University of Groningen
Insights into the transport mechanism of energy-coupling factor transporters
Stanek, Weronika Karolina
IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below.
Document Version
Publisher's PDF, also known as Version of record
Publication date: 2018
Link to publication in University of Groningen/UMCG research database
Citation for published version (APA):
Stanek, W. K. (2018). Insights into the transport mechanism of energy-coupling factor transporters. University of Groningen.
Copyright
Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).
Take-down policy
If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.
Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum.
CHAPTER 7
Three attempts to test the toppling hypothesis of S-components
Weronika K. Stanek, Nynke van der Veer, Ria H. Duurkens, Cedric Govaerts, Dirk J. Slotboom
ABSTRACT
Changes in membrane proteins conformation can be problematic to study due to the lipid bilayer environment. It is getting even more challenging when the predicted movement is toppling, a rotation of the protein in the lipid bilayer. In Energy-coupling factor (ECF) transporters, the substrate-binding subunit (named S-component) is hypothesized to undergo toppling during the transport cycle. There is no direct observation of toppling reported until now. However, indirect results (crystal structures, MD simulations, competition assays) provide enough basis to search for direct confirmation of this protein movement. Here, we tried to apply three different methods to capture S-component toppling: cysteine crosslinking, use of environment sensitive dye (RH421), and FTIR spectroscopy. None of the methods provided a clear answer about toppling of S-components.
INTRODUCTION
Toppling of S-components in the lipid bilayer was for the first time hypothesized based on
structures of full Energy-Coupling Factor (ECF) transporter complexes1–5 ECF transporters
are members of the ATP-binding cassette (ABC) transporters family and share a similar protein architecture. They consist of a tripartite ECF module with two nucleotide-binding subunits (EcfA and EcfA’) and a transmembrane protein (EcfT). The second transmembrane protein, the substrate-specific S-component, is one of the characteristic features that distinguish ECF transporters from other ABC transporters. S-components are hypothesized to perform a rotational movement (toppling) around an axis parallel to the membrane plane. This movement brings the substrate-binding site from an outward- to an inward-accessible side, and coverts the orientation of several membrane-spanning helices from perpendicular to parallel to the membrane plane. During substrate binding and release the conformational
changes in S-component are limited to movements in loops on top of the binding site.4,6–11
Toppling allows for opening of the same loops on either side of the membrane. S-components are considered as rigid body structures during the translocation process. In consequence, the
toppling mechanism represents a “moving carrier” mechanism of transport.3
Here, an attempt was made to directly observe the toppling of an S-component using three different techniques. First cysteine crosslinking was used, in which pairs of cysteines were introduced in the S-component and an interacting EcfT protein with the aim to find conditions in which toppling takes place. We expected to freeze the ECF complex in a single conformation (leading to inhibition of transport activity in crosslinked state) or study crosslinking efficiency in response to different substrates (ATP, AMP-PNP). The second
method was based on fluorescence probe RH421.12–14 The styryl-type RH421 dye is reported
to partition into the lipid bilayer and protein conformational changes in the membrane could cause significant shifts in the fluorescence of the dye. With this method we expected to observe substrate-dependent spectral changes of the dye fluorescence, corresponding to transition from substrate-binding site exposed to the toppled, compact conformation. The
last technique used was Polarized Fourier transform infrared (FTIR) spectroscopy.15,16 With
this technique changes in helical orientation relative to the membrane plane can be detected.17
S-components consists of six transmembrane helices that are expected to change orientation during the toppling. We aimed to capture this process with FTIR, which would be visible in one favored helix orientation in the apo-state and another in the substrate-bound protein (difference in different spectra).
Unfortunately, none of the above methods yielded conclusive data to confirm toppling. However, there is room for optimization of the methods using the fluorescence dye and FTIR spectroscopy.
METHODS
Mutagenesis
The positions of cysteines were chosen based on comparison of ECF-FolT2 Lactobacillus
delbrueckii amino acid sequence with the crystal structure of ECF-FolT from Lactobacillus brevis (PDB ID 4HUQ). L.brevis ECF-FolT was at that time the only folate transporter structure
available. The mutations were introduced with QuikChange PCR method (Stratagene) and primers are listed in Table 1.
