Citation
Plas, M. C. van der. (2008, January 24). A Drosophila model for Duchenne muscular dystrophy. Retrieved from https://hdl.handle.net/1887/12577
Version: Corrected Publisher’s Version
License: Licence agreement concerning inclusion of doctoral thesis in the Institutional Repository of the University of Leiden
Downloaded from: https://hdl.handle.net/1887/12577
Note: To cite this publication please use the final published version (if applicable).
CHAPTER 6
The role of Drosophila Dystrobrevin
in survival, muscle integrity and
wing formation
The role of Drosophila Dystrobrevin in survival, muscle integrity and wing formation
Mariska C. van der Plas, Anneke Kremer, Anja W.M. de Jong, Lee G. Fradkin, and Jasprina N. Noordermeer
Laboratory of Developmental Neurobiology, Department of Molecular Cell Biology, Leiden University Medical Center, 2300 RC Leiden, The Netherlands.
Summary
Duchenne muscular dystrophy is characterized by progressive muscle wasting. It is caused by mutations in the dystrophin gene. Dystrophin is part of a large protein complex which is located at the plasma membrane of muscle cells (sarcolemma). One of the proteins in this complex is Dystrobrevin. Mutations in dystrobrevin are associated in humans with congenital heart disease, although it is unknown if this is caused by muscle defects. In mice, lack of Dystrobrevin causes a mild muscular dystrophy. In Drosophila, RNA in situ analyses have shown that Dystrobrevin is found in the musculature and central nervous system. In this study, we examine the protein expression of Dystrobrevin in Drosophila embryos and larvae with three newly generated antibodies directed against two different regions of the Dystrobrevin protein. We find that Dystrobrevin is expressed at the neuromuscular junction and at the sarcomeric I-band in the muscle and in the neuropile and brain. Furthermore, we show that Dystrobrevin localizes to similar domains as Dystrophin and that Dystrobrevin is delocalized in Dystrophin mutants. To examine the effects of reduced expression of Dystrobrevin, we generated transgenic flies carrying an RNAi construct targeting Dystrobrevin sequences. Examination of these fly lines indicates roles for Dystrobrevin in survival, muscle integrity, and wing formation.
1. Introduction
Duchenne muscular dystrophy is a severe X-linked muscle wasting disease occurring in approximately 1:3500 boys. It is caused by defects in the dystrophin gene (Hoffman et al., 1989). The Dystrophin protein and its orthologue Utrophin are part of a larger protein complex in skeletal muscle, the Dystrophin Glycoprotein Complex (DGC). Other proteins involved in this complex are the Dystroglycans, the Sarcoglycans, Syntrophins, Sarcospan, and the Dystrobrevins. Dystrobrevin is also part of the Dystrophin-related family of proteins and bears a domain which has significant homology to the C-terminal of Dystrophin (Wagner et al., 1993; Blake et al., 1996). Dystrobrevins contain a ZZ domain, two EF-hands, two Syntrophin-binding sites, a coiled-coil domain and a unique C-terminal tail (Albrecht &
Froehner, 2002). Vertebrates have two Dystrobrevin genes, α-Dystrobrevin and β- Dystrobrevin (Peters et al., 1997; Blake et al., 1998; Nawrotzki et al., 1998). α-Dystrobrevin has at least five isoforms, of which α-DB1, -2, and -3 are expressed in muscle and located at the sarcolemma. α-DB1 is localized to the NMJ, whereas α-DB2 is distributed in a similar pattern as Dystrophin, specifically along the sarcolemma within costameres and at the troughs of the postsynaptic membrane (Nawrotzki et al., 1998; Peters et al., 1998; Newey et al., 2001a). β-Dystrobrevin is expressed in many non-muscle tissues, where it associates with the Dystrophin Dp71 isoform or Utrophin (Blake et al., 1999; Loh et al., 2000).
Thus far, only congenital heart disease is linked to mutations in the human dystrobrevin gene (Ichida et al., 2001). However, mice that lack α-Dystrobrevin have a mild muscular dystrophy in both skeletal and cardiac muscle (Grady et al., 1999). In contrast to Dystrophin null mutant mice, the sarcolemma is not disrupted in degenerating muscle fibers of α- Dystrobrevin null mutant mice (Albrecht & Froehner, 2002). The DGC members Dystrophin, Utrophin, β-Dystroglycan, and β-Sarcoglycan are still normally localized in Dystrobrevin null
mutant mice, but nNOS is displaced from the sarcolemma and the NMJ has a slightly reduced number of AChR clusters (Grady et al., 2000).
Most DGC protein encoding genes, among them Dystrobrevin, have been identified in C.
elegans ((Bessou et al., 1998; Grisoni et al., 2002; Grisoni et al., 2003; Cox & Hardin, 2004).
Absence of Dystrobrevin results in hyperactivity, similar to that seen in Dystrophin deficient worms (Gieseler et al., 2001). This phenotype can be mimicked by increasing the synaptic sensitivity to acetylcholine by either deactivating the Ca2+-activated K+ channel SLO1 or by insufficient clearing of acetylcholine from the synaptic cleft in the mutant by the acetylcholine transporter mutant, snf-6 (Gieseler et al., 2000; Ségalat, 2002; Carre-Pierrat et al., 2006;
Kim et al., 2004).
Drosophila Dystrobrevin resembles both the vertebrate α- and β-Dystrobrevins and has four EF-hands, a ZZ domain and a Syntrophin binding region (Greener & Roberts, 2000). RNA in situ analyses showed expression of dystrobrevin mRNA in the epidermis, CNS, PNS, labral sensory system, VUMS, brain, somatic muscle, dorsal pharyngeal muscle, and the midgut (Dekkers et al., 2004). Sequence analyses predict five dystrobrevin isoforms whose individual expression domains have not been determined.
Here, we determined where Dystrobrevin proteins are expressed and present a preliminary functional analysis of Dystrobrevin in the fruit fly using transgenic RNA interference. These RNAi lines have revealed the importance for Dystrobrevin in survival during the pupal stage, in maintaining muscle integrity in the third instar larva and during wing development.
2. Materials and Methods
2.1 Fly stocks
w1118 served as the wild type control in all experiments. All transgenic animals used were generated in this background. dysDLP2 E6 was described previously in van der Plas et al. (2006;
and chapter 3, this thesis). dysDp186 166.3 was previously described in Chapter 4 of this thesis.
