by Barbara J. Bain

HbD 0-0

HbE 0-0

<30 d 40-90 Handboek medische laboratoriumdiagnostiek by H. Hooijkaas; K. Mohrmann; L.C. Smeets; J.H.M. Souverijn;

HbF 30 d tot 1 j 0-50 G.H.M. Tax 2e druk 2013-04-16 pagina 267-271.

1 j tot 2 j 0-2

>2 j 0-1

HbS 0-0 Haemoglobinopathy Diagnosis, 2nd edition, 2004

niet zwanger <5 post meno <8,3

week 3 5,8-71

HCG intact en β serum week 4 9,5-750 U/L Bijsluiter Roche 2020

week 5 217-7138

week 7 3697-163563 week 9 63803-151410 week 12 27832-210612

week 16 9040-56451

week 18 8099-58176

HDL-cholesterol plasma >0,90 (M) mmol/L Bijsluiter Roche

>1,15 (V)

<4 d 0,45-0,65 Regionale uniformering van hematologische referentiewaarden by C. J. Pronk-Admiraal, 4 d tot 7 j 0,30-0,42 J.M. van Alphen-Jager en M.H. Herruer; Ned.Tijdschift klin Chem 1997, vol 22. no. 4

Hematocriet volbloed 7 j tot 16 j 0,35-0,50

16 j tot 120 j 0,40-0,50 (M) 0,35-0,45 (V)

Hemochromatose DNA onderzoek (HFE mutatie) volbloed negatief Ned.Tijdschr Geneeskd 2003;147:652-6.

<4 d 8,5-12,5

4 d tot 7 j 6,0-9,0 Regionale uniformering van hematology ref.waarden; Ned.Tijdschift klin Chem 1997, vol 22. no. 4

Hemoglobine volbloed 7 j tot 16 j 6,5-10,0 mmol/L

16 j tot 120 j 8,5-11,0 (M) Regiobesluit Rijnmond.

7,5-10,0 (V)

Heparin Induced Trombocytopenia (HITT) serum negatief RBCC MaasstadLab

HLA-B57 volbloed

4% van bevolking is positief voor

HLA B *5701.

The Pharmacogenomics Journal (2015) 15, 196–200

Hoeveelheid urine 1000-3500 l/24h Water turnover in 458 American adults 40-79 yr of age American Journal of Physiology tot Renal

Physiology Published 1 February 2004 Vol. 286 no. 2, F394-F401

(9)

Homocysteine plasma <15,0 μmol/L Bijsluiter Roche 2020

<1 w 0,00-0,09

1 w tot 2 m 0,10-0,50 Reference intervals for serum lgG, IgA, IgM,C3, and C4 as determined by rate Nephelometry

IgA serum 2 m tot 6 m 0,10-0,70 g/L by Carl R. Jollift; Karen M. Cost; Patricia C. Stivrins; Patricia P. Grossman; Craig R. Nolte;

6 m tot 1 j 0,10-0,80 Sofia M. Franco; Kenneth J. Fijan; Larry L.

1 j tot 2 j 0,10-1,20 2 j tot 5 j 0,20-1,50 5 j tot 8 j 0,30-2,00 8 j tot 10 j 0,50-2,40 10 j tot 120 j 0,40-4,00

IgE specifiek serum 0,00-0,35 kU/L Phadia Bijsl.Imm.CAP® Phadiatop versie 7-3-2014 pag.1

<6 w 0,0-2,3 6 w tot 3 m 0,0-4,1

3 m tot 6 m 0,0-7,3 Regiobesluit Rijnmond.

IgE totaal serum 6 m tot 9 m 0,0-10,0 kU/L Firma Thermo Scientific Phadia Bijsluiter ImmunoCAP® Total IgE versie 4-10-2014

9 m tot 1 j 0,0-13,0 1 j tot 3 j 0,0-32,0 3 j tot 6 j 0,0-56,0 6 j tot 8 j 0,0-71,0 8 j tot 10 j 0,0-85,0

>10 j 0,0-100,0 Regiobesluit Rijnmond. Validatierapport VD-2011/IXPI-IGE

<1 w 6,4-16,1 1 w tot 1 m 2,5-9,1

1 m tot 2 m 2,1-6,0 Reference intervals for serum lgG, IgA, IgM,C3, and C4 as determined by rate Nephelometry

IgG serum 2 m tot 4 m 1,8-5,6 g/L by Carl R. Jollift; Karen M. Cost; Patricia C. Stivrins; Patricia P. Grossman; Craig R. Nolte;

4 m tot 6 m 1,7-7,0 Sofia M. Franco; Kenneth J. Fijan; Larry L.