Table 1 QuikChange primers to introduce cysteines in the ECF-FolT2 Mutation name Primer sequence (5’→3’)
FolT2 I25C Fw GGTTATCGCCTGCAAGGTGATTTTGGG
FolT2 I25C Rv CCAAAATCACCTTGCAGGCGATAACC
FolT2 L66C Fw CGGCGGTGCCTGTAGCGACCTGGTTTCATC FolT2 L66C Rv GATGAAACCAGGTCGCTACAGGCACCGCCG FolT2 M21 Fw GGTCTTACTGGCCTGCGTTATCGCCATC FolT2 M21C Rv GATGGCGATAACGCAGGCCAGTAAGACC FolT2 F81C Fw CAACCTGGGCGGCTGCTTTATCGGTTTC FolT2 F81C Fw GAAACCGATAAAGCAGCCGCCCAGGTTG FolT2 V73C Fw CTTGAGCGACCTGGTTTCATCCTGCATTTTTGGCAACCTG FolT2 V73C Rv CAGGTTGCCAAAAATGCAGGATGAAACCAGGTCGCTCAAG FolT2 V34C Fw GGGACAGTTTAAGTGCGGGAATGCCAC FolT2 V34C Rv GTGGCATTCCCGCACTTAAACTGTCCC
FolT2 I28C Fw GGTTATCGCCATCAAGGTGTGTTTGGGACAGTTTAAGG FolT2 I28C Rv CCTTAAACTGTCCCAAACACACCTTGATGGCGATAACC FolT2 A24C Fw GGCCATGGTTATCTGCATCAAGGTGATTTTGGG FolT2 A24C Rv CCCAAAATCACCTTGATGCAGATAACCATGGCC FolT2 I23C Fw GGCCATGGTTTGCGCCATCAAGGTGATTTTGGG FolT2 I23C Rv CCCAAAATCACCTTGATGGCGCAAACCATGGCC EcfT l.delb Y28C Fw GGCCAAGCTGCTGACGTGTTTTTACTTTATCATCATG EcfT l.delb Y28C Rv CATGATGATAAAGTAAAAACACGTCAGCAGCTTGGCC EcfT l.delb F29C Fw GGCCAAGCTGCTGACGACTTGTTACTTTATCATCATG EcfT l.delb F29C Rv CATGATGATAAAGTAACAAGTCGTCAGCAGCTTGGCC EcfT l.delb I135C Fw CAAGCCCCTGGAATGCGCGGATGCCATG EcfT l.delb I135C Rv CATGGCATCCGCGCATTCCAGGGGCTTG EcfT l.delb A163C Fw GATTTCGATCTGCCTGCGCTTCGTG EcfT l.delb A163C Rv CACGAAGCGCAGGCAGATCGAAATC EcfT l.delb V167C Fw CCTGCGCTTCTGCCCGACCTTGTTTGATCAG EcfT l.delb V167C Rv CTGATCAAACAAGGTCGGGCAGAAGCGCAGG EcfT l.delb L193C Fw CTTTAACGACGGCGGCTGTGTCAAGCGGG EcfT l.delb L193C Rv CCCGCTTGACACAGCCGCCGTCGTTAAAG EcfT l.delb A197C Fw CCTGGTCAAGCGGTGCAAGTCAGTTG EcfT l.delb A197C Rv CAACTGACTTGCACCGCTTGACCAGG EcfT L.delbI156C Fw GGTCAACGTGGGCATGTGTAGTTTGGTG EcfT L.delb I156C Rv CACCAAACTACACATGCCCACGTTGACC EcfT L.delb S211C Fw GCCGCTTTTTATCGATTGTCTGGAAGTGGCCC EcfT L.delb S211C Rv GGGCCACTTCCAGACAATCGATAAAAAGCGGC
Protein overexpression, purification and reconstitution
The full complex ECF-FolT2 from L.delbrueckii (wild type and cysteine mutants) was
overexpressed from p2BAD vector18 in Escherichia coli MC1061 cells. The overexpression
overexpressed from pNZ8048 vector and purified according to protocol from Chapter 3. Solitary ThiT from Lactococcus lactis was overexpressed in L.lactis NZ9000 cells and pNZ8048 vector bearing His8-thiT. The expression and purification protocols for solitary
ThiT were described by Swier et al.19 Shortly, protein was overexpressed in chemically
defined medium20 without thiamine. Prior to purification ThiT was solubilized in
n-dodecyl-β-D-maltopyranoside (DDM, Anatrace) and purified on Ni-Sepharose resin and subsequently Superdex 200 10/300 gel filtration column (GE Healthcare) in n-dodecyl-β-D-maltoside (DM, Anatrace).