The BL7543 Dystrobrevin deficiency (deleted segment 48F5 - 49A6) and BL7663 Dystrophin deficiency (deleted segment 92A5 - 92A11) lines were obtained from the Bloomington Stock Center. The transgenic RNAi lines for pan-Dystrophin (RNAi-DysCO2H) and Dp117 (2xRNAi- Dp117) were described previously in Chapter 5 of this thesis (van der Plas et al., 2007). The following Gal4 driver lines were used: 24B-Gal4 (Brand and Perrimon, 1993), which is expressed predominantly in muscle and tendon cells, elav-Gal4 (Luo et al., 1994), which is panneuronally expressed, Da-Gal4 (Wodarz et al., 1995), which is expressed ubiquitously, and MS1096-Gal4 (obtained from the Bloomington Stock Center), which is expressed in the dorsal wing blade.
2.2 Generation of polyclonal antibodies and immunohistochemistry
Three rabbit antisera were raised against two GST-tagged Dystrobrevin antigens: 1) anti- DybCO2H (translated from base pairs 1842-2408 of the Dystrobrevin A transcript, Genbank accession number NM_165904), 2) anti-Dybmid SN1481, and 3) anti-Dybmid SN1482 (both translated from base pairs 1294-1818 of the Dystrobrevin A transcript, Genbank accession number NM_165904).
Anti-DybCO2H (1:2500), anti-Dybmid SN1481 (1:2500), anti-Dybmid SN1482 (1:1000), anti- actin (1:20.000; MP Biomedicals, Aurora, OH, USA), anti-muscle myosin (1:100), anti-HRP (1:500; Promega, Madison, WI, USA), anti-DysCO2H (1:3000; van der Plas et al., 2006), Alexa Fluor-conjugated secondary antibodies (1:300; Invitrogen, Breda, The Netherlands), and HRP-conjugated secondary antibodies (1:300) were used as described (van der Plas et al., 2006). Standard epifluorescence or confocal microscopy was used to visualize the samples.
2.3 Generation of transgenic constructs
Several transgenic flies carrying an RNA interference (RNAi) construct directed against Dystrobrevin (RNAi-Dyb) were generated to facilitate the reduction of Dystrobrevin expression levels in a time- and tissue-dependent manner using the UAS-Gal4 system (Brand
& Perrimon, 1993). The transgenic RNAi construct directed against Dystrobrevin contains sequences common to all predicted Dystrobrevin isoforms (base pairs 1125-2090 of Genbank accession number NM_165904) in a pUAST (Brand & Perrimon, 1993) derivative bearing the mub intron (Reichhart et al., 2002) between the gene region-specific repeats to increase the efficiency of RNA interference. Multiple independent transgenic lines bearing this construct were derived; five lines (lines 2C, 3B, 4A, 5A and lateA) are analyzed in this chapter.
2.4 RT-PCR and Western blotting
For RT-PCR analysis, larvae were dissected in PBS and placed in liquid nitrogen without fixation. RNA was isolated from larval body walls and larval brains using the RNeasy mini kit (Qiagen, Hilden, Germany), including a DNAse treatment to reduce potential genomic DNA contamination. Reverse transcriptions were performed using the SuperScript First Strand Synthesis System kit (Invitrogen, Breda, The Netherlands) according to the manufacturer’s protocol. Standard 40 cycle PCR was performed using long range PCR polymerase (rTth DNA polymerase, XL, Applied Biosystems, Foster City, CA, USA) and equivalent volumes of reaction products were electrophoresed and ethidium bromide stained. Primers used were:
Pan-Dystrobrevin: DybRTPCRf ATGGAACTGGAGCCGCGAGT;
DybRTPCRr TGGAATGTGGGCGACTCGTACAC;
Dystrobrevin C: DybCRTPCRf ATGTTGGAAGTGGTTTTTGGGCG;
DybCRTPCRr AGCTTCCGGCCACCAGCTG;
Dystrobrevin D: DybDRTPCRf AGAGAATCCGGCGCTAATCAATG;
DybDRTPCRr GCCATTGGCTATTCGCATTTGC;
Dystrobrevin E: DybERTPCRf AGAGAATCCGGCGCTAATCAATG;
DybERTPCRr TGACATTGGCAGTGGCAGTGG.
Western blotting was performed as previously described (Sambrook et al., 1989).
Figure 1: A schematic of the Drosophila dystrobrevin gene. There are five different isoforms and two different ATGs. Dyb A and Dyb B have no unique sequences. Dyb C, D, and E have unique protein domains at either the N-terminal or the C-terminal. The regions used for generation of the antibodies (stars) and the RNAi constructs (black bar) are indicated.
2.5 Analysis of muscle phenotype
To score the number of damaged muscles, larvae were dissected in ice-cold PBS to expose the body wall muscles. Body walls were submerged in Bouin’s fixative that stains the muscles yellow. Five muscles per larva (muscles 7, 6, 13, 12 and 4) in each of 10 hemisegments (A2-
A6) were examined for abnormalities associated with muscle degeneration (eg. rupture, transparency and dark patches). The total number of abnormal muscles in all hemisegments was used to calculate the percentage of degenerating muscles per larva. Ten to thirteen larvae per genotype were analyzed to obtain the average percentage of damage.
2.6 Photography of whole flies and mounting of wings
Flies were anesthesized using CO2 on a flypad under a Leica microscope and photographs were taken using a Leica DFC490 digital camera and Leica Application Suite software.
Five female flies of each genotype were immersed in 100% EtOH and stored at -20ºC for 1 day. Wings were then dissected in 100% EtOH and bathed in 50% EtOH/ 50% Glycerol.
Wings were transferred to a microscope slide and mounted in 50% EtOH/50% glycerol.
Photographs were made using a Zeiss microscope and digital camera.
3. Results
Drosophila dystrobrevin was first described by Greener and Roberts (2000). Sequence analyses predict five different isoforms, Dystrobrevin A-E (Figure 1), whose distinct expression domains and functions are not known. We have generated pan-Dystrobrevin antibodies directed against both the middle region of the protein, as well as the common C- terminal tail. We have also generated RNAi lines directed against all Dystrobrevin isoforms.
Figure 2: Expression of Dystrobrevin protein in wild type embryos. Dystrobrevin staining in the longitudinals of the CNS (anti-DybCO2H) (A) and in the attachment sites of the muscle (arrows) (B); Dystrobrevin can also be detected in the trachea of the body wall (anti-Dybmid SN1481) (C).
3.1 Dystrobrevin is expressed in the CNS and muscle in embryos and larvae Dystrobrevin expression was analyzed using RNA in situ analysis and antibody labelings.
Previous RNA in situ analyses in embryos revealed Dystrobrevin RNA expression in the CNS and the muscle (Dekkers et al., 2004 and Chapter 2). Dystrobrevin protein expression was detected in the embryonic neuropile (Figure 2A) and at muscle attachment sites in the muscle (Figure 2B). Tracheae were also stained when using the Dybmid SN1481 antibody (Figure 2C).