6 m tot 9 m 2,2-9,0 9 m tot 1 j 2,9-12,1

1 j tot 3 j 4,2-11,4 3 j tot 5 j 4,6-12,4 5 j tot 120 j 7,0-16,0

urine 0,0-8,0 mg/L Regiobesluit Rijnmond.

liquor 5-59 Bijsluiter Chemistry Information Sheet © Copyright 2010 Beckman Coulter, Inc. Urine Immunoglobulin G pg 6

IgG-index serum 0,25-0,70 Tietz; Textbook of Clin.Chem, 3rd edition, 1998 pag. 579.

<1 w 0,0-0,3 1 w tot 3 m 0,2-0,9

IgM serum 3 m tot 9 m 0,3-1,3 g/L Reference intervals for serum lgG, IgA, IgM,C3, and C4 as determined by rate Nephelometry;

9 m tot 2 j 0,4-1,7 Clin Chem 1982; 28: 126-128.

2 j tot 8 j 0,5-2,1 8 j tot 10 j 0,5-2,4

10 j tot 120 j 0,4-2,3 Regiobesluit Rijnmond.

Immature platelet fraction volbloed 1-6 % Briggs et al. Assessment of an immature platelet fraction (IPF) in peripheral thrombocytopenia.

Br J Haematol 2004.

IJzer plasma 14-28 (M) µmol/L Regiobesluit Rijnmond.

10-25 (V)

IJzerverzadiging 20-45 % Richtlijn Hemochromatose NIV 2018

Janus kinase 2 (JAK2) mutatie volbloed niet aantoonbaar

(10)

Kalium plasma 3,5-5,0 mmol/L Regiobesluit Rijnmond.

urine 25,0-125,0 mmol/24u Bijsluiter Roche, regiobesluit Rijnmond

Ketonen volbloed (POCT) <0,6 mmol/L Burtis, Carl A. et al. 1999, Tietz Textbook of Clinical Chemistry, Philadelphia, PA; W.B. Saunders Co.

<2 m 27-81

2 tot 12 m 14-34

1 tot 3 j 15-31

3 tot 5 j 23-37

5 tot 7 j 25-42 Bijsluiter Roche & Ceriotti et al. Clin. Chem 2008;54:559-66. Reference intervals for serum creatinine

Kreatinine plasma 7 tot 9 j 30-48 µmol/L concentrations: assessment of available data for global application

9 tot 11 j 28-57

11 tot 13 j 37-63 13 tot 15 j 40-72

>15 j 59-104 (M)

>15 j 45-84 (V)

urine 9,0-19,0 (M)

6,0-13,0 (V)

Kreatinine klaring urine <1 j 40-60 ml/min Diagnostisch Kompas, 2003

>1 j 60-125

0 tot 1 j 0,6-2,4 plasma 1 tot 18 j 1,0-2,4

Lactaat > 18 j 0,5-2,2 mmol/L Bijsluiter Roche

<3 d 1,1-6,7 liquor 3 tot 10 d 1,1-4,4

>10 d 1,1-2,8

>18 j 1,1-2,4

Lactaat/Pyruvaat ratio 0,0-20,0 Vademecum metabolicum 2nd edition by J. Zschocke

0 tot 15 d 309-1222

15 d tot 1 j 163-452 Colantino et al.Clin.Chem 2012;58:854-68 (CALIPER)

LDH plasma 1 tot 2 j 192-321 U/L

2 tot 15 j 120-300 Bijsluiter Roche

>15 j 0-250

LDH pleura/ LDH plasma ratio 0,0-0,6 Fundamentals of Urine & Body Fluid Analysis,2nd Ed.2004

LDL-cholesterol plasma 0,0-4,1 mmol/L Roche bijsluiter (op basis van optimal t/m bordeline high)

<4 d 12-24

4 d tot 6 m 6-17

volbloed 6 m tot 3 j 4-16 x109/L Regionale uniformering van hem. ref.waarden Ned.Tijdschift klin Chem 1997, vol 22. no. 4.

