Biochemical and biomechanical regulation of the myofibroblast phenotype
Piersma, Bram
IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below.
Document Version
Publisher's PDF, also known as Version of record
Publication date: 2017
Link to publication in University of Groningen/UMCG research database
Citation for published version (APA):
Piersma, B. (2017). Biochemical and biomechanical regulation of the myofibroblast phenotype: focus on Hippo and TGFβ signaling. Rijksuniversiteit Groningen.
Copyright
Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).
Take-down policy
If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.
Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum.
CHAPTER
4
YAP SYNERGIZES WITH THE TGFΒ/SMAD AXIS TO
REGULATE PRO-FIBROTIC SIGNALING
Bram Piersma
1, Rutger AF Gjaltema
1, Saskia de Rond
1, Theo Borghuis
1,
Nataly Puerta Cavanzo
1, Miriam Boersema
2, Ruud A Bank
11
University of Groningen, University Medical Center Groningen,
Department of Pathology and Medical Biology, MATRIX Research Group.
2
University of Groningen, Research Institute for Pharmacy, Division of
Pharmaceutical Technology and Biopharmacy.
ABSTRACT
Extracellular matrix stiffening is an active player in the development of fibrosis. YAP is a mechanosensitive transcriptional co-activator that associates with Smad transcription factors, the signal transducers of the TGFβ1 cascade. Here, we studied the mechanisms that govern activation of YAP in response to substrate stiffness and TGFβ1 exposure in human fibroblasts. YAP nuclear accumulation after TGFβ1 exposure was found to be dependent on actin polymerization, together with myosin II activity. TGFβ1-induced activation of Smad2/3 resulted in association with YAP and nuclear accumulation of YAP/ Smad complexes. Smad3 knockdown antagonized nuclear accumulation of YAP, which could be mimicked by treatment with verteporfin, a known inhibitor of YAP function. Moreover, independent of stiffness, verteporfin blocked nuclear accumulation of YAP, Smad2 and Smad3, and resulted in decreased expression of signature myofibroblast genes. Our data indicate that ECM stiffening promotes pro-fibrotic TGFβ1 signaling by inducing YAP/Smad cross-talk. Harnessing the clinically approved drug verteporfin may be a promising strategy in targeting YAP/Smad-mediated fibrogenesis.
4
INTRODUCTION
One of the hallmarks of pathological fibrosis is the cross-linking of ECM components in response to transforming growth factor (TGF)β1, resulting in a stiffer matrix which is difficult to degrade1,2. Despite decades of research, few anti-fibrotic therapies have reached the clinic, underlining the need for a thorough understanding of the underlying molecular mechanisms that lead to pathological fibrosis3. Recent findings suggest that ECM stiffening in itself plays an active role in the activation of myofibroblasts, key cells in the development of fibrosis4. Increased ECM stiffness has a profound effect on the myofibroblast phenotype via the activation of the pro-fibrotic signaling cascades of TGFβ/Smad2,5, Rho kinase6, and myocardin related transcription factor (MRTF)7. Hence, targeting the perpetuation of mechanical signals—a process termed mechanotransduction—has become a promising direction for new therapeutic modalities.
Yes associated protein 1 (YAP) is a mechanosensitive transcriptional co-activator and together with its ortholog TAZ are the major effectors of the Hippo signaling cascade8,9. In response to inactivation of the Hippo cascade, YAP accumulates in the nucleus and associates with transcription factors of the TEAD family to regulate transcription of target genes10.Besides Hippo-mediated activation, YAP was shown to be subject to mechanical signals9. In epithelial cell layers, cell-cell contacts regulate YAP activation in a Hippo-dependent fashion. Cells growing at low population density display nuclear YAP, whereas confluent cell layers show cytoplasmic localization of YAP, corroborating the paradigm of contact inhibition of proliferation9,11. Moreover, matrix stiffness regulates nuclear YAP accumulation. Increased tissue stiffness—measured by the increased elastic modulus E—results in nuclear accumulation of YAP, and subsequent activation of YAP/TEAD-mediated gene expression9. Actin polymerization and formation of stress fibers has been put forward as main orchestrator of YAP localization, whereas myosin II activity also influences YAP12.
Recently, we and others found that in both epithelial cells and fibroblasts YAP nuclear accumulation can be induced by the actions of the pro-fibrotic cytokine transforming growth factor (TGF)β113–17. Moreover, we showed that YAP regulates the myofibroblast phenotype by increasing the expression of genes such as COL1A1 and ACTA2. However, how TGFβ1 is able to activate YAP and govern the myofibroblast phenotype remains elusive. The notion that YAP is governed by F-actin polarization, but may also be Smad dependent, led us to hypothesize that TGFβ1-induced nuclear accumulation of YAP is subjected to multiple layers of regulation. Here, we investigate the activation of YAP in response to TGFβ1 exposure, with focus on substrate stiffness and Smad signaling. In this study we demonstrate that YAP localization depends on actin polymerization and active myosin II. Subsequently, we show that Smad2 and Smad3 form a complex with YAP after TGFβ1 exposure and identify a crucial role for Smad3 in the nuclear accumulation of YAP. Treatment with the benzoporphyrin derivative verteporfin (VP) inhibits YAP/Smad complex formation and prevents nuclear accumulation of
Figure 1. TGFβ1 induced YAP nuclear translocation is F-actin and myosin II dependent. (A) Human
dermal fibroblasts were cultured on fibronectin coated hydrogels of 1 kPa and 25 kPa or borosilicate glass and exposed to TGFβ1 for 24 hours. Representative immunofluorescent images show YAP localization (green) and nuclei (blue, DAPI). Empty arrowheads indicate cytoplasmic or diffuse localization; filled arrowheads indicate nuclear localization. (B) Experimental setup: human dermal fibroblasts on 1 kPa
4
YAP/Smad2 and YAP/Smad3 complexes. Taken together, TGFβ1 induces complex formation and nuclear accumulation of YAP/Smad2/3. Verteporfin treatment abolishes nuclear complexes and excludes both YAP and Smad2/3 from the nucleus, thereby antagonizing TGFβ1-induced transcription of signature myofibroblast genes.