Figure 3: Dystrobrevin expression in larvae. Dystrobrevin is detected in the muscle (anti-Dybmid SN1481) (A) at the sarcomeric I-band and in trachea (arrow) and at the NMJ (anti-Dybmid SN1482) (arrow in B) of certain, but not all muscles; In brains, eye- and wing- discs Dystrobrevin is expressed in the brain (C), which showed a stronger signal in the attachment between the two lobes (thin arrow) and in the optic tectum (thick arrow) and in the larval neuropile (D), where synaptic contacts are made; Dystrobrevin expression is found in the eye-antennal discs (E) and in the wing-discs (F).
In third instar larvae, Dystrobrevin is localized at the neuromuscular junction and at the sarcomeric I-band throughout the muscle (Figure 3A and B). Furthermore, Dystrobrevin is also expressed in the trachea. In the CNS, Dystrobrevin localizes to the neuropile and to areas in the brain lobes, including the optic tectum (Figure 3C and D). Furthermore, Dystrobrevin expression was found in the eye-antennal disc (Figure 3E) and in the wing disc (Figure 3F).
To test the specificity of the Dystrobrevin antibodies, we looked for residual staining in both the CNS of embryos and larval muscles of a deficiency line (BL7543), which lacks all Dystrobrevin expression. All staining was lost in BL7543 embryos and larvae, indicating that the antibodies are specific for Dystrobrevin (Figure 4).
In order to study the expression of the different Dystrobrevin isoforms in different tissues, RT-PCR was performed on larval body walls and on the eye-antennal associated imaginal larval discs (Figure 5). Unfortunately, Dystrobrevin A and B transcripts could not be separated from the other isoforms or each other using RT-PCR. Expression was found in both body walls and discs for pan-Dystrobrevin and Dystrobrevin D. Dystrobrevin C could only be detected in larval body walls. Dystrobrevin E could not be detected in either tissue.
To investigate whether Dystrobrevin colocalizes with actin, we performed a double labeling with anti-Dybmid SN1481 and anti-actin (Figure 6A-C). The results of this double labeling suggest that Dystrobrevin colocalizes with actin at the sarcomeric I-band, as was also reported for Dystrophin (van der Plas et al., 2006 and Chapter 3 of this thesis). Double labeling with anti-Dybmid SN1481 and anti-muscle myosin did not reveal any overlap in staining (Figure 6D-F). Furthermore, we performed a double labeling for Dystrobrevin and anti-HRP, which labels the presynaptic membrane of the motoneuron (Figure 6G-I), that confirmed the synaptic localization of Dystrobrevin.
Figure 4: Specificity of Dystrobrevin antibodies. Dystrobrevin (anti-DybCO2H in A and C, and anti- Dybmid SN1482 in B and D) expression in the embryonic longitudinals (A) and at the larval NMJ (B) is not apparent in BL7543 deficiency embryos (C) and larvae (D). The arrows indicate the area of the NMJ.
3.2 Dystrobrevin localization is dependent on Dystrophin in the neuropile, eye disc and at the muscle attachment site
In vertebrates, the sarcolemmal localization of the DGC complex is largely disrupted in the absence of Dystrophin. We examined whether the absence of Dystrophin in Drosophila also results in delocalization of other DGC members by studying the Dystrobrevin expression in two different Dystrophin isoform mutants, dysDLP2 E6 and dysDp186 166.3 and a Dystrophin deficiency, BL7663. Dystrobrevin protein was not found at the muscle attachment sites of embryos from the BL7663 and dysDLP2 E6 lines, but was present in the dysDp186 166.3 and w1118 embryos, suggesting that DLP2 may participate in the localization of Dystrobrevin at this site (Figure 7A, C, E, and G). Interestingly, expression of Dystrobrevin in the longitudinals of the
CNS is disrupted in BL7663 embryos, but not in dysDLP2 E6 mutants or dysDp186 166.3 mutants compared to the w1118 control (Figure 7B, D, F, and H).
Dystrobrevin expression was also studied in larval body walls and brains of the same genotypes (Figure 8). Synaptic localization of Dystrobrevin at the NMJ is unchanged in BL7663, dysDLP2 E6, and dysDp186 166.3 body walls (Figure 8A-D). However, Dystrobrevin localization to the neuropile in third instar larval brains is disrupted in BL7663, but not in dysDLP2 E6 and dysDp186 166.3 (Figure 8E-H) as also seen in the embryonic stage. Dystrobrevin expression in the optic tectum in the brain was unaltered in all genotypes (Figure 8I-L), but localization of Dystrobrevin in the eye-antennal disc was disrupted in BL7663 and dysDLP2 E6 individuals, but not in dysDp186 166.3 larvae (Figure 8M-P).
In summary, Dystrobrevin localization appears to be dependent on the presence of Dystrophin at the muscle attachment sites, in the neuropile and in the eye-antennal disc.
More specifically, DLP2 expression is required for correct localization of Dystrobrevin at the muscle attachment sites and in the eye-antennal disc.
Figure 5: RT-PCR results showing differential expression for the different Dystrobrevin isoforms in discs versus body walls (BWs). The left row shows the results from the RT-PCR. The right row is the no- RT control, showing occasional contamination of genomic DNA in the cDNA samples. M indicates marker, Gen.
indicates the size of band from genomic DNA for the different isoforms to compare with the cDNA band.
Dystrobrevin (pan-Dyb representing all Dystrobrevin isoforms) expression is detected in both the body wall and discs of third instar larvae. Dystrobrevin D is expressed in both discs and body walls, whereas Dystrobrevin C is only expressed in the body wall. Dystrobrevin E expression could not be detected in third instar larvae; the only bands obtained in the RT-PCR apparently result from contamination by genomic DNA. Expected cDNA fragment sizes were pan-Dyb: 536bp, DybC: 500bp, DybD: 497bp, and DybE: 473bp. Expected sizes for genomic DNA fragments were pan-Dyb: 660bp, DybC: 11004bp (too large for amplification), DybD: 2638bp, and DybE: 759bp.
Since the Dystrobrevin pattern is highly similar to that of Dp186, we expected that Dp186 could be involved in the localization of Dystrobrevin in the neuropile. Therefore, we hypothesized that there could be expression of a truncated Dystrophin isoform containing the Dystrobrevin-interaction conserved C-terminus in the longitudinals of the dysDp186 166.3
mutant even though previous analyses using a Dp186 specific antibody confirmed the absence of the DP186 unique first exon in these mutants (see Chapter 4 of this thesis). In order to detect residual Dystrophin expression in the neuropile, we evaluated pan-Dystrophin expression in dysDp186 166.3 mutants using the anti-DysCO2H antibody (van der Plas et al., 2006). This analysis revealed that there is expression of a protein bearing the common Dystrophin C-terminus in the longitudinals of dysDp186 166.3 mutants (Figure 9), but not in the BL7663 Dystrophin deficiency line. At this moment it is unclear whether this residual Dystrophin expression in the dysDp186 166.3 mutant is due to expression of a truncated Dp186 protein, or whether this expression reflects the presence of another Dystrophin isoform in the neuropile.
