The handle http://hdl.handle.net/1887/47933 holds various files of this Leiden University dissertation
Author: Janson, David
Title: Development of human skin equivalents mimicking skin aging : contrast between papillary and reticular fibroblasts as a lead
Issue Date: 2017-04-19
Papillary fibroblasts differentiate into reticular fibroblasts after prolonged in vitro culture
David Janson
1, Gaëlle Saintigny
2, Christian Mahé
2, Abdoelwaheb El Ghalbzouri
11
Department of Dermatology, Leiden University Medical Center, Leiden, The Netherlands
2
CHANEL Parfums Beauté, Paris, France
Experimental Dermatology, 2013, 22(1):48-53
Abstract
The dermis can be divided in two morphologically different layers: the papillary and reticular dermis. Fibroblasts isolated from these layers behave differently when cultured in vitro. During skin aging the papillary dermis decreases in volume. Based on the functional differences in vitro, it is hypothesized that the loss of papillary fibroblasts contributes to skin aging. In this study we aimed to mimic certain aspects of skin aging by using high passage cultures of reticular and papillary fibroblasts and investigated the effect of these cells on skin morphogenesis in reconstructed human skin equivalents.
Skin equivalents generated with reticular fibroblasts showed a reduced terminal differ- entiation and fewer proliferating basal keratinocytes. In vitro aged papillary fibroblasts had increased expression of biomarkers specific for reticular fibroblasts. The phenotype and morphology of skin equivalents generated with high passage papillary fibroblasts resembled that of reticular fibroblasts. This demonstrates that papillary fibroblasts can differentiate into reticular fibroblasts in vitro. Therefore, we hypothesize that papillary fibroblasts represent an undifferentiated phenotype, while reticular fibroblasts represent a more differentiated population. The differentiation process could be a new target for anti-skin aging strategies.
Introduction
The dermis consists of two distinct morphological layers. The upper, papillary dermis is localized right underneath the epidermis and stretches to approximately the first vascular plexus (rete subpapillare), while the reticular dermis consists of the deeper dermis. Both layers can be distinguished morphologically; cell density is increased in the papillary dermis, and the thickness of the extracellular matrix is increased in the reticular dermis (1). In addition, the expression and secretion of several matrix constituents differs in both layers. For example, decorin and collagen XVI are found mostly in the papillary dermis, whereas versican is associated with the reticular dermis (2, 3).
When fibroblasts from the respective layers are isolated and cultured in vitro, differ- ences are found between both subpopulations. For example, papillary fibroblasts show increased proliferation (4, 5) and have a more lean and spindle-shaped morphology (6) compared to reticular fibroblasts. Other differences were found in matrix production in culture (3, 7, 8), response to growth factors (9, 10) and production of growth factors (11, 12).
In a recent study, we have identified biomarkers that can distinguish reticular and papillary populations in vitro, both on RNA and protein levels (13). These markers are not only a useful tool to discriminate between the two fibroblasts populations, but also allow functional studies of the fibroblasts and their role in skin aging.
The most prominent marker of skin aging is the loss of the epidermal ridges. This is accompanied by morphological changes in the papillary dermis, a decrease in the number of papillary fibroblasts and changes in proteoglycans decorin and versican (2, 14, 15). The loss of papillary fibroblasts could have profound effects on skin homeostasis, because this population interacts differently with keratinocytes and generates a different matrix than reticular fibroblasts (2, 12). It was hypothesized that changes in skin physiology during skin aging might be explained by the phenomenon of the loss of papillary fibroblasts during aging (11).
In vitro cultures of primary cells have a limited lifespan (16). After prolonged culture cells will enter a stage called replicative senescence, which is likely to be caused by telomere stress (shortened telomeres) (17). The most important feature of cell senescence is a complete (and irreversible) cell cycle arrest. Senescent cells in vivo are believed to contribute to aging (18-21). However, whether replicative senescence in vitro and senescence in vivo are the same is not known (22, 23). It has been proposed that in vitro senescence is a form of differentiation (24).