The protein reconstitution procedure used here was described previously.21 The full complex
ECF-FolT2 was reconstituted in the ratio 1:1000 (protein to lipids) for the uptake assays. The solitary ThiT was reconstituted in protein to lipid ratio 1:15 or 1:50 for FTIR spectroscopy.
Protein crosslinking
Purified full complex ECF-FolT2 (double cysteine mutants) was crosslinked either in detergent solution or when reconstituted into proteoliposomes.
To increase chances of crosslinking a fraction of purified proteins was treated with 5 mM tris(2-carboxyethyl)phosphine hydrochloride (TCEP, Sigma-Aldrich) for 30 min at room temperature. TCEP was removed by NAP-5 column (GE Healthcare). The samples with or
without TCEP treatment were subsequently incubated with 1 mM HgCl2 (MERCK) for 20
min at room temperature, 1 mM freshly prepared Cu-phenantroline for 20 min at 30˚C or 2 mM bismaleimidoethane (BMOE, ThermoFisher Scientific) for 60 min at room temperature.
Cu-Phenantroline was obtained by mixing equal volumes of 20 mM CuSO4 and 60 mM
1,10-phenantroline (MERCK) dissolved in methanol. BMOE reaction was quenched with 5 mM DTT for 15 min at room temperature. Immediately after crosslinking reaction time samples were divided in two and one part was mixed with reducing loading dye whereas the other one with non-reducing dye. The samples were then resolved on SDS-PAGE polyacrylamide gel.
Wester blotting
The western blots of purified or reconstituted proteins were performed. At first, samples were mixed with non-reducing loading dye (Tris-HCl, SDS, glycerol, bromophenol blue) and resolved on a 15% SDS-polyacrylamide gel. Subsequently, the protein was transferred into a PVDF membrane in Trans-Blot® SD Dry Transfer system (Bio-Rad) in Fast Semi-Dry Transfer Buffer (Thermo Scientific). For protein detection primary antibodies against STREPII-tag or 4xHis-tag (Qiagen) and secondary antibodies anti-mouse (Qiangen) were used. The proteins on PVDF membranes were visualized by inducing chemiluminescence with the Western light kit (Tropix, Inc.) in the LAS-3000 imaging system (Fujifilm).
Radiolabeled folate uptake assay in proteoliposomes
The uptake assay of [3H]folate in proteoliposomes with reconstituted wild type or cysteine
mutants of ECF-FolT2 was performed at 30˚C. The uptake procedure used in here was described in Chapter 3.
RH421 assay
Fluorescence measurements were performed in Spec Fluorlog 322 fluorescence
spectrophotometer with quartz cuvettes in holder thermostated at 25oC and equipped with a
magnetic stirrer. During the assay 500 nM solitary FolT1 or ECF-FolT1 diluted in a suitable size-exclusion buffer was mixed with 200 nM RH421 dye and equilibrated under illumination until stable fluorescence signal (around 11 minutes). The excitation wavelength of 532 nm (5
nm slit width), and emission wavelength of 628 nm (10 nm slit width) were used.22 When a
modelrately stable fluorescence signal was reached folate was titrated to the protein solution with 30 sec recording time between subsequent additions. To establish the maximal change in
fluorescence 1 mM folate was added to the protein sample at the end of titration.12
FTIR spectroscopy
The reconstituted apo ThiT in high protein to lipid ratio was dehydrated with N2 at room
temperature. Samples of thiamine bound ThiT were incubated with 10 µM thiamine for 1 hour on ice and subsequently dehydrated. Samples were scanned at room temperature under
N2 on diamond IR. The 256 scans of each sample were averaged to calculate final spectra. For
1:15 protein:lipid ratio there was no need for vapor substraction. For 1:50 ratio sample using
D2O was necessary to get good quality signal.15
RESULTS
Crosslinking studies in ECF-FolT2
The current model for the transport mechanism of ECF transporters postulates toppling of the S-component during the substrate translocation. Such dynamic behavior leads to changes in the relative placement and orientation of the transporter subunits. To detect relative movements between transmembrane subunits of ECF transporters we introduced cysteine mutants for disulphide crosslinking.