Leukocyten 3 j tot 7 j 4-15

7 j tot 16 j 4-14 16 j tot 120 j 4-10

liquor 0-5 x106/L NVKC tijdschrift mei 1992, blz 111.

ascites geen RBCC MaasstadLab.

capd 0,0-0,1 x 109/L Adult Peritoneal Dialysis-related peritonitis treatment recommendations 2000 Per. Dial.Int.;2000;20;396-411.

pleura geen

punctaat geen Atlas of Synovial Fluid Analysis and Crystal Id-1991

(11)

1,7-8,6 (M)

foll. fase 2,4-12,6

LH ovul. fase serum 14,0-95,6 U/L Bijsluiter Roche 2020

lut. fase 1,0-11,4

post. meno. 7,7-58,5

Lipase plasma 13-60 U/L Bijsluiter Roche

Lupus anticoagulans plasma negatief Verificatierapport Stolling, 5.3 referentiewaarden iDoc

Magnesium plasma 0,70-1,05 mmol/L Regiobesluit Rijnmond.

<4 d 1,9-2,3 4 d tot 6 m 1,6-2,2

MCH volbloed 6 m tot 3 j 1,4-1,8 fmol Regionale uniformering van hem. ref.waarden Ned.Tijdschift klin Chem 1997, vol 22. no. 4.

3 j tot 7 j 1,5-1,9 7 j tot 16 j 1,5-2,0

16 j tot 120 j 1,7-2,1 Regiobesluit Rijnmond.

MCHC volbloed <7 j 19,0-23,0 mmol/L Regionale uniformering van hem. ref.waarden Ned.Tijdschift klin Chem 1997, vol 22. no. 4.

7 j tot 120 j 19,0-22,5

<4 d 100-120

4 d tot 6 m 75-110

MCV volbloed 6 m tot 3 j 70-85 fL Regionale uniformering van hem. ref.waarden Ned.Tijdschift klin Chem 1997, vol 22. no. 4.

3 j tot 7 j 70-90 7 j tot 16 j 75-95

16 j tot 120 j 80-100 Regiobesluit Rijnmond.

0,0-2,0 μmol/L

Metanefrine urine 0,0-3,0 μmol/24 uur Bijsluiter Metanephrines in urine en/of plasma m.b.v. HPLC en Fluorescentie detectie van firma Instruchemie 0-120 μmol/mol kreat

MetHb bloedgas 0-1,5 % Tietz (4th Edition): Carl A. Burtis; 2006 pagina 2286

Micro-albumine urine 0-30 mg/24 uur Regiobesluit Rijnmond.

geen CBO Richtlijn 2001; Gammopathie, Monoklonale.

albumine 34,0-50,0

M-proteine α1-globuline 1,0-3,0

α2-globuline serum 5,0-10,0 g/L RBCC MaasstadLab

β-globuline 5,5-9,5

γ-globuline 5,5-16,5

urine neg Diagnostisch Kompas 2003 pagina 781, 782

feces 18 j tot 120 j 2-50 Clin Chim Acta 1985;150:197–203.

Natrium plasma 135-145 mmol/L

urine 40-220 Regiobesluit Rijnmond.

bloedgas 136-147

0,0-5,0 μmol/L

Normetanefrine urine 0,0-7,5 μmol/24 uur Bijsluiter Metanephrines in urine en/of plasma m.b.v. HPLC en Fluorescentie detectie van firma Instruchemie 0-300 μmol/mol kreat

NT-ProBNP plasma 0-15 pmol/L Regiobesluit Rijnmond.

O2 verzadiging arterieel >60 u 95-98 % Regiobesluit Rijnmond.

(12)

41,4-159 (M) post meno <18,4-505

Oestradiol plasma foll. fase 114-332 pmol/L Bijsluiter firma Roche

ovul. fase 222-1959 lut. fase 222-854 1ste tri 563-11902 2de tri 5729-78098 3de tri 31287- >110100

feces 18 j tot 120 j 170-440 mosmol/ Clin Chim Acta 1985;150:197–203.

Osmolaliteit serum 279-297 kg H2O Stageopdracht MaasstadLab 2013 S. Ramzam.

urine 18 j tot 120 j 300-900 Tietz 4th ed. page 1718.