In this study we used prolonged culture of papillary and reticular fibroblasts as a proxy for (cellular) aging. We hypothesized that papillary fibroblasts represent an undifferenti- ated phenotype and will differentiate into reticular fibroblasts during prolonged culture.
This has been proposed before, e.g. (7, 11). However, in this study we have used our specific biomarkers to support this hypothesis. Furthermore, we examined the effect of low- and high passage, papillary and reticular fibroblasts on epidermal morphogenesis in human skin equivalents.
Materials and Methods
Isolation and cell culture
Isolation of reticular and papillary fibroblasts was performed as described in literature, for example (12). In short, skin obtained from plastic surgery (mammary reduction or abdomen correction) was cleaned thoroughly and dermatomed at two different depths.
First, skin was dermatomed at 300 µm to obtain the epidermis and papillary dermis.
For the reticular dermis the skin was dermatomed at 700µm, and the upper part was discarded. The remaining (deep) dermis was used for isolation. Fibroblasts were isolated by treatment with Collagenase (Invitrogen, Breda, The Netherlands) and Dispase (Roche Diagnostics, Almere, The Netherlands), mixed in a 3:1 ratio for 2 hours at 37°C.
Fibroblasts were cultured in DMEM medium (Gibco/Invitrogen, Breda, The Nether- lands) containing 5% Fetal Calf Serum (FCS, HyClone, Thermo Scientific, Etten-Leur) and 1% penicillin-streptomycin (Invitrogen). They were kept at 37o C at 5% CO2. Five female, Caucasian, donors (between 39 and 49) were used in this study. From all donors both reticular and papillary fibroblasts were isolated, consequently all analyses were performed on a pairwise basis. When reaching confluency, fibroblasts were passaged at a 1:3 ratio.
A fraction of the fibroblasts was kept in prolonged culture for 15 to 20 passages (high passage). Low passage controls and fibroblasts used for other experiments were in passage 3 – 6. All experiments were performed on at least three different donors (both papillary and reticular from same donor).
Normal human epidermal keratinocytes were isolated from skin obtained from plastic surgery. First the entire skin was treated with Dispase II to separate the dermis from the epidermis. Subsequently, the epidermis was incubated in trypsin to isolate the keratinocytes. After filtering with a cell strainer (70µm pore size), the keratinocytes were seeded and cultured at 37o C at 7,3 % CO2. Keratinocyte medium consisted of DMEM and Ham’s F12 medium (3:1) supplemented with 5% FCS, 0.5µM hydrocortisone, 1µM isoproterenol, 0.1µM insulin (Sigma-Aldrich, Zwijndrecht, The Netherlands), 100 U ml-1 penicillin and 100µg ml-1 streptomycin (Invitrogen).
Patient consent was not required, because the use of surplus material obtained in accordance with the Dutch Law on Medical Treatment Agreement does not require patient consent.
Generation of Human Skin Equivalents
Human fibroblast-derived matrix (FDM) equivalents were generated as described earlier (25). Briefly, 2 * 105 fibroblasts were seeded into 6-well filter inserts (0.4µm pore size Transwell inserts, Corning Incorporated, Schiphol-Rijk, The Netherlands) and cultured submerged for 3 weeks using CNT-05 medium (CELLnTEC, Huissen, The Netherlands) supplemented with 50µM ascorbic acid.
After generation of the dermal equivalents 5 * 105 keratinocytes were seeded on top. Cultures were incubated overnight in keratinocyte medium as described above.
After this the models were cultured for two days in keratinocyte medium with 1% FCS, supplemented with 53µM selenious acid, 10mM L-serine, 10µM L-carnitine, 1µM dL- α-tocopherol-acetate, 250µM ascorbic acid phosphate, 24µM bovine serum albumin and a lipid supplement containing 25µM palmitic acid, 15µM linoleic acid and 7µM arachidonic acid (Sigma-Aldrich, Zwijndrecht, The Netherlands). After another two days, the cultures were air exposed and cultured in supplemented keratinocyte medium as described above, except that FCS was omitted and the concentration of linoleic acid was increased to 30µM. Medium was refreshed twice a week. After 17 days of air-exposed culture the FDM equivalents were harvested for analysis.