We used the p2BAD vector with the 10His-ecfAA’T operon downstream of the first promoter and folT2-StrepII downstream of the second promoter. The native cysteine in EcfT (C252) was removed to avoid unintended crosslinks, but the native cysteine in EcfA’ (C168) was kept in the final constructs. C168 is part of D-loop of the NBD and its mutation to alanine reduced the activity of the transporter (Figure 2B), possibly by interfering with protein stability. C168 in EcfA’ is located in a buried position, well separated the engineered cysteines that we expected to interact, and therefore we did not expect complications. Two native cysteines in helix 5 of FolT2 (C116 and C121) were also left in the final constructs and seemed to influence the protein’s activity (Figure 2C). C121 is buried between helices 5 and 4 of FolT2 while C116 is situated more to the outside of EcfT and could lead to disulphide bond formation with other available cysteines, which may be taken into account during data analysis.
The positions for cysteines in ECF-FolT2 were designed according to optimal distance for
disulphide bond formation (< 6 Å between the Cß atoms).23,24 The cysteines on the interface
between EcfT and FolT2 were placed on the coupling helices or transmembrane helix 1 of EcfT and on positions in the S-component that were predicted to contact with them (Figure
1). The double cysteine mutants of ECF-FolT2 were overexpressed in Escherichia coli MC1061 and purified with the standard protocol used for wild type ECF-FolT2.
We checked which crosslinking agent was suitable for disulphide bond formation (Figure 3). Cu-phenantroline appeared to be the most effective in crosslinking both in detergent solution (Figure 3A and C) and in liposomes (Figure 3B). The use of sulfhydryl reductant, TCEP, did not improve crosslinking efficiency and was therefore not used. Most of the designed cysteine pairs formed disulphide bonds to some extent. Only mutant A163C/A24C did not crosslink under any of the conditions tested.
Figure 1 Positions of cysteines for crosslinking studies. A) Amino acids changed ECF-FolT2. FolT2 is colored
yellow, EcfT in blue and EcfA and EcfA’ in pink. Positions of cysteine mutations in FolT2 are colored in dark blue. Amino acids mutated in EcfT are colored in orange. The structure is shown from two different viewpoints. B) Table representing pairs of cysteine mutants designed for ECF-FolT2.
We checked the transport activity of the mutated transporters (Figure 2). Single mutations caused only a minor decrease in transport activity (not shown). However, when two cysteines were introduced in ECF-FolT2 the folate transport was significantly impaired (Figure 2), which reduces the relevance of any results obtained with the mutant proteins.
Figure 2 Transport activity of mutants reconstituted into proteoliposomes. A) Radiolabeled folate uptake
assay in proteoliposomes with double cysteine mutants. Wild type activity was set to 100%. As the control of the background level Mg-ADP loaded proteoliposomes with wild type ECF-FolT2 was used. Error bars represent range of four measurements (two independent experiments). B) Uptake assay of EcfAA’(C168A)T FolT2 compared with
A B
wild type ECF-FolT2. C) Uptake assay with EcfAA’T FolT2(∆cys) and wild type ECF-FolT2.
In particular, because introduction of cysteines on the interface between two transmembrane domains in ECF-FolT2 tremendously decreased the activity of transporter, we decided not to develop the crosslinking assay further. It would be impossible to distinguish the effect of the mutation from the effects of blocked conformation changes.
Figure 3 Crosslinking of double cysteine mutants visualized by Western blot (A and B) or a coomassie-stained non-reducing SDS-PAGE gel (C). A) Western blot of EcfAA’T(V167C) FolT2(I28C) crosslinked with HgCl2,
BMOE, and Cu-Phenantroline . B) Western blot of EcfAA’T(I135C) FolT2(V73C) crosslinked with HgCl2 and
Cu-Phenantroline. C) SDS-PAGE of other double cysteine mutants. The arrow indicate expected size of EcfT-FolT2 complex, whereas with asterisk complex of two FolT2s.