Figure 6: Dystrobrevin localizes with actin to the sarcomeric I-band and is expressed at the synapse, but does not colocalize with muscle myosin. Representative photographs of double labelings of wild type third instar larval body walls with anti-Dybmid SN1481 and anti-actin (A-C), anti-Dybmid SN1481 and anti-muscle myosin (D-F), and anti-Dybmid SN1482 and anti-HRP (G-I). See Appendix for color figure.
Figure 7: Dystrobrevin (anti-DybCO2H) localization is affected in BL7663 Dystrophin deficient and dysDLP2 E6 embryos, but not in dysDp186 166.3 embryos. Representative photographs of embryonic body walls (A, C, E, G) and the CNS (B, D, F, H) of w1118 (A, B), BL7663 (C, D), dysDLP2 E6 (E, F) and dysDp186 166.3 (G, H).
Dystrobrevin expression is delocalized or absent in the Dystrophin deficient BL7663 embryos. Dystrobrevin is delocalized in dysDLP2 E6 body walls, but Dystrobrevin is localized normally in the CNS. Dystrobrevin is observed in the wild type pattern in both the CNS and the body wall of dysDp186 166.3 embryos.
Figure 8: Dystrobrevin localization is dependent on Dystrophin in the neuropile and eye-antennal disc of third instar larvae, but not at the NMJ or optic tectum. Representative photographs of Dystrobrevin localization at the NMJ (A-D; anti-Dybmid SN1482), neuropile (E-H; anti-DybCO2H), brain lobe (I- L; anti-DybCO2H) and eye-antennal disc (M-P; anti-DybCO2H) of w1118 (A, E, I, M), BL7663 (B, F, J, N), dysDLP2 E6 (C, G, K, O), and dysDp186 166.3 (D, H, L, P) third instar larvae. Dystrobrevin localization is aberrant in BL7663 larvae in the neuropile (F) and eye-antennal disc (N), but not at the neuromuscular junction (B) or in the optic tectum (J). Localization of Dystrobrevin in a restricted part of the eye-antennal disc depends on the presence of DLP2 (O; dotted pattern in each ommatidia indicated by the horizontal arrow).
3.3 Dystrobrevin is required for survival and muscle integrity
In order to study the effect of reduction of Dystrobrevin expression levels, we generated lines expressing double-stranded RNA from sequences present in all Dystrobrevin isoforms (see Figure 1). In order to examine the reduction of the expression levels of individual isoforms, Dystrobrevin expression was examined by Western Blotting (Figure 10). Comparisons between samples prepared from w1118 and RNAi lines revealed decreased expression of two protein species (arrows in Figure 10), whose sizes are those predicted for Dystrobrevin isoforms (see Table 1 for the expected protein sizes).
Figure 9: A protein bearing the common Dystrophin carboxyterminal domain is expressed in dysDp186 166.3 mutants. Representative photographs of anti-DysCO2H staining in w1118 (A), BL7663 (B), and dysDp186 166.3 (C) embryos reveal residual Dystrophin staining in a Dp186-like pattern in the longitudinals in the Dp186 mutant, but not in the pan-Dystrophin deficiency, BL7663.
To examine the effects of reducing Dystrobrevin expression levels in the RNAi-Dystrobrevin lines, we crossed these lines with the ubiquitously-expressed Daughterless-Gal4 (Da-Gal4) driver. This resulted in essentially 100% lethality of the progeny of the five lines examined at the pupal stage (data not shown). We have shown previously that reducing Dystrophin expression in the muscle is lethal (Chapter 5 of this thesis). We therefore used the muscle driver 24B-Gal4 to express the RNAi-Dyb construct to determine whether the lethality associated with ubiquitous expression of the Dystrobrevin-directed dsRNA could be due to reduced Dystrobrevin expression in the muscle. Reducing Dystrobrevin expression in the muscle was found to cause lethality (Figure 11). RNAi-Dyb/24B offspring died in the late pupal stage (w1118 4.8 ± 0.4%, RNAi-Dyb2C/24B 86.0 ± 3.4%, RNAi-Dyb3B/24B 76.9 ± 6.2%, RNAi-DyblateA/24B 70.7 ± 14.5%, RNAi-Dyb4A/24B 83.3 ± 6.9% and RNAi-Dyb5A/24B 93.7 ± 7.1% lethal). All RNAi-Dyb/24B offspring formed pharate adults which never emerged from the pupal cage. Dystrobrevin therefore has an important role in the muscle and is required for survival.
Loss of Dystrobrevin causes a mild muscular dystrophy in mice and loss of Dystrophin has been shown to result in muscle degeneration in flies as well as in mice (Chapter 5 of this thesis, Shcherbata et al., 2007). We therefore examined muscle integrity in the five RNAi- Dystrobrevin lines (Figure 12) when Dystrobrevin expression levels were reduced in the muscle using 24B-Gal4. Although the amount of actually ruptured or severely degenerated muscles was small, there were significantly more muscles that had dark patches, looked transparent or were very small in the RNAi-Dyb/24B lines compared to wild type muscles (10.5% for RNAi-Dyb2C/24B, 11.4% for RNAi-Dyb3B/24B, 8.8% for RNAi-DyblateA/24B, 8.9% for RNAi-Dyb4A/24B, and 9.0% for RNAi-Dyb5A/24B versus 1.7% for w1118). Therefore, Dystrobrevin appears to play a subtle role in maintaining muscle integrity.
Figure 10: Dystrobrevin protein isoform expression in RNAi-Dyb/Da-Gal4 lines. Line 1: protein from 50 w1118 embryos. Line 2: a ‘bulk’ sample for w1118 containing a larger amount of protein as a positive control. Line 3: marker. Lines 4-8: protein from 50 embryos of the RNAi-Dyb/Da-Gal4 lines. Line 9: marker. The markers are drawn in to show the size of the bands and the arrows point to the bands that are less pronounced in the RNAi- Dyb/Da-Gal4 lines. The third band from above (indicated by *) appears to be background since it is not more pronounced in the ‘bulk’ sample. See Table 1 for the predicted protein sizes.