METHODS
Reagents and antibodies
Reagents were as follows: human plasma fibronectin (2 µg/cm2, F1056; Sigma-Aldrich, Munich, Germany), human recombinant TGFβ1 (5 ng/mL, 100-21C; Peprotech, London, UK), Phalloidin-iFluor 647 (1:1000, ab176759; Abcam, Cambridge, UK), Control siRNA-F (10 pM, sc-44234; Santa Cruz Biotechnology, Santa Cruz, USA), siRNA-YAP (10 pM, sc-38637; Santa Cruz Biotechnology), siRNA-Smad2 (10 pM, sc-38374; Santa Cruz Biotechnology), siRNA Smad3 (10 pM, sc-38376; Santa Cruz Biotechnology), latrunculin B (5 µM, 428020; Merck Millipore, Billerica, USA), blebbistatin (50 µM, B0560; Sigma-Aldrich), SB-431542 (10 µM, S4317; Sigma-Sigma-Aldrich), verteporfin (250 nM, SML0534; Sigma-Aldrich), MG132 (2-5 µM, M8699; Sigma-Aldrich). Antibodies used are denoted in Supplementary Table 1.
Cell manipulations
Primary human dermal fibroblasts (CC-2511; Lonza, Basel, Switzerland) were sub-cultured in Dulbecco’s modified Eagle medium (DMEM, 12-604F; Lonza) containing 50 U/L penicillin/streptomycin (15140122; Thermo Fisher Scientific, Landsmeer, the Netherlands) and 10% fetal bovine serum (FBS; Sigma-Aldrich). Before commencing experiments, cells were verified to be mycoplasm free. Starvation and experiments were performed in DMEM containing 50 U/L penicillin/streptomycin, 0.5% FBS and 17 mM ascorbic acid (A8960; Sigma-Aldrich). For YAP localization experiments, cells were cultured on fibronectin functionalized substrates with elastic moduli of 1 (soft) and 25 (stiff) kilo Pascal (kPa) (Matrigen Life Technologies, Brea, USA), as described before18. Cells were seeded at 15.000/cm2, starved for 18 hours and exposed to small molecule inhibitors for 1 hour in advance of TGFβ1 stimulation. For protein knock down, cells were transfected with siRNA against Smad2, Smad3, YAP or a nonsense sequence as control using Lipofectamine RNAiMax reagent (13778150; Thermo Fisher Scientific) and starved after 8 hours, before starting experiments.
substrates were pre-incubated with the small molecule inhibitors latrunculin B, blebbistatin, or verteporfin to block actin polymerization, myosin II activity, and YAP activity, respectively, followed by 24 hours of TGFβ1 stimulation. (C) Immunofluorescence for YAP (green), nuclei (blue, DAPI) and actin (red) after actin and myosin inhibition. Empty arrowheads indicate cytoplasmic or diffuse localization; filled arrowheads indicate nuclear localization. (D) Immunofluorescence for YAP and nuclei (blue, DAPI) after verteporfin exposure. Empty arrowheads indicate cytoplasmic or diffuse localization; filled arrowheads indicate nuclear localization. Images are representative for n=3 independent experiments. Original magnification × 630. (E) YAP mRNA expression after 72 hours in the presence of TGFβ1 and verteporfin. Two-Way ANOVA with Bonferroni post hoc analysis. (F) immunoblot showing YAP and YWHAZ after 72 hours in the presence of TGFβ1 and verteporfin. DAPI, 4',6-diamidino-2-phenylindole; kPa, kilo Pascal; TGFβ1, transforming growth factor-β1; YAP, Yes-associated protein; YWHAZ, tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide.
Figure 2. YAP complexes with Smad2 and Smad3 on TGFβ1 exposure. (A) Experimental setup of (B):
human dermal fibroblasts on 1 kPa substrates were pre-incubated with the small molecule inhibitor SB-431542 for 1 hour, and exposed to TGFβ1 for 24 hours. (B) Immunofluorescence for YAP (green), nuclei (blue, DAPI) and actin (red) after TGFβ type I receptor inhibition. Empty arrowheads indicate cytoplasmic or diffuse localization; filled arrowheads indicate nuclear localization. Original magnification × 630. (C) Proximity ligation assay (PLA) for YAP/Smad2, YAP/Smad3, and YAP/Smad2/3 demonstrating molecular proximity. Human dermal fibroblasts were cultured on borosilicate cover glass and exposed to TGFβ1 for 24 hours. Original magnification × 630. (D–F) PLA quantification of n=1 experiments of (D) YAP/Smad2, (E) YAP/Smad3, and (F) YAP/Smad2/3. The number of interactions were counted in a blind fashion. Welch’s unequal variances t-test; ** p<0.01, *** p<0.001. DAPI, 4',6-diamidino-2-phenylindole; kPa, kilo Pascal; TGFβ1, transforming growth factor-β1; YAP, Yes-associated protein.