Quantitative RT-PCR
RNA was isolated from monolayer fibroblast culture with the RNEasy kit (Qiagen, Venlo, The Netherlands), according to manufacturer’s instructions. cDNA was generated of 1 µg RNA using the iScript cDNA synthesis kit (BioRad, Veenendaal, The Netherlands) according to manufacturer’s instructions. PCR reactions were based on the SYBR Green method (BioRad).The PCRs were run on the CFX-384 system (BioRad). The PCR cycles were: 3,5 minutes at 95 C to activate the polymerase, 35 cycles of 20 sec 95 C and 40 sec 60 C, followed by the generation of a melt curve. Expression analysis was performed with the BioRad CFX Manager Software and was based on the delta delta Ct method. The primers are listed in Table 1.
Histology and Immunohistochemistry
For immunohistochemical analyses on monolayer cell cultures, fibroblasts were grown on glass slides until nearly confluent, washed in PBS and fixed with 4% formaldehyde. Skin equivalents were processed and snap-frozen in liquid nitrogen or fixed in 4% formalde- hyde, dehydrated and embedded in paraffin. Sections were cut (5µm) and rehydrated in xylene and ethanol. For cryosections, 5µm were cut and fixed with acetone. Following incubation with the primary antibody or no addition of primary antibody for negative control, sections were stained with avidin-biotin-peroxidase system (GE Healthcare,
Target Sequence Forward Sequence Reverse
CCRL1 TGAGGGTCCTACAGAGCCAACCA CTCCCCCTTCCCCCAACCCA
CDH2 ATGTGCCGGATAGCGGGAGC ACAGACGCCTGAAGCAGGGC
CNN1 AGCGGAAATTCGAGCCGGGG GGTGCCCATCTGCAGCCCAA
EI24 TTCACCGCATCCGTCGCCTG GAGCGGGTCCTGCCTTCCCT
NTN1 CCAACGAGTGCGTGGCCTGT CCGGTGGGTGATGGGCTTGC
PDPN GCCACCAGTCACTCCACGGAGAA TTGGCAGCAGGGCGTAACCC
SND1 CGTGCAGCGGGGCATCATCA TGCCCAGGGCTCATCAGGGG
TGM2 GGTGTCCCTGCAGAACCCGC CGGGGTCTGGGATCTCCACCG
Table 1: Primers used for qPCR analysis. EI24 and SND1 were used as reference genes for normalization of expression.
Hoevelaken, The Netherlands), as described by manufacturer’s instructions. Staining was visualized with DAB (3,3’diaminobenzidine tetrahydrochloride) and sections were counterstained with haematoxylin.
Global morphologic analysis was performed on 5µm thick paraffin sections stained with haematoxylin and eosin (HE).
Antibodies
The antibodies used in this study were: monoclonalα-SMA (1A4, Sigma) 1:800, mono- clonal Calponin (CALP, Abcam) 1:50, polyclonal Collagen I (SouthernBiotech) 1:20, poly- clonal Collagen III (SouthernBiotech) 1:20, monoclonal Collagen IV (PHM12, Chemicon) 1:75, monoclonal Filaggrin (FLG01, Neomarkers) 1:500, monoclonal Involucrin (SY5, Monosan) 1:500, monoclonal Keratin 10 (DE-K10, abcam) 1:100, monoclonal Keratin 16 (LL025, Serotec) 1:50, monoclonal Ki67 (MIB1, DAKO) 1:100, polyclonal Laminin 332 (LAM5, kind gift of Dr. A. Aumailley) 1:75, polyclonal Loricrin (AF62, Covance) 1:800, monoclonal Podoplanin (18H5, Abcam) 1:250, polyclonal Small Proline Rich Protein 2 (kind gift from Dr. C. Backendorf ) 1:1000 and monoclonal TGM2 (CUB7402, Abcam) 1:75.