Isoform Protein size (kDa) Nr. Amino acids
Dystrobrevin A 68 614
Dystrobrevin B 68 614
Dystrobrevin C 69 623
Dystrobrevin D 72 646
Dystrobrevin E 74 670
Table 1: Expected sizes of the different Dystrobrevin isoforms in Drosophila.
0%
20%
40%
60%
80%
100%
120%
w1118
RN Ai-Dy
b2C /24B
RN
Ai-Dyb3B/24B RN
Ai-DyblateA/24B
RNAi-Dyb4A/24B RN
Ai-Dy b5A
/24B
percentage of pupal lethality
Figure 11: Reduction in Dystrobrevin expression levels results in pupal lethality. The bar graph represents the percentages of pupal lethality, scored by comparing the number of pupae with the number of hatched flies, for w1118 (4.8 ± 0.4%, n=416), RNAi-Dyb2C/24B-Gal4 (86.0 ± 3.4%, n=164), RNAi-Dyb3B/24B- Gal4 (76.9 ± 6.2%, n=165), RNAi-DyblateA/24B-Gal4 (70.7 ± 14.5%, n=185), RNAi-Dyb4A/24B-Gal4 (83.3 ± 6.9%, n=158) and RNAi-Dyb5A/24B-Gal4 (93.7 ± 7.1%, n=162). Error bars represent the standard deviation.
Asterisks indicate statistical significance with p<0.05.
Lane 1 2 3 4 5 6 7 8 9
0%
2%
4%
6%
8%
10%
12%
14%
Wt
RN Ai-Dyb2
C/24B
RN
Ai-Dyb3B/24B RN
Ai-DyblateA/24B RN
Ai-Dyb4 A/24B
RN Ai-Dyb5A/
24B
Percentage of damaged muscles
Figure 12: Reduced expression levels of Dystrobrevin result in increased muscle damage in 3rd instar larval body walls. The bar graph represents the percentages of damaged muscles, scored based on absence, transparency or abnormal shape, in w1118 (n=10), RNAi-Dyb2C/24B-Gal4 (n=10), RNAi-Dyb3B/24B- Gal4 (n=13), RNAi-DyblateA/24B-Gal4 (n=10), RNAi-Dyb4A/24B-Gal4 (n=13) and RNAi-Dyb5A/24B-Gal4 (n=10); The percentage of damaged muscles is significantly increased in body walls of the RNAi-Dyb/24B-Gal4 lines compared to the wild type. The error bars show the standard error of mean for each line. Asterisks indicate statistical significance with p<0.05. Values: w1118 1.7% ± 0.6, RNAi-Dyb2C/24B-Gal4 10.5% ± 1.1, RNAi- Dyb3B/24B-Gal4 11.4 ± 0.7, RNAi-DyblateA/24B-Gal4 8.8% ± 1.4, RNAi-Dyb4A/24B-Gal4 8.9% ± 1.2 and RNAi- Dyb5A/24B-Gal4 9.0% ± 1.2.
We previously observed a wing phenotype in the dysDLP2 E6 mutant, crossveins were disrupted or absent (data not shown and Figure 13B). To evaluate potential roles for Dystrobrevin during wing development, we reduced the expression levels of Dystrobrevin in the dorsal wing blade using the MS1096-Gal4 driver. This resulted in curved up wings in the MS1096/+;
RNAi-Dyb2C/+ and MS1096/+; RNAi-Dyb5A/+ lines (Figure 13E and F). In the RNAi-Dyb lines 3B, lateA and 4A this phenotype was much weaker and could only occasionally be seen in males, presumably due to higher activity in males of the MS1096-Gal4, which is located on the X chromosome. This curving of the wing is also seen in MS1096/+;RNAi-DysCO2H/+
flies (Figure 13C), in which all Dystrophin isoforms are targeted (Chapter 5), and is very severe in 2xRNAi-Dp117-MS1096 flies (Figure 13D), in which Dystrophin Dp117 is targeted (Chapter 5), but was not observed in w1118 and dysDLP2 E6 flies (Figure 13A and B), suggesting that Dp117 and Dystrobrevin may play similar or redundant roles during wing formation.
4. Discussion
In this study, we have analyzed the expression of Drosophila Dystrobrevin in embryos and larvae. We have found that Dystrobrevin protein is expressed in the brain and neuropile as well as at the NMJ in the muscle. Furthermore, we find that Dystrobrevin localizes to similar areas as Dystrophin in the muscle. Dystrobrevin has been found to be located at the NMJ.
However, Dystrobrevin appears not to be present at the NMJ of muscles 6 and 7, which has only type I boutons, suggesting that Dystrobrevin might be specifically localized to either type II or type III boutons. It is unclear what function Dystrobrevin might have there, or if other DGC members also localize to these bouton types.
The Dystrobrevin expression pattern in the CNS, in the neuropile and optic tectum very closely resembles that of Dp186, suggesting their potential colocalization. Unfortunately, as both antisera are derived from the same species, we have not yet been able to perform double-labelings with Dystrophin and Dystrobrevin antibodies. This awaits either the generation of antisera in other species or direct labeling of the primary antibodies.
We show that in Drosophila, Dystrobrevin localization in the muscle, ventral nerve cord and eye-antennal disc is dependent on the presence of distinct Dystrophin isoforms. At present, it is unclear, whether the disappearance of Dystrobrevin labeling reflects delocalization, degradation of the protein, or reduced expression of the dystrobrevin gene. Dystrobrevin localization in humans and mice also depends on the presence of Dystrophin, suggesting that Drosophila Dystrobrevin and Dystrophin likely associate in a similar way as they do in vertebrates. Dystrobrevin localization at the optic tectum and at the NMJ, however, does not depend on Dystrophin expression. This is consistent with recent findings in vertebrates that DGC members are not localized by Dystrophin in all tissues. For instance, analyses of expression of the DGC members in the retina of mdx3cv mice show that wildtype localization of the sarcoglycan-sarcospan complex, Dystrobrevin and Syntrophin is independent of the presence or absence of Dystrophin in this tissue (Dalloz et al., 2001; Fort et al., 2005).
Figure 13: Wing defects in Dystrophin and flies with reduced expression of Dystrobrevin.
Representative photographs of adult flies (left) and wings (right) of w1118 (A), dysDLP2 E6 (B), MS1096/+;RNAi- DysCO2H/+ (C), 2xRNAi-Dp117-MS1096 (D), MS1096/+;RNAi-Dyb2C/+ (E), and MS1096/+;RNAi-Dyb5A/+
(F). Crossvein defects are visible in dysDLP2 E6 and MS1096/+;RNAi-DysCO2H/+. However, reduction of Dystrobrevin expression does not result in crossvein defects, but does cause curving of the wing, which is also seen in MS1096/+;RNAi-DysCO2H/+ (less severe than MS1096/+;RNAi-Dyb/+) and in 2xRNAi-Dp117-MS1096 flies (more severe than MS1096/+;RNAi-Dyb/+). 2xRNAi-Dp117-MS1096 wings are also much smaller in size.