RNA isolation, cDNA conversion and real-time PCR
Briefly, total RNA was isolated by lysis in RLT buffer containing 20 mM 1,4-dithiothreitol (DTT; Sigma-Aldrich), and purification through spin columns (74104; Qiagen, Venlo, the Netherlands). RNA purity and quality was analyzed using capillary electrophoreses and LabChip GX software version 5.2.2009.0 (Perkin Elmer, Groningen, the Netherlands). For real-time PCR, 1 µg RNA was reversed transcribed first strand cDNA synthesis kit (K1621; Thermo Fisher Scientific) and used in semi-quantitative PCR using Sybr Green PCR mix (04673484001; Roche, Basel, Switzerland) and a VIIA7 thermal cycling system (Thermo Fisher Scientific). Primer sequences used are denoted in Supplementary
4
Figure 3. Smad3 but not Smad2 is crucial for nuclear accumulation of YAP. (A) Experimental setup:
human dermal fibroblasts were treated with siRNA against Smad2 or Smad3, starved, and exposed to TGFβ1 for 24 hours. (B) Representative immunofluorescent images of cells on soft 1 kPa substrates treated with Smad2 siRNA showing YAP (green) and nuclei (blue, DAPI) staining. Shown are representative images of n=3 independent experiments. (C) Quantification of nuclear Smad2 levels. Data represent mean ± standard deviation of Smad2 intensity levels in the nucleus of n=3 independent experiments. Student’s t -test; *** p<0.001 (D) Representative immunofluorescent images of cells on soft 1 kPa substrates treated with Smad3 siRNA showing YAP (green) and nuclei (blue, DAPI) staining. Shown are representative images of n=3 independent experiments. (E) Quantification of nuclear Smad3 levels. Data represent mean ± standard deviation of Smad3 intensity levels in the nucleus of n=3 independent experiments. Student’s t -test. Original magnification × 630. DAPI, 4',6-diamidino-2-phenylindole; kPa, kilo Pascal; TGFβ1, transforming growth factor-β1; YAP, Yes-associated protein.
Table 2.
Immunofluorescence microscopy and proximity ligation assay
Immunofluorescence was performed as described previously15. Briefly, cells were fixed in 2% PFA in PBS, permeabilized in 0.5% Triton X-100 in PBS, and blocked with antibody diluent (2.2% bovine serum albumin (BSA) in PBS/0.1% Triton X-100). Primary antibodies were diluted in antibody diluent at 4°C for 18 hours. Secondary Alexa Fluor 647-labeled antibodies were incubated in antibody diluent for 1 hour at room temperature. All washing steps were performed in PBS + 0.05% Tween 20. Nuclei were visualized with DAPI and the actin cytoskeleton was labeled with fluorescent-labeled phalloidin. Finally, stained specimens were mounted in SlowFade Diamond mountant (Thermo Fisher Scientific). Protein interactions were visualized using an in situ proximity ligation assay as described previously20. Briefly, cells were fixed in 2% PFA in PBS, permeabilized in 0.5% Triton X100 in PBS, and blocked with antibody diluent (2.2% BSA in PBS/0,1% Triton X100). Primary antibodies were incubated in antibody diluent at 4°C for 18 hours. Next, cells were incubated with PLA Probe Anti-Mouse MINUS and PLA Probe Anti-Rabbit PLUS (Sigma-Aldrich) in antibody diluent at 37 °C for 1 hour, followed by enzymatic ligation and rolling PCR amplification according to manufacturer's instructions (DUO92008l; Sigma-Aldrich). Nuclei were visualized with DAPI. Finally, stained specimens were mounted in SlowFade Diamond mountant (Thermo Fisher Scientific). Fluorescent photomicrographs (16 bit) were acquired using a SP8 scanning confocal microscope equipped with photomultiplier tubes (PMTs) (Leica Microsystems, Amsterdam, the Netherlands) and a HC PL APO CS2 63x/1.4 oil immersion objective at room temperature. Alexa Fluor 647 fluorescence was visualized with a spectral detection system set at 595–650 nm. PLA fluorescence was visualized with a spectral detection system set at 640–700 nm. To quantify nuclear intensities of YAP, Smad2, and Smad3, nuclei were masked and used for quantification of the mean fluorescent signal intensity using the Dipimage toolbox and a customized script in Matlab R2015a (MathWorks, Eindhoven, the Netherlands). All quantification was performed on the raw 16-bit images. For presentation, images were corrected equally for background and converted to 8-bit TIF images.
Immunoblotting
Immunoblotting was performed as described previously15, with slight adaptations. Briefly, equal amounts of cell lysates were subjected to SDS-PAGE, with 0.1% 2,2,2-trichloroethanol (T54801; Sigma-Aldrich) added to polyacrylamide gels, for visualization of total protein levels21. Proteins were transferred to a nitrocellulose membrane, and probed with primary and secondary antibodies in TBS containing 0.05% Tween 20 and 5% non-fat milk or 5% BSA. Chemiluminescence was recorded using a Chemidoc imaging system (Bio-Rad, Hercules, CA, USA) and processed with ImageLab software version 5.2.1 (Bio-Rad). Protein levels were normalized to total protein levels as described before21.
4
Figure 4. YAP does not regulate Smad2 nuclear accumulation. (A) Experimental setup: human dermal
fibroblasts were treated with siRNA against YAP, starved, and exposed to TGFβ1 for 24 hours. (B) Representative immunofluorescent images of cells on soft 1 kPa substrates treated with YAP siRNA showing Smad2 (green) and nuclei (blue, DAPI) staining. Shown are representative images of n=3 independent experiments. (C) Quantification of nuclear Smad2 levels in (B). Student’s t-test (D) Representative immunofluorescent images of cells on stiff 25 kPa substrates treated with YAP siRNA showing Smad2 (green) and nuclei (blue, DAPI) staining. Shown are representative images of n=3 independent experiments. (E) Quantification of nuclear Smad2 levels in (D) Data represent mean ± standard deviation of Smad2 intensity levels in the nucleus of n=3 independent experiments. Two-way ANOVA with Bonferroni post-test. ** p<0.01. Original magnification × 630. DAPI, 4',6-diamidino-2-phenylindole; kPa, kilo Pascal; TGFβ1, transforming growth factor-β1; YAP, Yes-associated protein.
Statistics
All statistics were performed using Graphpad Prism software version 7.01 (GraphPad Software, Inc. La Jolla, CA, USA).