Results
Papillary fibroblasts express reticular markers after prolonged culture
After passaging (P16 – P22), both papillary and high passage reticular populations showed signs of senescence; they had larger cell bodies and about 20% – 40% of the cells were positive for Senescence Associated Beta Galactosidase staining. However, the cells retained significant proliferative capacity (data not shown).
The expression of papillary markers, measured by qPCR, was decreased in high passage papillary fibroblasts compared to low passage papillary controls. The expression
of reticular markers was increased in high passage papillary fibroblasts compared to low passage controls (figure 1).
Immunohistochemical analysis of the low passage populations for the biomarkers of reticular and papillary fibroblasts showed that papillary biomarker PDPN is highly expressed in papillary fibroblasts and shows little to no expression in reticular fibroblasts.
Reticular markers TGM2 and CNN1 were highly expressed in a large number of reticular fibroblasts, although not in every cell. TGM2 and CNN1 were only expressed in a small fraction of papillary cells. Moreα-SMA positive cells were present in the reticular populations, although the number of positive cells was quite low. Evaluation of the high passage reticular fibroblasts revealed that the expression of markers had not changed compared to low passage reticular fibroblasts, except a small increase inα-SMA positive cells (data not shown). In contrast, high passage papillary fibroblasts showed a decrease in PDPN staining and an increase in the number of positive cells for TGM2, CNN1 and α-SMA (figure 2).
Epidermal proliferation and terminal differentiation are differentially regulated by papillary and reticular fibroblasts in FDM
To study the effects of both subpopulations on the dermal and epidermal morphogenesis of the skin, FDM full-thickness equivalents were generated with either papillary or reticular fibroblasts as a dermal substrate (papFDM and retFDM respectively). Since in FDM the dermal substrate is completely formed by the fibroblasts and the molecules they secrete, this model is suitable to investigate matrix deposition and dermal morphology. As shown in figure 3, retFDMs showed a much denser matrix compared to papFDMs.
Macroscopically, reticular equivalents had a poorer looking epidermis than papillary equivalents. Cornification was incomplete in the center of the reticular equivalents and the epidermis was irregular compared to papillary equivalents, which had a complete, smooth epidermis. This was confirmed in HE-stained cross sections of the equivalents.
Reticular equivalents showed fewer keratinocytes, more chaotic differentiation patterns and fewer terminally differentiated cells (figure 3).
In addition, we observed that the epidermal compartments of retFDMs were more disorganized compared to papFDMs. When we evaluated the effect on basement mem- brane formation, no differences could be observed in the expression of collagen type IV.
This protein was expressed at the dermal-epidermal junction irrespective of the fibroblast populations used for generation of the FDMs (data not shown). Similar results were found for collagen type VII and laminin 332 (data not shown). Collagen I and III were expressed abundantly throughout the dermis (data not shown).
The epidermises of retFDMs had a more chaotic differentiation pattern and fewer
Figure 1: qPCR analysis of reticular and papillary markers. Papillary markers showed decreased expression in high passage papillary and low passage reticular fibroblasts, while reticular marker expression was increased in high passage papillary fibroblasts.
Bars represent the average of three donors. Error bars represent SEM. Differences between the different populations were significant, calculated by ANOVA and Tukey HSD test.
Figure 2: Analysis of the expression of reticular (CNN1, TGM2), papillary (PDPN) and myofibroblast (α-SMA) markers in monolayer cultures of low and high passage papillary and low passage reticular fibroblasts. In low passage fibroblasts the expression of these markers was as expected: PDPN was highly expressed in papillary fibroblasts, while expression in reticular fibroblasts was low. CNN1 and TGM2 were expressed in most reticular fibroblasts and hardly in papillary fibroblasts. Myofibroblast markerα-SMA was more expressed in reticular fibroblasts than in papillary fibroblasts. After passaging, papillary fibroblasts had a phenotype that was more similar to reticular fibroblasts: low expression of PDPN and increased expression of CNN1, TGM2 andα-SMA. Scale bars: 50 µm.