The absence of Dystrobrevin expression in the neuropile of BL7663 Dystrophin deficient embryos and larvae, indicates that Dystrobrevin localization in this area is dependent on the presence of Dystrophin, but it is unclear which Dystrophin isoform is involved in this localization. The Dp186 Dystrophin isoform is the only isoform thus far known to be expressed in the neuropile of the ventral nerve cord. Since the Dystrophin expression pattern does not disappear in dysDp186 166.3 mutants, as shown by the pan-Dystrophin antibody, anti- DysCO2H (Figure 9C), it is possible that the mutation in dysDp186 166.3, which is located at the 5’
end in the unique first exon of this isoform, allows the expression of a truncated isoform
bearing the common C-terminal region. If this is the case, than Drosophila Dystrobrevin is possibly anchored by the cysteine-rich domain of Dystrophin, as is the case in vertebrates.
Alternatively, absence of Dp186 in the neuropile could trigger a compensatory expression of another isoform, not normally expressed in this region. It is also possible that another, as yet uncharacterized, Dystrophin isoform is expressed in the neuropile. The protein expression domains of the recently discovered Dp117 and Dp205 isoforms have not yet been characterized. RNA in situ analysis, which showed RNA expression of these isoforms in a restricted subset of cells at the midline of the ventral nerve cord (Chapter 5 of this thesis, van der Plas et al., 2007), suggests that they are not likely present in the neuropile.
Reduced expression levels of Dystrobrevin in the muscle causes lethality during the pupal stage. Pupal lethality was also observed when the Dystrophin Dp117 isoform expression was reduced in muscle (van der Plas et al., 2007), suggesting a similar role in survival for these two proteins. These observations are consistent with the hypothesis that Dystrophin and Dystrobrevin function in the same protein complex. Roles in stabilizing muscle integrity for both proteins are also supported by the result that reduced expression of either Dystrobrevin or Dp117 increased muscle damage in third instar larvae compared to wild type (van der Plas et al., 2007). It would be interesting to investigate whether combining the reduction of Dystrobrevin and Dp117 expression levels aggravates the phenotype.
In mice, Dystrobrevin deficiency also leads to a mild muscular dystrophy, but, unlike Dystrophin-deficient muscles, an intact plasma membrane is maintained (Grady et al., 1999;
Albrecht & Froehner, 2002), possibly due to the remainder of the DGC remaining localized to the sarcolemma. Membrane leakage occurs in the degenerating muscles of dystrophin mutant mice, but does not apparently occur in the degenerating muscles of dystrobrevin mutant mice. This difference suggests that membrane damage is not obligately required in the onset of muscle degeneration, but might be a secondary effect of Dystrophin disruption, which aggravates the dystrophic process. Furthermore, it appears that muscle degeneration can occur even when the structural link between the ECM and the cytoskeleton via the actin- binding domain of Dystrophin is still intact (Grady et al., 1999). Membrane leakage only occurs in the absence of this link, suggesting a second pathway leading to degeneration of the muscle cell.
Recently, Shcherbata et al. (2006) reported muscle degeneration in adult flies lacking Dystrophin (Dys8-2). It is unclear in this study which isoform is responsible for this phenotype. If the isoform involved is DLP2 than this phenotype could be induced by the absence of the link between the ECM and actin. It was not reported whether the muscle degeneration in Dys8-2 adult flies correlates with sarcolemmal damage. Muscle degeneration in larvae with reduced pan-Dystrophin expression has been shown to leave the sarcolemma intact (Chapter 5 and van der Plas et al., 2007). The integrity of the sarcolemma in larvae with reduced Dystrobrevin expression levels has not yet been investigated. The sarcolemma also remains intact in affected muscles of dystrobrevin mutant mice, suggesting that disruption of signaling pathways might underlie the onset of muscle degeneration in these mice. However, screens for Dystrobrevin-interacting proteins have so far mainly identified intermediate filament proteins, such as syncoilin, synemin and dysbindin (Mizuno et al., 2001; Newey et al., 2001b; Poon et al., 2002; Benson et al., 2001). Both syncoilin and synemin are part of the costameric lattice surrounding sarcomeres and bind to desmin, which is important for lateral force transmission during contraction. This has led to a theory of an alternative mechanical function for the DGC, namely in the stabilization of the link between the sarcolemma and the costameres. It is conceivable that absence of Dystrobrevin eliminates this link between the sarcolemma and the costameric lattice, resulting in muscle degeneration. An interaction between desmin and either Dystrobrevin or Dystrophin in Drosophila remains to be evaluated.
Reduction of Dystrobrevin expression levels in the wing results in curved up wings. Similar wing defects are seen in RNAi-DysCO2H/MS1096 and in 2xRNAi-Dp117-MS1096 flies, which have reduced expression levels of pan-Dystrophin and Dp117, respectively, in the dorsal wing blade. Curved up wings possibly result from differences in cell number or size between the dorsal and ventral wing blades. Furthermore, the absence or incomplete formation of the posterior and sometimes the anterior crossvein is found in the DLP2 deficient mutant dysDLP2
E6. Interestingly, the BMP homolog Dpp as well as BMP receptor homologs such as thickveins, are involved in crossvein formation and Dpp is involved in cell excretion in the wing, where reduced expression or absence of Dpp results in a reduced cell number, leading to wing curvature (Ralston & Blair, 2005; Shen & Dahmann, 2005). These results suggest that different Dystrophin isoforms could interact with BMP homologs in both crossvein formation as well as cell number determination. Additionally, Dpp has been shown to interact with the JNK signaling pathway. The activation of the JNK signaling pathway and an interaction with integrin has also been shown in blistery mutants (by; Lee, 2003).
Overexpression of by using MS1096-Gal4 results in convex wings and incomplete formation of the posterior crossvein. The similarities between these phenotypes suggest a possible involvement of the JNK apoptotic pathway and/or integrins in the curving of the wings of flies with reduced Dystrobrevin or Dystrophin expression.
Alternatively, the curving of the wing could be caused by a reduction in cell size, not number, in the dorsal wing blade, possibly regulated by the insulin signaling pathway. Overexpression of the insulin signaling pathway members dS6K and dAkt results in curved up wings (Rintelen, 2001), suggesting that Dystrophin might be involved in regulation of this pathway.
This is further supported by the proposed link between Dystroglycan and the insulin receptor pathway in axon guidance in the Drosophila brain (Shcherbata et al., 2007), between human Akt and Dystrophin in the hypertrophic response in DMD and LGMD muscles (Peter &
Crosbie, 2006) and in the development of cancer cachexia (Acharyya et al., 2005).