RESULTS
Previously, we and others have shown that TGFβ1 induces nuclear accumulation of YAP on soft 1 kPa substrates, whereas YAP is constitutively nuclear on stiff substrates including 25 kPa hydrogels and glass15–17. Several reports demonstrated that YAP nuclear accumulation depends on a functional actin cytoskeleton that is able to transduce mechanical cues from the environment22–26. Additional work suggests that YAP is also regulated by myosin activity, via the actin-binding protein angiomotin27. Therefore, we investigated the mechanism of nuclear YAP accumulation on TGFβ1 exposure in human fibroblasts. Protein localization will be referred to as follows: cytoplasmic (mostly cytoplasmic and nuclear exclusion), diffuse (equal distribution between cytoplasm and nucleus), and nuclear (mostly or complete nuclear localization). We found that YAP localization is diffuse with a fraction of cells showing a weak nuclear localization, when cultured on soft 1 kPa substrates (normal stiffness), whereas YAP is constitutively nuclear on 25 kPa substrates (pathological stiffness) and 65 GPa glass (non-physiological stiffness) (Figure 1A). TGFβ1 stimulation on soft substrates resulted in the formation of actin stress fibers and nuclear accumulation of YAP (Figure 1A), a feature that could be blocked by inhibition of actin polymerization with latrunculin B (Figure 1B, C). To test the role of cell contractility and cytoskeletal tension on YAP localization in fibroblasts, we inhibited myosin II with blebbistatin treatment. We found that blocking the interaction of myosin II with actin dramatically altered the morphology of actin stress fibers, which acquired a dendritic appearance, both in the presence and absence of TGFβ1. Interestingly, inhibition of myosin II activity resulted in a decrease of nuclear YAP and overall cells showed more diffuse localization of YAP (Figure 1B, C), indicating that YAP localization is in part mediated by actin tension and contractility.
The benzoporphyrin derivative verteporfin has been shown to specifically inhibit nuclear accumulation of YAP and interactions with TEADs28. However, recent findings suggest that verteporfin also induces cytoplasmic sequestering of YAP via 14-3-3 proteins and subsequent proteasomal degradation16,29. We detected a decrease in nuclear YAP with most cells displaying diffuse localization after verteporfin treatment, which is consistent with previous findings (Figure 1D). However, we found that both in the presence and absence of TGFβ1, verteporfin does not affect either YAP mRNA expression (Figure 1E) or protein levels (Figure 1F). Additionally, verteporfin treatment reduced the expression of several signature myofibroblast genes, including
ACTA2, COL1A1, ED-A FN, and CCN2 as opposed to siRNA mediated YAP silencing
4
Figure 5. YAP does not regulate Smad3 nuclear accumulation. (A) Experimental setup: human dermal
fibroblasts were treated with siRNA against YAP, starved, and exposed to TGFβ1 for 24 hours. (B) Representative immunofluorescent images of cells on soft 1 kPa substrates treated with YAP siRNA showing Smad3 (green) and nuclei (blue, DAPI) staining. Shown are representative images of n=3 independent experiments. (C) Quantification of nuclear Smad3 levels in (B). (D) Representative immunofluorescent images of cells on stiff 25 kPa substrates treated with YAP siRNA showing Smad3 (green) and nuclei (blue, DAPI) staining. Shown are representative images of n=3 independent experiments. (E) Quantification of nuclear Smad3 levels in (D). Data represent mean ± standard deviation of Smad3 intensity levels in the nucleus of n=3 independent experiments. Two-way ANOVA with Bonferroni post-test. Original magnification × 630. DAPI, 4',6-diamidino-2-phenylindole; kPa, kilo Pascal; TGFβ1, transforming growth factor-β1; YAP, Yes-associated protein.
Figure 6. Verteporfin antagonizes nuclear accumulation of YAP/Smad complexes. (A) Experimental
setup: human dermal fibroblasts were pre-incubated with verteporfin for 1 h, followed by TGFβ1 stimulation for 24 h. (B) Representative immunofluorescent images of cells on soft 1 kPa and stiff 25 kPa substrates, showing Smad2 (green) nuclei staining (DAPI, blue). Shown are representative images of n=3 independent experiments. (C) Quantification of Smad2 nuclear intensity when cultured on 1 and 25 kPa substrates. Two-way ANOVA with Bonferroni post-test; * p<0.05, ** p<0.01, *** p<0.001. (D) Representative
4
YAP is a mechanosensitive transcriptional co-factor that has been shown to interact with Smad2 and Smad3 on TGFβ1 exposure in epithelial cells and fibroblasts13,16. Therefore, we asked whether YAP is directly or indirectly regulated by signaling through the type I TGFβ receptor. Although TGFβ1 is able to induce nuclear accumulation of YAP, small molecule-mediated inhibition of the TGFβ type I receptor (SB431542) did not prevent nuclear accumulation of YAP (Figure 2A, B). This suggests that TGFβ1 mediated YAP accumulation in the nucleus is, at least in part, independent of the canonical TGFβ1 signaling through Alk4, Alk5, and Alk7. Recent reports have shown that YAP interacts with the Smad2/3 complex13,16, however, both reports focused on the interaction with Smad2/3 combined, while Smad2 and Smad3 are known to behave differently after TGFβ exposure30,31. Hence, we asked whether YAP interacts with single Smad2 or Smad3 in the context of substrate stiffness and TGFβ1 exposure. We observed that YAP associates with both Smad2 and Smad3 in unstimulated cells (Figure 2C). Exposure to TGFβ1, however, increased the number of interactions with Smad2, Smad3 and total Smad2/3 in the nucleus (Figure 2C–F). To establish whether YAP accumulation in the nucleus is Smad dependent, we silenced the translation of Smad2 and Smad3 and visualized the localization of YAP on soft (1 kPa) and stiff (25 kPa) fibronectin functionalized substrates (Figure 3A). Interestingly, we found that Smad3, but not Smad2 is essential for nuclear accumulation of YAP, independent of substrate stiffness (Figure 3B–E), although the majority of cells still showed low levels of nuclear YAP. Vice versa, we observed that YAP deficiency does affect neither Smad2 localization (Figure 4A–C) nor Smad3 localization after TGFβ1 exposure (Figure 5A–C). Interestingly, in contrast to other reports16, we did not find nuclear accumulation of Smad2 (Figure 4) or Smad3 (Figure 5) in response to increased substrate stiffness.