terminally differentiated keratinocytes (figure 3). There was more staining for terminal differentiation markers filaggrin (figure 3), loricrin and small proline rich protein 2 (data not shown) in the stratum granulosum and stratum corneum of papFDMs compared to retFDMs. In the latter, the markers were only expressed in a single cell layer underneath the stratum corneum. Another terminal differentiation marker, involucrin, was aberrantly expressed in retFDMs: expression was found throughout the entire epidermis. Involucrin was expressed only in the upper layers of the epidermis in papFDMs, similar to native skin (figure 4). Expression of general differentiation marker Keratin 10, was not different between retFDMs and papFDMs (data not shown). Proliferation marker Ki67 revealed a significantly higher number of proliferating basal keratinocytes in papFDMs (19 +/- 4 %) compared to retFDMs (15 +/- 4%) (data not shown).
Long cultured, papillary fibroblasts have a reticular phenotype in skin equivalents
FDMs were generated that contained high or low passage, papillary or reticular fibroblasts (papFDM and retFDM). Differences between low passage retFDMs and low passage papFDMs were as described above.
High passage retFDMs showed less matrix deposition and contained a thinner epider- mis (data not shown). High passage papFDMs appeared similar to low passage retFDMs;
the matrix was denser and the number of differentiated keratinocytes was decreased (figure 3).
Low- and high passage papFDMs and low passage retFDMs were analyzed by im- munohistology for the following markers: reticular markers TGM2 and CNN1, terminal differentiation marker filaggrin and involucrin, and epidermal stress marker keratin 16.
CNN1 was not expressed in low passage papFDM, but was expressed in 20 – 60% in high passage papFDM and 43 – 68% in low passage retFDM (figure 4). TGM2 clearly stained the basal layer of the epidermis in all FDMs. In fibroblasts, TGM2 expression was not found in low passage papFDM. In high passage papFDM TGM2 was expressed in 10 – 25% of the fibroblasts and in low passage retFDM it was expressed in 12 – 40% of the fibroblasts.
As shown in figure 4, FDM generated with papillary fibroblasts show increased terminal differentiation compared to reticular fibroblasts. Analysis of filaggrin staining showed that the number of filaggrin positive layers was higher in low passage papFDMs, but not in in high passage papFDMs, compared to retFDM. As before, involucrin was aberrantly expressed in low- and high passage retFDMs. Involucrin was expressed in the upper part of the epidermis of low passage papFDMs, but expression started lower and was more variable in high passage papFDMs. In these equivalents epidermal stress marker keratin 16 showed occasional staining in low passage retFDMs, but not in low passage papFDMs.
The entire epidermis was stained in high passage retFDMs. High passage papFDMs again
Figure 3: Macroscopic pictures and haematoxylin stained sections of FDM equivalents generated with low- and high passage papillary and low passage reticular fibroblasts. Low passage equivalents showed the differences described earlier: papillary FDM had a looser dermal matrix and more keratinocytes in the epidermis. High passage papillary FDM were more similar to low passage reticular FDM; they had a dense dermal matrix and a more chaotically and a more sparsely populated epidermis. This was also visible in the macroscopic pictures taken right before harvesting. Low passage papillary equivalents had a smooth and regular epidermis, while high passage papillary and low passage reticular FDM showed incomplete cornification and a rough epidermis. High passage reticular FDM showed less dermal matrix deposition and less epidermal differentiation.
Scale bars: 50µm.
more closely resembled low passage retFDMs than low passage papFDMs (figure 4).
Discussion
Papillary and reticular fibroblasts behave differently in in vitro monolayer cultures. Fur- thermore, in skin equivalents generated with an artificial dermal substrate it was shown that reticular fibroblasts are less able to support keratinocytes to form a completely differentiated epidermis (11). In a previous study we identified biomarkers for papillary and reticular fibroblasts (13). In this study we validated and expanded on these results by generating FDM skin equivalents. In FDM extracellular matrix is secreted by fibroblasts and subsequently used as a dermal substrate for keratinocytes. As in the in vivo situ- ation, we have found that papillary fibroblasts generated a looser matrix than reticular fibroblasts. In addition, terminal differentiation of keratinocytes was more effective and proliferation of basal keratinocytes was increased in equivalents generated with papillary fibroblasts.