Interaction between Dystrobrevin or Dystrophin and the JNK apoptotic pathway or the insulin pathway has yet to be investigated in Drosophila.
In summary, we have shown that Drosophila Dystrobrevin is expressed in muscle and the nervous system, similar to human Dystrobrevin, and that it localizes to similar domains as Dystrophin. Its wildtype localization is largely dependent on the presence of Dystrophin, suggesting they are together in a complex, the Drosophila DGC. Reduced expression of Dystrobrevin causes muscle degeneration in third instar larvae and Dystrobrevin plays a critical role in the survival of the organism as shown by the high lethality rate during the pupal stage. Our results indicate that Drosophila is a valuable model system for the study of the role of Dystrobrevin in the onset of muscle degeneration, but could also give insight in the roles of the different other DGC members in the disease pathology of muscular dystrophies.
5. Acknowledgements
We thank the Bloomington Stock Center for fly stocks and Martijn van Schie, Bert van Veen and Monique Bansraj for help with the experiments. This work was supported by a ‘Pionier’
grant #900-02-003 of the ‘Nederlandse Organisatie voor Wetenschappelijk Onderzoek, N.W.O. (J.N. and L.G.F.).
6. References
Acharyya, S., Butchbach, M. E., Sahenk, Z., Wang, H., Saji, M., Carathers, M., Ringel, M. D., Skipworth, R. J., Fearon, K. C., Hollingsworth, M. A., Muscarella, P., Burghes, A. H., Rafael-Fortney, J. A., and Guttridge, D. C. (2005). Dystrophin glycoprotein complex dysfunction: a regulatory link between muscular dystrophy and cancer cachexia. Cancer Cell 8, 421-432.
Albrecht, D. E. and Froehner, S. C. (2002). Syntrophins and dystrobrevins: defining the dystrophin scaffold at synapses. Neurosignals. 11, 123-129.
Benson, M. A., Newey, S. E., Martin-Rendon, E., Hawkes, R., and Blake, D. J. (2001). Dysbindin, a novel coiled-coil-containing protein that interacts with the dystrobrevins in muscle and brain. J Biol.Chem. 276, 24232-24241.
Bessou, C., Giugia, J. B., Franks, C. J., Holden-Dye, L., and Ségalat, L. (1998). Mutations in the Caenorhabditis elegans dystrophin-like gene dys-1 lead to hyperactivity and suggest a link with cholinergic transmission. Neurogenetics. 2, 61-72.
Blake, D. J., Nawrotzki, R., Peters, M. F., Froehner, S. C., and Davies, K. E. (1996). Isoform diversity of dystrobrevin, the murine 87-kDa postsynaptic protein. J Biol.Chem. 271, 7802-7810.
Blake, D. J., Nawrotzki, R., Loh, N. Y., Gorecki, D. C., and Davies, K. E. (1998). beta-dystrobrevin, a member of the dystrophin-related protein family. Proc.Natl.Acad.Sci U.S.A 95, 241-246.
Blake, D. J., Hawkes, R., Benson, M. A., and Beesley, P. W. (1999). Different dystrophin-like complexes are expressed in neurons and glia. J Cell Biol. 147, 645-658.
Brand, A. H. and Perrimon, N. (1993). Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118, 401-415.
Carre-Pierrat, M., Grisoni, K., Gieseler, K., Mariol, M. C., Martin, E., Jospin, M., Allard, B., and Ségalat, L. (2006). The SLO-1 BK channel of Caenorhabditis elegans is critical for muscle function and is involved in dystrophin-dependent muscle dystrophy. J.Mol.Biol. 358, 387-395.
Cox, E. A. and Hardin, J. (2004). Sticky worms: adhesion complexes in C. elegans. J.Cell Sci. 117, 1885-1897.
Dalloz, C., Claudepierre, T., Rodius, F., Mornet, D., Sahel, J., and Rendon, A. (2001). Differential Distribution of the Members of the Dystrophin Glycoprotein Complex in Mouse Retina: Effect of the mdx3Cv Mutation. Molecular and Cellular Neuroscience 17, 908-920.
Dekkers, L. C., van der Plas, M. C., van Loenen, P. B., den Dunnen, J. T., van Ommen, G. J., Fradkin, L. G., and Noordermeer, J. N. (2004). Embryonic expression patterns of the Drosophila dystrophin-associated glycoprotein complex orthologs. Gene Expr.Patterns. 4, 153-159.
Fort, P., Estrada, F. J., Bordais, A., Mornet, D., Sahel, J. A., Picaud, S., Vargas, H. R., Coral- Vazquez, R. M., and Rendon, A. (2005). The sarcoglycan-sarcospan complex localization in mouse retina is independent from dystrophins. Neuroscience Research 53, 25-33.
Gieseler, K., Grisoni, K., and Ségalat, L. (2000). Genetic suppression of phenotypes arising from mutations in dystrophin-related genes in Caenorhabditis elegans. Curr.Biol. 10, 1092-1097.
Gieseler, K., Mariol, M. C., Bessou, C., Migaud, M., Franks, C. J., Holden-Dye, L., and Ségalat, L.
(2001). Molecular, genetic and physiological characterisation of dystrobrevin-like (dyb-1) mutants of Caenorhabditis elegans. J.Mol.Biol. 307, 107-117.
Grady, R. M., Grange, R. W., Lau, K. S., Maimone, M. M., Nichol, M. C., Stull, J. T., and Sanes, J. R.
(1999). Role for alpha-dystrobrevin in the pathogenesis of dystrophin-dependent muscular dystrophies.
Nat.Cell Biol. 1, 215-220.
Grady, R. M., Zhou, H., Cunningham, J. M., Henry, M. D., Campbell, K. P., and Sanes, J. R. (2000).
Maturation and maintenance of the neuromuscular synapse: genetic evidence for roles of the dystrophin- -glycoprotein complex. Neuron 25, 279-293.
Greener, M. J. and Roberts, R. G. (2000). Conservation of components of the dystrophin complex in Drosophila. FEBS Letters 482, 13-18.
Grisoni, K., Martin, E., Gieseler, K., Mariol, M. C., and Ségalat, L. (2002). Genetic evidence for a dystrophin-glycoprotein complex (DGC) in Caenorhabditis elegans. Gene 294, 77-86.
Grisoni, K., Gieseler, K., Mariol, M. C., Martin, E., Carre-Pierrat, M., Moulder, G., Barstead, R., and Ségalat, L. (2003). The stn-1 Syntrophin Gene of C. elegans is Functionally Related to Dystrophin and Dystrobrevin. Journal of Molecular Biology 332, 1037-1046.