Because YAP localization is Smad3 dependent and YAP exits the nucleus on verteporfin treatment, we asked whether verteporfin influenced Smad localization. Immunofluorescence revealed that verteporfin blocked the nuclear accumulation of Smad2 and Smad3 on TGFβ1 stimulation (Figure 6A–E), a feature not observed after siRNA mediated YAP knockdown. Additionally, we found that verteporfin drastically reduced the total levels of both Smad2 and Smad3, both independent of proteasomal degradation (Figure 6F and Supplemental Figure 2). Moreover, verteporfin antagonizes the nuclear accumulation of YAP/Smad complexes but does not alter the total number of interactions, suggesting that verteporfin blocks nuclear anchorage
immunofluorescent images of cells on soft 1 kPa and stiff 25 kPa substrates pre-incubated with verteporfin for 1 h, followed by TGFβ1 stimulation for 24 h, showing Smad3 (green) nuclei staining (DAPI, blue). Shown are representative images of n=3 independent experiments. (E) Quantification of Smad3 nuclear intensity when cultured on 1 and 25 kPa substrates. Two-way ANOVA with Bonferroni post-test; * p<0.05, ** p<0.01, *** p<0.001. (F) Whole cell lysates from cells incubated with verteporfin for 1 h, followed by TGFβ1 stimulation for 24 h were immunoblotted and probed for Smad2 and Smad3. (G) Quantification of PLA signals for YAP/ Smad2 in cells treated with verteporfin and TGFβ1. (H) Quantification of PLA signals for YAP/Smad3 in cells treated with verteporfin and TGFβ1. Data represent n=3 independent experiments. Two-way ANOVA with Bonferroni post-test; **** p<0.0001. Original magnification × 630. DAPI, 4',6-diamidino-2-phenylindole; DMSO, dimethyl sulfoxide; kPa, kilo Pascal; TGFβ1, transforming growth factor-β1; VP, verteporfin; YAP, Yes-associated protein.
of YAP/Smad complexes, but does not interfere with complex formation per se (Figure 6G, H and Supplemental Figure 3). Taken together, our data show that YAP is a mechanosensitive regulator that acts in synergy with the TGFβ/Smad2/3 axis to control the myofibroblast phenotypical switch, which can be therapeutically targeted using verteporfin.
DISCUSSION
Although it has been shown that YAP regulates the myofibroblast phenotype, the exact mechanism of TGFβ1-induced YAP nuclear translocation remains elusive. Here we show that TGFβ1-induced nuclear accumulation of YAP is dependent on Smad3, together with actin polymerization and myosin II activity (Figure 7). Our data suggest that the myofibroblast phenotype depends on the signaling of both YAP, Smad2, and Smad3. Additionally, we found that in human fibroblasts, the benzoporphyrin derivate verteporfin abolished nuclear accumulation of YAP, Smad2 and Smad3, irrespective of substrate stiffness. We revealed that silencing of YAP and chemical inhibition using verteporfin result in a radical different gene expression profile, suggesting that verteporfin has other functions besides the direct inhibition of YAP.
ECM stiffening is one of the hallmarks of organ fibrosis, and ECM-induced biomechanical signal transduction has been shown to amplify biochemical signaling cascades, including the TGFβ1/Smad and YAP/TAZ pathways14,16,32. Not only does ECM stiffening induce activation of these signaling proteins, but it also invokes a positive feedback loop, where additional synthesis and post-translational modification of ECM components exacerbate the fibrotic response14. In the present study, we demonstrated how the nuclear accumulation of YAP is regulated by both the actin cytoskeleton and TGFβ1 signaling. Actin polymerization is thought to inhibit angiomotin proteins, which causes YAP/angiomotin dissociation and translocation into the nucleus27. Additionally, we found myosin II activity to be important for YAP localization, as myosin II inhibition with blebbistatin caused reduced nuclear accumulation of YAP. This is possibly due to the fact that blebbistatin inhibits myosin II/actin interactions, thereby altering polymerization status and the formation of stress fibers. Moreover, TGFβ1-induced Rho/Rock activation may also affect actin-mediated nuclear accumulation of YAP9, corroborating the notion that TGFβ1-induced YAP activation requires cytoskeletal tension. Another explanation of our findings may lie in the link between smooth muscle α-actin (αSMA) and YAP. Recent findings suggest that YAP activity and nuclear accumulation depend on the polymerization of αSMA positive stress fibers26. Since αSMA polymerization depends on myosin II activity, blebbistatin treatment may also invoke αSMA de-polymerization, and subsequent YAP cytoplasmic retention33,34. We identified the molecular interaction between YAP and Smad3 and could corroborate the existing paradigm of stiffness-induced pro-fibrotic signaling14,35. Smad3 drives the expression of multiple pro-fibrotic genes36, suggesting how inactive YAP impedes
4
expression of both TEAD and Smad3 target genes37,38. Our data are in line with recent observations that showed complex formation between YAP and Smad2/313,16. However, these reports only studied the Smad2/3 heterodimer or Smad2 as interactor of YAP, whereas both Smads have widely different functions in fibrosis30,39,40. We demonstrated that YAP interacts with both Smad2 and Smad3 under the influence of TGFβ1, which is in accordance with a recent report describing RASSF1A as negative regulator of TGFβ signaling by interfering with Smad2 and YAP activation17. TGFβ1 exposure targets RASSF1A for degradation, causing a shift in binding partners of YAP from p73 to Smad2. Smads bind to the DNA with low affinity, and therefore may require YAP and other co-factors, including p300 and CBP, for transcriptional regulation. Our data indicate that TGFβ1 induces nuclear accumulation of YAP/Smad2 and YAP/Smad3 complexes that regulate the expression of signature myofibroblast genes, a process mediated by actin polymerization and myosin-II activity.