Oxy hemoglobine liquor 0,00-0,10 μmol/L RBCC MaasstadLab

Parathormoon plasma 1,00-8,00 pmol/L Siemens Immulite and Immulite 2000 Reference Range Compendium First Edition pg 48

PCP screening plasma 2,5-10,0

arterieel 60 u tot 120 j 35-48 Regiobesluit Rijnmond.

pCO2 capillair bloedgas 36 u tot 60 u 28,5-48,7 mm Hg Clinical Biochemistry, Vol no 38, 2005, pp 905-907.

veneus 60 u tot 120 j 42-50 Richtlijn D. Mellitus en zwangerschap versie 2.0 pagina 8.

PFA colageen/EPI volbloed 82-150 sec Overleg dr. M. Schellings met EMC (dr M. de Maat)

collageen/ADP 62-120

MBO prenataal >7,20 Royal Coll. of Obstetr. and Gyn. 2014, pagina 1058.

pH capillair bloedgas 36 u tot 60 u 7,31-7,47 Clinical Biochemistry, Vol no 38, 2005, pp 905-907.

arterieel 60 u tot 120 j 7,35-7,45 Regiobesluit Rijnmond.

veneus 60 u tot 120 j 7,32-7,38 Clin. physiology of acid-base disorders 5th 2001, pg 538.

pleura >7,2 Ned Tijdschr Geneeskd 2002;146:464-9.

pO2 arterieel bloedgas 60 u tot 120 j 75-100 mm Hg Regiobesluit Rijnmond.

capillair 36 u tot 60 u 32,8-61,2 Clinical Biochemistry, Vol no 38, 2005, pp 905-907.

uro-porfyrine 0,0-4,0

nmol/mmol

kreat De bepaling van profyrinen met behulp van HPLC in bloed, urine en faeces en zijn toepassing bij 0-40 nmol/L het vaststellen van porfyrieen by G.J.J. Beukeveld, G.T. Nagel, A.W. de Ruiter-Buitenhuis,

heptacarboxyl-porfyrine 0,0-2,0

nmol/mmol kreat

E.W. Kwarts en B.G. Wolthers , Tijdschrift NVKC 1985; 10: 223-231.

Porfyrine 0-10 nmol/L Porfyrines tot Resultaten onderzoek (1982)

hexacarboxyl-porfyrine urine 0,0-1,0

nmol/mmol kreat

0-5 nmol/L

pentacarboxyl-porfyrine 0-2

nmol/mmol kreat

0-10 nmol/L

copro-porfyrine 0,0-33,0

nmol/mmol kreat

0-300 nmol/L

copro I porfyrine 18 j tot 120 j 0,3-8,5

nmol/mmol

kreat Biochemical Differentiation of the Porphyrias, Clinical Biochemistry, Vol. 32, No. 8, 609–619, 1999.

copro III porfyrine 18 j tot 120 j 1,7-26,0

nmol/mmol kreat

<1 d 0-20

Procalcitonine plasma <2 d 0-10 Neonatology 2015;108:60–64

<3 d 0-2 µg/L

4d tot 2 m 0-1

>2 m 0-0,5 Bijsluiter Roche 2020

(13)

<0,159-0,474 (M)

foll. fase <0,159-0,616

ovul. fase 0,175-13,2

Progesteron lut. fase serum 13,1-46,3 nmol/L Bijsluiter Roche 2020

1ste tri 35-141

2de tri 80,8-265

3de tri 187-679

post. meno. <0,159-0,401

Prolactine serum 0,09-0,32 (M) IU/L Bijsluiter Roche 2020

niet zwanger 0,1-0,5 (V)

Prolactine post-PEG serum 0,06-0,25 (M) IU/L Reporting of POST-PEG prolactine: Time to Change Clinical Chemistry 2010, 56:3, 484–490.

0,08-0,38 (V)

< 40 j <1,4 40 tot 49 j <2,0

PSA plasma 50 tot 59 j <3,1 μg/L Bijsluiter Roche 2020

60 tot 69 j <4,1

>70 j <4,4

PT plasma 8-10,5 sec Verificatierapport Stolling, 5.3 Referentiewaarden iDoc.

PT-INR plasma 0,8-1,2 Verificatierapport Stolling, 5.3 Referentiewaarden iDoc.