After prolonged in vitro culture, papillary fibroblasts developed a more reticular phenotype. This was based on the expression of several biomarkers for reticular and papillary cells and the behavior of the fibroblasts in FDMs. In the latter, equivalents generated with high passage papillary fibroblasts more closely resembled low passage reticular equivalents than low passage papillary equivalents in terms of morphology and epidermal morphogenesis.
These findings support the hypothesis that fibroblasts undergo a differentiation pro- cess in vitro (7, 11, 24). Papillary fibroblasts then represent a more undifferentiated phenotype and reticular fibroblasts are further into this differentiation process. This could also explain the observed heterogeneity within the populations, as not all fibroblasts will differentiate at the same rate. At the final stage of this differentiation process the cells appear to become a myofibroblast or a myofibroblast-like cell. The expression of myofibroblast markerαSmooth Muscle Actin is increased in high passage fibroblasts, as well as in reticular fibroblasts (which again hints that reticular fibroblasts represent a more differentiated population). In addition, the markers used for reticular fibroblasts (CNN1 and TGM2) both have been implicated in myofibroblast function and the contractile apparatus of cells and CNN1 is often used as a marker of smooth muscle tissue (26, 27).
Whether there is a relation with cell senescence is unknown. Earlier work hints that fibroblast (TGF-β1-induced) differentiation and replicative senescence, which is caused by in vitro aging, are different processes (28). Nonetheless, it is not possible to distinguish between effects of fibroblast senescence and differentiation in the results presented here.
The volume of the papillary dermis decreases during in vivo skin aging. This leads to a relative increase in reticular fibroblasts and decrease in papillary fibroblasts. It
Figure 4: Immunohistochemical analysis of FDM equivalents generated with low- and high passage papillary and low passage reticular fibroblasts. Calponin 1 (CNN1) was expressed in most fibroblasts of all reticular equivalents and in high passage papillary equivalents, but not in low passage papillary equivalents. Transglutaminase 2 (TGM2) expression in fibroblasts was higher in high-passage equivalents. In addition, it was increased in reticular equivalents. Filaggrin expression was only in the upper layers of the epidermis. However, there were more positive layers in low-passage papillary equivalents than in high-passage equivalents and reticular equivalents. Involucrin was expressed in the upper layers of the epidermis of low passage papFDM, but in low passage papFDM and all retFDM it was expressed more often in the lower spinous layers. The markers at the side of the pictures show the stained cell layers. Keratin 16 expression was not found in low passage papFDM, and occasionally in low passage retFDM and high passage papFDM. Scale bars: 50µm.
is hypothesized that this affects skin homeostasis and consequentially contributes to aging of the skin. The obtained results could have three implications for this model.
First, the fibroblast subpopulations have different effects on the epidermis. As described before (11), the reticular fibroblasts induce less terminal differentiation and keratinocyte proliferation. In vivo, aging results in reduced epidermal proliferation and affects barrier function of the skin (29, 30). These changes could in part be explained by the shift from fibroblasts with a papillary phenotype to a reticular phenotype.
Second, in vivo dermis has two distinct layers based on the matrix density. This is reflected in FDM skin equivalents generated with papillary fibroblasts or reticular fibroblasts. The former generate a looser matrix than the latter. The decrease of the papillary dermal volume in aged skin encompasses the loss of the loose matrix underneath the epidermis. This may well lead to different physical properties, such as elasticity, in aged skin.
Last, papillary fibroblasts have the propensity to differentiate into reticular fibroblasts when left to their own devices in in vitro culture. There are two main theories as to why papillary fibroblasts are lost during skin aging (7, 11). It is possible that papillary fibroblasts are more sensitive (or more often exposed) to stressors and therefore are preferentially lost. Or papillary fibroblasts differentiate into reticular fibroblasts as time progresses. The results obtained in this study favor the latter theory, although it remains uncertain to what extent this in vitro phenomenon can be extrapolated to in vivo aging.