Verteporfin is currently used as a photosensitizer in photodynamic therapy for the treatment of neovascular macular degeneration41. We found that verteporfin treatment negates YAP/Smad nuclear accumulation and target gene expression, indicating that the FDA approved compound verteporfin may prove a potential anti-fibrotic therapy in both early and late stages of fibrosis. More importantly, we found significant differences in gene expression when we silenced YAP with verteporfin, in contrast to small interfering RNA directed against YAP. This could either mean that minute levels of YAP are sufficient to reach maximum transcriptional activity, or that verteporfin has additional targets next to YAP. Of note, in our previous study we found that silencing YAP mRNA did prove sufficient to attenuate the transcription of target genes, but
Figure 7. Proposed model for the interaction between YAP and Smad2/3 in myofibroblasts and targeting of the signal transduction using Verteporfin.
these experiments were performed in primary cells from other donors15, suggesting that siRNA-mediated YAP silencing may result in donor specific effects. Verteporfin has already been shown to be effective in preventing early-stage pre-clinical fibrosis in the kidney and liver16,42. However, the mechanisms underlying verteporfin action are yet incompletely understood. It is thought that verteporfin binds to YAP with high affinity, changing its conformation and ability to interact with TEAD transcription factors28. Verteporfin-induced proteasomal degradation through the interaction with 14-3-3σ has been proposed as alternative mechanism of YAP inhibition29. Interestingly, degradation of YAP was only found at verteporfin concentrations exceeding 1 µM, whereas our data demonstrate robust YAP inhibition at 250 nM concentrations without affecting YAP levels, suggesting that degradation by the proteasome is not the main mechanism of action. Finally, verteporfin causes dramatic reduction in the nuclear accumulation of YAP/Smad complexes, as well as nuclear accumulation of Smad2 and Smad3 in the presence of TGFβ1. YAP silencing, however, did not affect nuclear anchoring of Smads, indicating that verteporfin may target Smads directly. Other studies propose that verteporfin causes protein oligomerization of high molecular weight proteins such as Stat343. Because Stat3 is also involved in mechanotransduction and regulates the expression of ECM components44, inhibiting Stat3 activity may prove another mechanisms of verteporfin action. Hence, we postulate that verteporfin has multiple targets besides YAP, warranting thorough biochemical analysis of verteporfin pharmacology. Increased stiffening of the ECM together with aberrant TGFβ signaling activity regulate the phenotypical switch of quiescent cells into pro-fibrotic myofibroblasts. In fibroblasts, both stiffness and TGFβ1 activate the transcriptional-coactivator YAP through multiple layers of regulation, including the actin cytoskeleton and Smad2/3 nuclear shuttling. We have demonstrated that YAP and Smad2/3 synergistically promote the switch to a myofibroblast phenotype, a feature that can be blocked with the benzoporphyrin derivate verteporfin.
ACKNOWLEDGEMENTS
We would like to thank Kèvin Knoops for help with FIJI and Matlab analysis, and Anna Wil Bosma for excellent technical assistance. 8xGTIIC-luc was a gift from Stefano Piccolo (Addgene plasmid #34615). SBE4-luc was a gift from Bert Vogelstein (Addgene plasmid #16495). This work was supported by the Netherlands Institute for Regenerative Medicine (NIRM) grant FES0908 and the Dutch Kidney Foundation (R.A.B.).
4
REFERENCES
1. Rockey, D. C., Bell, P. D. & Hill, J. A. Fibrosis--a common pathway to organ injury and failure. N. Engl. J.
Med. 372, 1138–49 (2015).
2. Klingberg, F., Hinz, B. & White, E. The myofibroblast matrix: implications for tissue repair and fibrosis. The
Journal of Pathology 229, 298–309 (2013).
3. Friedman, S., Sheppard, D., Duffield, J. & Violette, S. Therapy for Fibrotic Diseases: Nearing the Starting Line. Sci Transl Medicine 5, 167sr1–167sr1 (2013).
4. Janmey, P. A., Wells, R. G., Assoian, R. K. & McCulloch, C. A. From tissue mechanics to transcription factors. Differentiation 86, 112–20 (2013).
5. Shi, M. et al. Latent TGF-β structure and activation. Nature 474, 343–349 (2011).
6. Zhou, Y. et al. Inhibition of mechanosensitive signaling in myofibroblasts ameliorates experimental pulmonary fibrosis. J. Clin. Invest. 123, 1096–108 (2013).
7. Miralles, F., Posern, G., Zaromytidou, A.-I. I. & Treisman, R. Actin dynamics control SRF activity by regulation of its coactivator MAL. Cell 113, 329–42 (2003).
8. Yagi, R., Chen, L., Shigesada, K., Murakami, Y. & Ito, Y. A WW domain-containing Yes-associated protein (YAP) is a novel transcriptional co-activator. The EMBO Journal 18, 2551–62 (1999).
9. Dupont, S. et al. Role of YAP/TAZ in mechanotransduction. Nature 474, 179–83 (2011).
10. Piccolo, S., Dupont, S. & Cordenonsi, M. The biology of YAP/TAZ: hippo signaling and beyond. Physiol.
Rev. 94, 1287–312 (2014).