Fluorescence-based study of FolT1 conformational change
A fluorescence assay with the RH421 dye was used as an alternative assay to detect toppling of the S-component FolT1. We used freshly purified solitary FolT1 and full complex ECF-FolT1. Each sample was mixed with the RH421 dye and the emission fluorescence was followed in the spectrophotometer. Unfortunately, we were unable to reach stable signal from the label in 15 min of the experiments lifetime (Figure 4). Furthermore, addition of different substrate concentrations did not yield stabilization of the signal or a common pattern in the probe behavior (Figure 4).
A B
Figure 4 Fluorescence time traces of RH421 in the detergent micelle surrounding FolT1
FTIR spectroscopy on ThiT toppling in the lipid environment
The thiamine specific S-component, ThiT, was extensively investigated over the years.7,25–29
We decided to study conformational changes of solitary ThiT in the lipid bilayer by FTIR spectroscopy. An advantage of using ThiT instead of other S-components is that the thiamine molecule has no carbonyl groups (C=O) that would interfere with the protein signal in IR. Therefore, we expected that substrate dependence of toppling of ThiT could be measured. Liposomes were oriented by the dehydration technique. We followed the peak between
1650 and 1660 cm-1 corresponding to the C=O stretching of an alpha helix. Additionally,
absorption at two polarizations, 90° and 0°, were compared to elucidate the orientation of helices relative to the membrane plane (Figure 5). A comparison of difference spectra of apo ThiT and thiamine-bound ThiT (Figure 5C) did not reveal any changes in helix orientation. We also checked if the dense protein packing in the proteoliposomes that we used (1:15 protein to lipid ratio (w/w)) might have prevented toppling of ThiT. The difference spectra of apo and thiamine-bound ThiT at a lower reconstitution ratio (1:50) looked identical as in 1:15 ratio, showing that the negative results for ThiT are caused not by the high protein concentration in the membrane.
Figure 5 Protein FTIR spectra. The peak between 1770 and 1710 correspond to the lipid carbonyl groups (left
arrow); the peak between 1700 and 1600 correspond to the amide I band (carbonyl groups; middle arrow); the peak between 1650 and 1500 correspond to the amide II band (amine group; right arrow). A) Averaged spectra of apo ThiT (light blue and red) and ThiT incubated with 10 µM thiamine (green and dark blue). In light blue apo sample in polarization 0° is represented whereas in red apo sample in polarization 90°. For ThiT mixed with thiamine sample polarized 0° is represented by green spectra and in dark blue sample polarized 90°. B) The spectra of apo ThiT normalized for the amount of used material. The non-oriented lipid band was used for the normalization. The spectrum of apo ThiT polarized 90° is in blue, apo ThiT polarized 0° in green and difference spectrum (90° - 0°) is in black. C) The comparison of difference spectra of apo ThiT (black) and ThiT incubated with thiamine (green).
Time (min)
Figure 5 Protein FTIR spectra.
DISCUSSION
Every new postulated mechanism that describes functioning of a protein needs an experimental testing. The proposed toppling mechanism of S-components in the lipid bilayer may seem
implausible,30 but it was hypothesized that toppling might occur without a prohibitive
energetic barrier.1,3 Structural work proved that in the substrate bound state S-components
are more compact and there are no charged amino acids exposed around the binding pocked. With that in mind there may not be significant objections for the existence of a toppling mechanism. Indeed, preliminary MD simulations (Faustino, I./Marrink, S.J.) indicate the S-component ThiT with substrate bound is stable in a toppled orientation in the bilayer. Here, we tried three different techniques to test the toppling hypothesis. The crosslinking method failed due to strong reduction of the transport activity of full complex ECF transporter by the introduced cysteine mutations. Decreased activity was mostly a consequence of cysteine introduction in the S-component. We observed a general trend where the more cysteines were introduced the more activity of the transporter was lost. A similar phenomenon was observed
in the ECF-type biotin transporter.31 The cysteine mutations in BioMNY lowered its stability
and it was an additive effect of cysteines not assigned to any particular residue.