Restoring the papillary dermis in aged skin is a potential rejuvenation strategy. One interesting observation is that dermabrasion restores the papillary dermis (31). This suggests that the aged skin is still capable of forming the papillary dermis, but that this is suppressed. Skin equivalents could prove a valuable tool in investigating the hypothesis that restoring the reticular fibroblasts to a more papillary phenotype is beneficial for aging skin. One hurdle is that, as of yet, there is no reliable method to change reticular fibroblasts into papillary fibroblasts.
Another question that remains is the role of the markers we have used to distinguish between the reticular and papillary fibroblasts. It is known that the reticular markers are related to contraction and myofibroblast differentiation. But whether they actively contribute to the differentiation process is not known.
All in all, we found that papillary fibroblasts differentiate into reticular fibroblasts when kept in prolonged culture. Whether this is reversible or preventable and to what extent it is comparable to the changes that occur in in vivo skin is unknown. In addition, we have investigated functional differences, utilizing skin equivalents, between reticular and papillary fibroblasts in relation to skin homeostasis. In general, equivalents generated with reticular fibroblasts resemble a more “aged” phenotype than did their papillary counterparts. This suggests a role for fibroblast differentiation in skin aging and offers
a potential new mechanism that can be targeted for intervention.
Conflict of interest
GS and CM are employees of CHANEL Parfum Beauté. AEG declares the receipt of a grant from CHANEL. The other author declares no conflict of interest.
Acknowledgements
We would like to thank Prof. Rein Willemze, Dr. Frank de Gruijl and Dr. Nelleke Gruis of the Department of Dermatology, Leiden University Medical Center (LUMC), Leiden, The Netherlands for carefully reading the manuscript. The work was supported by CHANEL Parfum Beauté, Paris, France.
References
1. Ross MH, Pawlina W. Histology: A Text and Atlas. 6th ed. Baltimore, MD: Lippincott Williams &
Wilkins, 2011.
2. Sorrell JM, Caplan AI. Fibroblast heterogeneity: more than skin deep. J Cell Sci 2004: 117:667- 675.
3. Schonherr E, Beavan LA, Hausser H, Kresse H, Culp LA. Differences in decorin expression by papillary and reticular fibroblasts in vivo and in vitro. Biochem J 1993: 290 ( Pt 3):893-899.
4. Azzarone B, Macieira-Coelho A. Heterogeneity of the kinetics of proliferation within human skin fibroblastic cell populations. J Cell Sci 1982: 57:177-187.
5. Harper RA, Grove G. Human skin fibroblasts derived from papillary and reticular dermis:
differences in growth potential in vitro. Science 1979: 204:526-527.
6. Schafer IA, Pandy M, Ferguson R, Davis BR. Comparative observation of fibroblasts derived from the papillary and reticular dermis of infants and adults: growth kinetics, packing density at confluence and surface morphology. Mech Ageing Dev 1985: 31:275-293.
7. Izumi T, Tajima S, Nishikawa T. Differential expression of alpha 1 and alpha 2 chains of type VI collagen in the upper, middle, and lower dermal fibroblasts in vitro. J Biochem 1995: 117:1004- 1007.
8. Tajima S, Pinnell SR. Collagen synthesis by human skin fibroblasts in culture: studies of fibroblasts explanted from papillary and reticular dermis. J Invest Dermatol 1981: 77:410-412.
9. Feldman SR, Trojanowska M, Smith EA, Leroy EC. Differential responses of human papillary and reticular fibroblasts to growth factors. Am J Med Sci 1993: 305:203-207.
10. Tajima S, Izumi T. Differential in vitro responses of elastin expression to basic fibroblast growth factor and transforming growth factor beta 1 in upper, middle and lower dermal fibroblasts.
Arch Dermatol Res 1996: 288:753-756.
11. Mine S, Fortunel NO, Pageon H, Asselineau D. Aging alters functionally human dermal papillary fibroblasts but not reticular fibroblasts: a new view of skin morphogenesis and aging. PLoS ONE 2008: 3:e4066.