11. Kim, N.-G. G., Koh, E., Chen, X. & Gumbiner, B. M. E-cadherin mediates contact inhibition of proliferation through Hippo signaling-pathway components. Proc. Natl. Acad. Sci. U.S.A. 108, 11930–5 (2011). 12. Wada, K.-I., Itoga, K., Okano, T., Yonemura, S. & Sasaki, H. Hippo pathway regulation by cell morphology
and stress fibers. Development 138, 3907–14 (2011).
13. Varelas, X. et al. The Crumbs Complex Couples Cell Density Sensing to Hippo-Dependent Control of the TGF-β-SMAD Pathway. Developmental Cell 19, 831–844 (2010).
14. Liu, F. et al. Mechanosignaling through YAP and TAZ drives fibroblast activation and fibrosis. Am. J.
Physiol. Lung Cell Mol. Physiol. 308, L344–57 (2015).
15. Piersma, B. et al. YAP1 Is a Driver of Myofibroblast Differentiation in Normal and Diseased Fibroblasts.
Am. J. Pathol. 185, 3326–37 (2015).
16. Szeto, S. G. et al. YAP/TAZ Are Mechanoregulators of TGF-β-Smad Signaling and Renal Fibrogenesis. J.
Am. Soc. Nephrol. (2016). doi:10.1681/ASN.2015050499
17. Pefani, D.-E. E. et al. TGF-β Targets the Hippo Pathway Scaffold RASSF1A to Facilitate YAP/SMAD2 Nuclear Translocation. Mol. Cell 63, 156–66 (2016).
18. Wouters, O. Y., Ploeger, D. T., van Putten, S. M. & Bank, R. A. 3,4-Dihydroxy-L-Phenylalanine as a Novel Covalent Linker of Extracellular Matrix Proteins to Polyacrylamide Hydrogels with a Tunable Stiffness.
Tissue Eng Part C Methods (2016). doi:10.1089/ten.tec.2015.0312
19. Zawel et al. Human Smad3 and Smad4 are sequence-specific transcription activators. Molecular cell 1, 611–7 (1998).
20. Gjaltema, R. A., van der Stoel, M. M., Boersema, M. & Bank, R. A. Disentangling mechanisms involved in collagen pyridinoline cross-linking: The immunophilin FKBP65 is critical for dimerization of lysyl hydroxylase 2. Proc. Natl. Acad. Sci. U.S.A. 113, 7142–7 (2016).
21. Colella, A. et al. Comparison of Stain-Free gels with traditional immunoblot loading control methodology. Analytical Biochemistry 430, 108–10 (2012).
22. Fernández, B. G. et al. Actin-Capping Protein and the Hippo pathway regulate F-actin and tissue growth in Drosophila. Development 138, 2337–46 (2011).
23. Sansores-Garcia, L. et al. Modulating F-actin organization induces organ growth by affecting the Hippo pathway. EMBO J. 30, 2325–35 (2011).
24. Das, A., Fischer, R. S., Pan, D. & Waterman, C. M. YAP Nuclear Localization in the Absence of Cell-Cell Contact Is Mediated by a Filamentous Actin-dependent, Myosin II- and Phospho-YAP-independent Pathway during Extracellular Matrix Mechanosensing. J. Biol. Chem. 291, 6096–110 (2016).
25. Aragona, M. et al. A mechanical checkpoint controls multicellular growth through YAP/TAZ regulation by actin-processing factors. Cell 154, 1047–59 (2013).
26. Talele, N. P., Fradette, J., Davies, J. E., Kapus, A. & Hinz, B. Expression of α-Smooth Muscle Actin Determines the Fate of Mesenchymal Stromal Cells. Stem Cell Reports 4, 1016–30 (2015).
27. Mana-Capelli, S., Paramasivam, M., Dutta, S. & McCollum, D. Angiomotins link F-actin architecture to Hippo pathway signaling. Mol. Biol. Cell 25, 1676–85 (2014).
28. Liu-Chittenden, Y. et al. Genetic and pharmacological disruption of the TEAD–YAP complex suppresses the oncogenic activity of YAP. Genes & Development 26, 1300–5 (2012).
29. Wang, C. et al. Verteporfin inhibits YAP function through up-regulating 14-3-3σ sequestering YAP in the cytoplasm. Am J Cancer Res 6, 27–37 (2016).
30. Piersma, B., Bank, R. A. & Boersema, M. Signaling in Fibrosis: TGF-β, WNT, and YAP/TAZ Converge. Front
Med (Lausanne) 2, 59 (2015).
31. Liu, C. et al. Smads 2 and 3 are differentially activated by TGF-β in quiescent and activated hepatic stellate cells: Constitutive nuclear localization of Smads in activated cells is TGF-β independent. Journal
of Biological Chemistry 278, 11721–8 (2003).
32. Klingberg, F. et al. Prestress in the extracellular matrix sensitizes latent TGF-β1 for activation. The Journal
of Cell Biology 207, jcb.201402006 (2014).
33. Liu, Z. et al. Mechanical tugging force regulates the size of cell–cell junctions. Proceedings of the
National Academy of Sciences 107, 9944–9 (2010).
34. Haynes, J., Srivastava, J., Madson, N., Wittmann, T. & Barber, D. L. Dynamic actin remodeling during epithelial-mesenchymal transition depends on increased moesin expression. Mol. Biol. Cell 22, 4750– 64 (2011).
35. Parker, M. et al. Fibrotic extracellular matrix activates a profibrotic positive feedback loop. Journal of
Clinical Investigation 124, 1622–1635 (2014).
36. Dobaczewski, M. et al. Smad3 Signaling Critically Regulates Fibroblast Phenotype and Function in Healing Myocardial Infarction. Circulation Research 107, 418–428 (2010).