The experiments with the environmentally sensitive fluorescence dye RH421 were also unsuccessful. Possible explanations of failure are detergent micelle preventing toppling of the protein or that RH421 dye is not suitable for visualizing toppling. To exclude a possible a negative influence of the detergent micelle a new experiment can be designed in which crude membrane vesicles are used instead of detergent-solubilized protein. It may also be possible to discriminate conformational changes of S-component in the membrane vesicles with overexpressed S-component. In that case there will be more space for the dye to insert and the S-component will be still in a native environment. Notably, crude membrane vesicles
A B
have been used successfully for substrate binding experiments with ITC (Chapter 5).
Despite the failure to detect substrate-induced changes in protein orientation with FTIR spectroscopy experiments there is still a room for improvement. We cannot exclude that toppling is energetically so unfavorable, that only a small fraction of the proteins is toppled in the equilibrium distribution. The technique might not be sensitive enough to detect the minor fraction of toppled proteins against the background of “straight” proteins. Possibly the sensitivity can be enhanced by studying the full complex instead of the solitary S-component. Starting from the full complex in the apo state, in which the S-components is toppled, addition of ATP should release the S-component, and allow it to topple back to the straight state. Since this state may be energetically more favored than the toppled state, the change in FTIR signal is expected to be more pronounced.
Nevertheless, with the FTIR data obtained so far we could calculate the average protein orientation of the S-component in the membrane. Such calculation could confirm whether the orientation of the S-component is mostly straight, with the helices perpendicular to the plane of the membrane. The evidence for such orientations are crystal structures of solitary
S-components in the lipidic cubic phase,11,32 molecular dynamics stimulations (Faustino,
I unpublished)32, and accessibility experiments.33 Finally, any technique which would
bring direct confirmation of the initial orientation of apo S-component and could test the predictions from toppling mechanism would be useful. Only in this way it will be possible to unambiguously learn about this unique elevator mechanism.
REFERENCES
1. Swier, L. J. Y. M., Guskov, A. & Slotboom, D. J. Structural insight in the toppling
mechanism of an energy-coupling factor transporter. Nat. Commun. 7, 11072 (2016).
2. ter Beek, J., Guskov, A. & Slotboom, D. J. Structural diversity of ABC transporters.
J. Gen. Physiol. 143, 419–35 (2014).
3. Slotboom, D. J. Structural and mechanistic insights into prokaryotic energy-coupling
factor transporters. Nat. Rev. Microbiol. 12, 79–87 (2014).
4. Bao, Z. et al. Structure and mechanism of a group-I cobalt energy coupling factor
transporter. Cell Res. 27, 675–687 (2017).
5. Karpowich, N. K., Song, J. M., Cocco, N. & Wang, D.-N. ATP binding drives
substrate capture in an ECF transporter by a release-and-catch mechanism. Nat.
Struct. Mol. Biol. 22, 565–571 (2015).
6. Zhang, M. et al. Structure of a pantothenate transporter and implications for ECF
module sharing and energy coupling of group II ECF transporters. Proc. Natl. Acad.
Sci. U. S. A. 111, 18560–5 (2014).
7. Majsnerowska, M. et al. Substrate-induced conformational changes in the
S-component ThiT from an energy coupling factor transporter. Structure 21, 861– 867 (2013).
8. Berntsson, R. P. -a. et al. Structural divergence of paralogous S components from
ECF-type ABC transporters. Proc. Natl. Acad. Sci. 109, 13990–13995 (2012).
9. Song, J., Ji, C. & Zhang, J. Z. H. Unveiling the gating mechanism of ECF Transporter
RibU. Sci. Rep. 3, 3566 (2013).
10. Zhao, Q. et al. Structures of FolT in substrate-bound and substrate-released
7661 (2015).
11. Karpowich, N. K., Song, J. & Wang, D. N. An Aromatic Cap Seals the Substrate
Binding Site in an ECF-Type S Subunit for Riboflavin. J. Mol. Biol. 428, 3118–3130 (2016).
12. Reyes, N., Oh, S. & Boudker, O. Binding thermodynamics of a glutamate transporter
homolog. Nat. Struct. Mol. Biol. 20, 634–640 (2013).
13. Clarke, R. J., Zouni, A. & Holzwarth, J. F. Voltage Sensitivity of the
Fluorescent-Probe Rh421 in a Model Membrane System. Biophys. J. 68, 1406–1415 (1995).
14. Lin, S. H., Smirnova, I. N., Kasho, V. N. & Faller, L. D. Eosin, energy transfer, and
RH421 report the same conformational change in sodium pump as fluorescein. Ann.