12. Sorrell JM, Baber MA, Caplan AI. Site-matched papillary and reticular human dermal fibrob- lasts differ in their release of specific growth factors/cytokines and in their interaction with keratinocytes. J Cell Physiol 2004: 200:134-145.
13. Janson DG, Saintigny G, van AA, Mahe C, El GA. Different Gene Expression Patterns in Human Papillary and Reticular Fibroblasts. J Invest Dermatol 2012: 132:2565-2572.
14. Giangreco A, Goldie SJ, Failla V, Saintigny G, Watt FM. Human Skin Aging Is Associated with Reduced Expression of the Stem Cell Markers beta1 Integrin and MCSP. J Invest Dermatol 2009:
130:604-608.
15. Oh JH, Kim YK, Jung JY, Shin JE, Chung JH. Changes in glycosaminoglycans and related proteoglycans in intrinsically aged human skin in vivo. Exp Dermatol 2011: 20:454-456.
16. Hayflick L. The limited in vitro lifetime of human diploid cell strains. Exp Cell Res 1965: 37:614- 636.
17. Allsopp RC, Vaziri H, Patterson C et al. Telomere length predicts replicative capacity of human fibroblasts. Proc Natl Acad Sci U S A 1992: 89:10114-10118.
18. Erusalimsky JD, Kurz DJ. Cellular senescence in vivo: its relevance in ageing and cardiovascular disease. Exp Gerontol 2005: 40:634-642.
19. Jeyapalan JC, Sedivy JM. Cellular senescence and organismal aging. Mech Ageing Dev 2008:
129:467-474.
20. Dimri GP, Lee X, Basile G et al. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci U S A 1995: 92:9363-9367.
21. Ressler S, Bartkova J, Niederegger H et al. p16INK4A is a robust in vivo biomarker of cellular aging in human skin. Aging Cell 2006: 5:379-389.
22. de Magalhaes JP. From cells to ageing: a review of models and mechanisms of cellular senescence and their impact on human ageing. Exp Cell Res 2004: 300:1-10.
23. Maier AB, Westendorp RG. Relation between replicative senescence of human fibroblasts and life history characteristics. Ageing Res Rev 2009: 8:237-243.
24. Bayreuther K, Rodemann HP, Hommel R, Dittmann K, Albiez M, Francz PI. Human skin fibroblasts in vitro differentiate along a terminal cell lineage. Proc Natl Acad Sci U S A 1988:
85:5112-5116.
25. El Ghalbzouri A, Commandeur S, Rietveld MH, Mulder AA, Willemze R. Replacement of animal- derived collagen matrix by human fibroblast-derived dermal matrix for human skin equivalent products. Biomaterials 2008: 30:71-78.
26. Huang L, Haylor JL, Hau Z et al. Transglutaminase inhibition ameliorates experimental diabetic nephropathy. Kidney Int 2009: 76:383-394.
27. Kulkarni AA, Thatcher TH, Olsen KC, Maggirwar SB, Phipps RP, Sime PJ. PPAR-gamma ligands repress TGFbeta-induced myofibroblast differentiation by targeting the PI3K/Akt pathway:
implications for therapy of fibrosis. PLoS ONE 2011: 6:e15909.
28. Untergasser G, Gander R, Lilg C, Lepperdinger G, Plas E, Berger P. Profiling molecular targets of TGF-beta1 in prostate fibroblast-to-myofibroblast transdifferentiation. Mech Ageing Dev 2005:
126:59-69.
29. Gilhar A, Ullmann Y, Karry R et al. Aging of human epidermis: reversal of aging changes correlates with reversal of keratinocyte fas expression and apoptosis. J Gerontol A Biol Sci Med Sci 2004: 59:411-415.
30. Seyfarth F, Schliemann S, Antonov D, Elsner P. Dry skin, barrier function, and irritant contact dermatitis in the elderly. Clin Dermatol 2011: 29:31-36.
31. Freedman BM, Rueda-Pedraza E, Waddell SP. The epidermal and dermal changes associated with microdermabrasion. Dermatol Surg 2001: 27:1031-1033.