37. Hiemer, S. E., Szymaniak, A. D. & Varelas, X. The transcriptional regulators TAZ and YAP direct transforming growth factor β-induced tumorigenic phenotypes in breast cancer cells. J. Biol. Chem.
289, 13461–74 (2014).
38. Fujii, M. et al. Convergent signaling in the regulation of connective tissue growth factor in malignant mesothelioma: TGFβ signaling and defects in the Hippo signaling cascade. Cell Cycle 11, 3373–9 (2012).
39. Uemura, M. et al. Smad2 and Smad3 play different roles in rat hepatic stellate cell function and alpha-smooth muscle actin organization. Molecular biology of the cell 16, 4214–24 (2005).
40. Meng, X. et al. Smad2 Protects against TGF-β/Smad3-Mediated Renal Fibrosis. Journal of the American
Society of Nephrology 21, 1477–1487 (2010).
41. Schmidt-Erfurth & Hasan. Mechanisms of action of photodynamic therapy with verteporfin for the treatment of age-related macular degeneration. Survey of ophthalmology 45, 195–214 (2000). 42. Mannaerts, I. et al. The Hippo pathway effector YAP controls mouse hepatic stellate cell activation. J.
Hepatol. 63, 679–88 (2015).
43. Zhang, H. et al. Tumor-selective proteotoxicity of verteporfin inhibits colon cancer progression independently of YAP1. Sci Signal 8, ra98 (2015).
44. Laklai, H. et al. Genotype tunes pancreatic ductal adenocarcinoma tissue tension to induce matricellular fibrosis and tumor progression. Nat. Med. 22, 497–505 (2016).
4
SUPPLEMENTARY INFORMATION
Supplementary Figure 1. Verteporfin antagonizes the TGFβ1-induced myofibroblast phenotype switch. (A) Relative mRNA expression of YAP1, EDA-FN, COL1A1, ACTA2, SERPINE1, and CCN2 in fibroblasts
either treated with siRNA or pre-incubated with verteporfin, followed by TGFβ1 exposure for 72 h. Data represent mean ± SD of n=3 independent experiments. Two-way ANOVA with Bonferroni post-test, *** p<0.01, ***p<0.001. (B) Immunoblot of whole cell lysates after 72 hours in the presence of siRNA, verteporfin and/or TGFβ1. TGFβ1, αSMA, smooth muscle α-actin; DMSO, dimethyl sulfoxide; TGFβ1, transforming growth factor-β1; YAP, Yes-associated protein; YWHAZ, tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide.
Supplementary Figure 3. Verteporfin negates nuclear accumulation of YAP/Smad complexes.
Representative fluorescent images of proximity ligation assay (PLA) for YAP/Smad2 and YAP/Smad3 in fibroblasts pre-incubated with verteporfin for 1 h, followed by exposure to TGFβ1 for 24 h. PLA signals are shown in green. Nuclei are visuzalized with DAPI (blue). Shown are images representative of n=3 independent experiments. DAPI, 4',6-diamidino-2-phenylindole; DMSO, dimethyl sulfoxide; TGFβ1, transforming growth factor-β1; YAP, Yes-associated protein.
Supplementary Figure 2. Representative immunoblot of complete cell lysates treated with verteporfin and
or the proteasome inhibitor MG132. Human dermal fibroblasts pre-incubated with MG132 (2 µM or 5 µM) for 1 h and subsequently incubated with verteporfin (250 nM) or DMSO control for 24 h. Blots were probed with antibodies against Smad2 and Smad3. DMSO, dimethyl sulfoxide; VP, verteporfin.
4
Target Company number Catalog Research Resource
Identifier
Applications Concentration
Alpha smooth
muscle actin Dako M0851 - WB 0.142 µg/mL Collagen1A1 Biotechnology Santa Cruz sc-8783 AB_638594 WB 2,0 µg/mL
PLA probe Anti-Rabbit
PLUS Sigma-Aldrich DUO92002 - PLA 1:5 PLA probe
Anti-Mouse
MINUS Sigma-Aldrich DUO92004 - PLA 1:5 Smad2 Cell Signaling Technologies 3103S AB_490816 IF, PLA, WB 0,5 µg/mL Smad3 Cell Signaling Technologies 9523S AB_2193182 IF, WB 0,75 µg/mL Smad2/3 BD transduction laboratories 610842 AB_398161 IF, PLA 0,25 µg/mL YAP Abcam ab52771 AB_2219141 ChIP 5µg per IP YAP Biotechnology Santa Cruz sc-15407 AB_2273277 IF, PLA, WB 2,0 µg/mL YAP Biotechnology Santa Cruz sc-101199 AB_1131430 IF, PLA 2,0 µg/mL 14-3-3 zeta
(YWHAZ) Abcam Ab51129 AB_867447 WB 1,0 µg/mL Goat
anti-rabbit IgG
biotinylated Dako E0432 AB_2313609 IF 0,86 µg/mL Goat
anti-mouse IgG
biotinylated AbD Serotec 1030-08 AB_2103446 IF 0,5 µg/mL
Supplementary Table 1. Antibodies used
Gene Accession Forward primer 5’-3’ Reverse primer 5’-3’
ACTA2 NM_001141945.2 CTGTTCCAGCCATCCTTCAT TCATGATGCTGTTGTAGGTGGT CCN2 NM_001901.2 AGCTGACCTGGAAGAGAACATT GCTCGGTATGTCTTCATGCTG COL1A1 NM_000088.3 GCCTCAAGGTATTGCTGGAC ACCTTGTTTGCCAGGTTCAC FN1 NM_212482.2 CTGGCCGAAAATACATTGTAAA CCACAGTCGGGTCAGGAG SERPINE1 NM_000602.4 TGGTGCTGATCTCATCCTTG AGAAACCCAGCAGCAGATTC YAP1 NM_001130145.2 AATCCCACTCCCGACAGG GACTACTCCAGTGGGGGTCA