N. Y. Acad. Sci. 834, 442–444 (1997).
15. Vandenbussche, G., Clercx, A., Curstedt, T., Johansson, J. & Ruysschaert, J. M.
Structure and orientation of the surface-associated protein {C} in a lipid bilayer. Eur.
J. Biochem. 203, 201–209 (1992).
16. Pastrana, B., Mautone, A. J. & Mendelsohn, R. Fourier transform infrared studies
of secondary structure and orientation of pulmonary surfactant SP-C and its effect on the dynamic surface properties of phospholipids. Biochemistry 30, 10058–10064 (1991).
17. Ding, F.-X., Xie, H., Arshava, B., Becker, J. M. & Naider, F. ATR-FTIR study of the
structure and orientation of transmembrane domains of the Saccharomyces cerevisiae alpha-mating factor receptor in phospholipids. Biochemistry 40, 8945–54 (2001).
18. Birkner, J. P., Poolman, B. & Kocer, a. Hydrophobic gating of mechanosensitive
channel of large conductance evidenced by single-subunit resolution. Proc. Natl.
Acad. Sci. 109, 12944–12949 (2012).
19. Swier, L. J. Y. M. et al. Structure-based design of potent small-molecule binders to
the S-component of the ECF transporter for thiamine. ChemBioChem 16, 819–826 (2015).
20. Berntsson, R. P. a et al. Selenomethionine incorporation in proteins expressed in
Lactococcus lactis. Protein Sci. 18, 1121–1127 (2009).
21. Geertsma, E. R., Nik Mahmood, N. a B., Schuurman-Wolters, G. K. & Poolman, B.
Membrane reconstitution of ABC transporters and assays of translocator function.
Nat. Protoc. 3, 256–266 (2008).
22. Pedersen, M. et al. Detection of charge movements in ion pumps by a family of styryl
dyes. J. Membr. Biol. 185, 221–236 (2002).
23. Hazes, B. & Dijkstra, B. W. Model building of disulfide bonds in proteins with known
three- dimensional structure. Protein Eng. 2, 119–125 (1988).
24. Sowdhamini, R. et al. Stereochemical modeling of disulfide bridges. Criteria for
introduction into proteins by site-directed mutagenesis. Protein Eng. 3, 95–103 (1989).
25. Eudes, A. et al. Identification of genes encoding the folate- and thiamine-binding
membrane proteins in firmicutes. J. Bacteriol. 190, 7591–7594 (2008).
26. Rodionov, D. A. et al. A novel class of modular transporters for vitamins in
prokaryotes. J. Bacteriol. 91, 42–51 (2009).
27. Erkens, G. B. & Slotboom, D. J. Biochemical characterization of ThiT from
lactococcus lactis: A thiamin transporter with picomolar substrate binding affinity.
Biochemistry 49, 3203–3212 (2010).
28. Majsnerowska, M., ter Beek, J., Stanek, W. K., Duurkens, R. H. & Slotboom, D.
J. Competition between Different S-Components for the Shared Energy Coupling Factor Module in Energy Coupling Factor Transporters. Biochemistry 54, 4763–4766 (2015).
29. Erkens, G. B. et al. The structural basis of modularity in ECF-type ABC transporters.
Nat. Struct. Mol. Biol. 18, 755–760 (2011).
30. Forrest, L. R. & Rudnick, G. The rocking bundle: a mechanism for ion-coupled
solute flux by symmetrical transporters. Physiology (Bethesda). 24, 377–386 (2009).
31. Neubauer, O., Reiffler, C., Behrendt, L. & Eitinger, T. Interactions among the A and T
units of an ECF-type biotin transporter analyzed by site-specific crosslinking. PLoS
One 6, (2011).
32. Josts, I., Almeida Hernandez, Y., Andreeva, A. & Tidow, H. Crystal Structure of a
Group I Energy Coupling Factor Vitamin Transporter S Component in Complex with Its Cognate Substrate. Cell Chem. Biol. 23, 827–836 (2016).
33. Finkenwirth, F. et al. ATP-dependent Conformational Changes Trigger Substrate
Capture and Release by an ECF-type Biotin Transporter. J. Biol. Chem. 290, 16929– 16942 (2015).