Hoffman, E. P., Brown, R. H., Jr., and Kunkel, L. M. (1987). Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell 51, 919-928.
Ichida, F., Tsubata, S., Bowles, K. R., Haneda, N., Uese, K., Miyawaki, T., Dreyer, W. J., Messina, J., Li, H., Bowles, N. E., and Towbin, J. A. (2001). Novel gene mutations in patients with left ventricular noncompaction or Barth syndrome. Circulation 103, 1256-1263.
Kim, H., Rogers, M. J., Richmond, J. E., and McIntire, S. L. (2004). SNF-6 is an acetylcholine transporter interacting with the dystrophin complex in Caenorhabditis elegans. Nature 430, 891-896.
Lee, S. B., Cho, K. S., Kim, E., and Chung, J. (2003). blistery encodes Drosophila tensin protein and interacts with integrin and the JNK signaling pathway during wing development. Development 130, 4001-4010.
Loh, N. Y., Newey, S. E., Davies, K. E., and Blake, D. J. (2000). Assembly of multiple dystrobrevin- containing complexes in the kidney. Journal of Cell Science 113 ( Pt 15), 2715-2724.
Luo, L., Liao, Y. J., Jan, L. Y., and Jan, Y. N. (1994). Distinct morphogenetic functions of similar small GTPases: Drosophila Drac1 is involved in axonal outgrowth and myoblast fusion. Genes Dev. 8, 1787- 1802.
Megeney, L. A., Kablar, B., Garrett, K., Anderson, J. E., and Rudnicki, M. A. (1996). MyoD is required for myogenic stem cell function in adult skeletal muscle. Genes Dev. 10, 1173-1183.
Mizuno, Y., Thompson, T. G., Guyon, J. R., Lidov, H. G., Brosius, M., Imamura, M., Ozawa, E., Watkins, S. C., and Kunkel, L. M. (2001). Desmuslin, an intermediate filament protein that interacts with alpha -dystrobrevin and desmin. Proc.Natl.Acad.Sci U.S.A 98, 6156-6161.
Nawrotzki, R., Loh, N. Y., Ruegg, M. A., Davies, K. E., and Blake, D. J. (1998). Characterisation of alpha-dystrobrevin in muscle. Journal of Cell Science 111 ( Pt 17), 2595-2605.
Newey, S. E., Gramolini, A. O., Wu, J., Holzfeind, P., Jasmin, B. J., Davies, K. E., and Blake, D. J.
(2001a). A novel mechanism for modulating synaptic gene expression: differential localization of alpha- dystrobrevin transcripts in skeletal muscle. Mol.Cell Neurosci. 17, 127-140.
Newey, S. E., Howman, E. V., Ponting, C. P., Benson, M. A., Nawrotzki, R., Loh, N. Y., Davies, K. E., and Blake, D. J. (2001b). Syncoilin, a novel member of the intermediate filament superfamily that interacts with alpha-dystrobrevin in skeletal muscle. J Biol.Chem. 276, 6645-6655.
Peter, A. K. and Crosbie, R. H. (2006). Hypertrophic response of Duchenne and limb-girdle muscular dystrophies is associated with activation of Akt pathway. Exp.Cell Res. 312, 2580-2591.
Peters, M. F., O'Brien, K. F., Sadoulet-Puccio, H. M., Kunkel, L. M., Adams, M. E., and Froehner, S.
C. (1997). beta-dystrobrevin, a new member of the dystrophin family. Identification, cloning, and protein associations. J Biol.Chem. 272, 31561-31569.
Peters, M. F., Sadoulet-Puccio, H. M., Grady, M. R., Kramarcy, N. R., Kunkel, L. M., Sanes, J. R., Sealock, R., and Froehner, S. C. (1998). Differential membrane localization and intermolecular associations of alpha-dystrobrevin isoforms in skeletal muscle. J Cell Biol. 142, 1269-1278.
Poon, E., Howman, E. V., Newey, S. E., and Davies, K. E. (2002). Association of syncoilin and desmin:
linking intermediate filament proteins to the dystrophin-associated protein complex. J Biol.Chem. 277, 3433-3439.
Ralston, A. and Blair, S. S. (2005). Long-range Dpp signaling is regulated to restrict BMP signaling to a crossvein competent zone. Dev.Biol. 280, 187-200.
Reichhart, J. M., Ligoxygakis, P., Naitza, S., Woerfel, G., Imler, J. L., and Gubb, D. (2002). Splice- activated UAS hairpin vector gives complete RNAi knockout of single or double target transcripts in Drosophila melanogaster. Genesis. 34, 160-164.
Rintelen, F., Stocker, H., Thomas, G., and Hafen, E. (2001). PDK1 regulates growth through Akt and S6K in Drosophila. Proc.Natl.Acad.Sci U.S.A 98, 15020-15025.
Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). 'Molecular Cloning: A Laboratory Manual.' 2nd Edn.
(Cold Spring Harbor Laboratory Press: Plainview, New York.)
Ségalat, L. (2002). Dystrophin and functionally related proteins in the nematode Caenorhabditis elegans.
Neuromuscular Disorders 12, S105-S109.
Shcherbata, H. R., Yatsenko, A. S., Patterson, L., Sood, V. D., Nudel, U., Yaffe, D., Baker, D., and Ruohola-Baker, H. (2007). Dissecting muscle and neuronal disorders in a Drosophila model of muscular dystrophy. EMBO J 26, 481-493.
Shen, J. and Dahmann, C. (2005). Extrusion of cells with inappropriate Dpp signaling from Drosophila wing disc epithelia. Science 307, 1789-1790.
van der Plas, M. C., Pilgram, G. S. K., Plomp, J. J., de Jong, A., Fradkin, L. G., and Noordermeer, J.
N. (2006). Dystrophin is required for appropriate retrograde control of neurotransmitter release at the Drosophila neuromuscular junction. Journal of Neuroscience 26, 333-344.
van der Plas, M. C., Pilgram, G. S. K., de Jong, A., Bansraj, M. R. K. S., Fradkin, L. G., and Noordermeer, J. N. (2007). Drosophila Dystrophin is required for integrity of the musculature.
Mechanisms of Development 124, 617-630.
Wagner, K. R., Cohen, J. B., and Huganir, R. L. (1993). The 87K postsynaptic membrane protein from Torpedo is a protein-tyrosine kinase substrate homologous to dystrophin. Neuron 10, 511-522.
Wodarz, A., Hinz, U., Engelbert, M., and Knust, E. (1995). Expression of crumbs confers apical character on plasma membrane domains of ectodermal epithelia of Drosophila. Cell 82, 67-76.