PTH plasma 1,6-6,9 pmol/L Bijsluiter Roche 2020

<1 m 0,0-16,0 1 m tot 3 m 0,0-9,1

3 m tot 1 j 0,0-5,4 Nieuwsbrief van Neurochemisch laboratorium, Afdeling Neurologie, Laboratorium Genetische, Endocriene en Q-Albumine liquor 1 j tot 16 j 0,0-5,5 x10-3/L Metabole Ziekten, Afdeling Laboratoriumgeneeskunde UMC St Radboud, Nijmegen No. 07, februari 2010.

16 j tot 31 j 1,7-5,7 31 j tot 41 j 1,4-6,2 41 j tot 51 j 2,0-7,2 51 j tot 70 j 2,1-8,9

<1 m 0,0-13,3

1 m tot 3 m 0,0-7,1 Afgeleid uit Reiberdiagram.

Q-IgG liquor 3 m tot 1 j 0,0-7,1 x10-3/L Reporting Cerebrospinal fluid data: knowledge base and interpretation software, Neurochemisches Labor 1 j tot 16 j 0,0-3,9 der Neurologischen Klinik,Universität Göttingen,Robert-Koch Strasse 40, 37075 Göttingen,Germany.

16 j tot 31 j 0,0-2,2 31 j tot 51 j 0,0-2,8 51 j tot 70 j 0,0-3,5

<15 d 15-17

15 d tot 31 d 14-17

RDW volbloed 31 d tot 181 d 12-16 % Referentiewaarden Erasmus MC Afdeling Klinische Chemie 21 januari 2015 pagina 16

181 d tot 2 j 13-16 2 j tot 6 j 12-15 6 j tot 12 j 12-14 12 j tot 18 j 12-15 18 j tot 120 j 12-16

<4 d 15-130

Reticulocyten volbloed 4 d tot 16 j 30-85 x109/L Regionale uniformering van hem. ref.waarden Ned.Tijdschift klin Chem 1997, vol 22. no. 4 16 j tot 120 j 30-90

(14)

negatief, <3,5

Reumafactoren IgM dubieus, 3,5-5,0 iU/mL Phadia; Reumafactor IgM (p.31), versie 21 2017-04

positief >5,0

CT 161-204 sec

CFT 62-130

Alfa hoek 66-77

INTEM C MCF 51-69

A5 33-52 mm

A10 43-62

A20 50-68

CT 50-80 sec

CFT 46-149

Alfa hoek 63-83

ROTEM EXTEM C MCF volbloed 55-72 bijsluiter ROTEM Sigma.

A5 32-52 mm

A10 43-63

A20 52-70

CT 46-84 sec

MCF 6-21

FIBTEM C A5 5-20 mm

A10 6-21

A20 6-21

CT 41-80 sec

CFT 62-184

Alfa hoek 60-80

ABTEM C MCF 52-71

A5 28-50 mm

A10 39-61

A20 48-68

Rivaroxaban plasma Zie anti-Xa

20 tot 49 j 16,5-55,9 (M)

SHBG (Sex hormoon-binding globuline) serum 24,6-122 (V) nmol/L Intern onderzoek Roche (n=214)

≥50 j 19,3-76,4 (M) 17,3-125 (V)

aantal >20,0 x106/L

leuco’s <1,0 WHO Laboratory Manual for the Examination of Human Semen and Sperm-Vervical Mucus Interaction

Sperma analyse pH semen >7,2 4th edition 1999 pagina 60.

viscositeit geen

volume >2,0 mL

T3 serum 1,3-3,1 nmol/L Bijsluiter Roche 2020

(15)

Tanner 1 ≤0,025 (M) 0,025-0,061 (V)

Tanner 2 0,025-4,32 (M)

Testosteron serum 0,025-0,104 (V) ng/ml 2020-03, V 2.0 English bijsluiter Roche testosteron II

Tanner 3 0,649-7,78 (M)

0,025-0,237 (V)

Tanner 4 1,8-7,63 (M)

0,025-0,268 (V)

Tanner 5 1,88-8,82 (M)

0,046-0,383 (V) 20 tot 49 j 198-619 (M)

Testosteron vrij serum 3-33 (V) pmol/L Intern onderzoek Roche (n=214)

≥50 j 163-473 (M) 1-20 (V) Uitslag interpreteren in relatie tot

Thyreoglobuline (Tg) de voorgeschiedenis patiënt ng/mL

en de richtlijn schildklier- carcinoom

<1 w 44-76

plasma 1 w tot 1 j 51-73 g/L

1 tot 2 j 56-75

Totaal eiwit >2 j 60-80 Bijsluiter firma Roche

urine 0,00-0,14 g/24 uur

0 tot 1 w 0,45-1,09 1 w tot 1 m 0,51-1,01

liquor 1 tot 3 m 0,24-0,65 g/L

3 m tot 1 j 0,17-0,35 1 tot 10 j 0,16-0,31 10 tot 18 j 0,24-0,49

>18 j 0,18-0,58

Transferrine plasma 2,0-3,6 g/L Bijsluiter firma Roche

Triglyceriden plasma 0,00-2,00 mmol/L Regiobesluit Rijnmond.

Trombocyten volbloed <1 j 150-600 x109/L Regionale uniformering van hem. ref.waarden Ned.Tijdschift klin Chem 1997, vol 22. no. 4

>1 j 150-400 Regiobesluit Rijnmond.

Troponine-T plasma 0-14 ng/L Bijsluiter firma Roche

Tryptase serum 1,0-15,0 μg/L Serum levels in atopic and nonatopic child. Allergy Clin. Immunol. 2009 October; 124(4): 845–848 pg 845.

<1 m 1,23-27,2

TSH plasma 1 tot 11 m 1,03-6,8 mU/L Bijsluiter firma Roche

1 tot 14 j 1,12-5,01 15 tot 18 j 0,68-4,09

>18 j 0,27-4,2

Ureum plasma 2,5-6,4 mmol/L Regiobesluit Rijnmond

urine 428,0-714,0 mmol/24u Bijsluiter firma Roche

(16)

soortelijk gewicht 1,005-1,035 g/mL Diagnostisch Kompas 2003 pagina 781, 782.

albumine neg

bilirubine neg

algemeen bloed urine neg

onderzoek glucose neg

ketonen neg

Urine onderzoek leukocyten neg

nitriet neg

pH ≥18 j 5,0-7,5 RBCC Maasstad

urobilinogeen neg

erytrocyten geen

sediment leukocytencylinder geen per

erytrocytencylinder geen gezichtsveld

dysmorfe erytrocyten geen

plasma 0,20-0,42 (M) mmol/L Regiobesluit Rijnmond, EMC.

Urinezuur 0,12-0,34 (V)

urine 1,5-4,4 mmol/ 24h Tietz (2006) en Krieg et al (1986)

Vet kwalitatief feces normaal Manual of laboratory and diagn. tests 2nd ed 1984, pg.197

Vetzuur feces geen

B1 serum 78-143 nmol/L Ned Tijdschr Klin Chem Labgeneesk 2009; 34:35-43 pg.39

Vitamine B6 serum 37-111 nmol/L A multicenter effort to impr.comp vit.B6; Clin Chem Lab Med 2017.

B12 plasma 145-569 pmol/L Bijsluiter firma Roche

D 25(OH) serum 50-150 nmol/L Tietz Clinical Guide to laboratory Test 4th edition.

Referenties

GERELATEERDE DOCUMENTEN

Bijgevolg dient artikel 14, §§ 1 en 2, te worden geschrapt, met uitzondering van het tweede lid van paragraaf 1, in zoverre daarin bepaald wordt dat de dienst die belast wordt met

Schrijf op: weegt (blauwe hakkaart) 9 Steun maar op de stok.. Schrijf op: steun

Schrijf op: de poes (rode hakkaart) 9 De juf zegt: ‘Hoera!’ Schrijf op: zegt (blauwe hakkaart). Het is feest op

2 En u zult zich bekeren tot de HEERE, uw God, en Zijn stem gehoorzaam zijn, u en uw kinderen, met heel uw hart en met heel uw ziel, overeenkomstig alles wat ik u heden ge- bied..

[r]

Met de projecten werken we toe naar een dienstverlenende organisatie, waarin de klant centraal staat en waarin we continu leren en onszelf verbeteren.. Binnen de projecten zijn

Begane grond: algemene entree met tochtportaal en trapopgang naar de eerste verdieping, diverse kantoorkamers, vergaderruimte en toiletten.. Eerste verdieping: centrale hal met

VvPSY1_5’-ATG ATGTCTGTTGCTCTGTTGTGGATTG 60 Amplifies the full-length phytoene synthase 1 encoding gene (VvPSY1) from cDNA (1317 bp). VvPSY1_3’-STOP