University of Groningen The long road Hilgendorf, Susan

The long road

Hilgendorf, Susan

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below.

Document Version

Publisher's PDF, also known as Version of record

Publication date: 2018

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA):

Hilgendorf, S. (2018). The long road: The autophagic network and TP53/ASXL1 aberrations in hematopoietic malignancies. Rijksuniversiteit Groningen.

Copyright

Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

Take-down policy

If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum.

background rescues apoptotic phenotype of

human hematopoietic stem and progenitor cells

but without overt malignant transformation

Susan Hilgendorf1 _{& Edo Vellenga}1

1 _{Department of Hematology, Cancer Research Center Groningen, University Medical Center Groningen, University of}

3

INTRODUCTION

With increasing age, the incidence of hematological malignancies rises, including myelodysplastic syndrome (MDS). MDS is characterized by ineffective hematopoiesis, a defect of differentiation in one or more hematopoietic lineages, which can progress to acute myeloid leukemia (AML) in time1,2_{. Throughout the development of MDS and AML, a vast}

subset of different driver mutations can be identified that are prognostic for disease outcome. In low-risk MDS, frequently one driver mutation can be recognized which is accompanied by a second mutation in the context of disease progression2,3_{. Two genes that are found to be}

co-mutated in MDS and AML patients are ASXL1 and TP534,5_{. Mutations altering or disabling}

TP53 can be missense mutations, frameshift mutations, or loss of the short arm of chromosome 17, where the TP53 gene is located6,7_{. The role of p53 in cell fate decisions makes it an attractive}

target for functional inactivation of its signaling pathways in cancer8,9_{. Functional knockout}

studies of the mouse TP53 gene, Trp53, revealed early spontaneous tumors and resistance to apoptosis after induced DNA damage10,11_{. In patients, TP53 mutations are mainly found in}

complex karyotype MDS and AML with unfavorable prognosis4,12_{. Mutations in ASXL1 are}

also generally associated with an unfavorable prognosis13_{. ASXL1 is an epigenetic modifier}

and mutations of it may lead to the truncation of its protein thereby disrupting the chromatin interacting and modifying domain. One of the main functions of ASXL1 is its interaction with the polycomb repressive complex 2 (PRC2). The PRC2 complex is stabilized and/ or recruited to the histone 3-lysine 27 by ASXL1, leading to trimethylation and thereby repression of certain loci14_{. Loss of function of ASXL1 in mice has been found to be embryonic}

lethal and after long latency, ASXL1 heterozygous mice developed MDS-like phenotypes15–17_.

Additionally, ASXL1 loss leads to reduced numbers of erythroid progenitors in vitro and in vivo, accompanied by increased apoptosis and decreased H3K27me3 levels18,19_{. Nevertheless,}

malignant transformation has only been observed in cells with altered genetic background, suggesting that ASXL1 mutations need to be accompanied by additional mutations14_.

In this study, we addressed whether simultaneous loss of ASXL1 and TP53 in human hematopoietic stem and progenitor cells (HSPC) can rescue the negative phenotype in the erythroid lineage upon ASXL1 knockdown and promote transformation. We used an RNAi approach to reduce gene expression of both genes independently. The obtained results demonstrate a growth advantage of shTP53/shASXL1 cells over shASXL1 single cells in vitro

METHODS AND MATERIALS

Primary cell isolation

After informed consent was obtained in accordance with the Declaration of Helsinki, CD34+

cord blood cells (CB) were isolated from the University Medical Center Groningen and the Obstetrics departments at the Martini Hospital, Groningen, The Netherlands. The AutoMacs (Miltenyi Biotec, Amsterdam, The Netherlands) was used to purify CB CD34+ _cells.

Cell culture

CB CD34+ _{cells were grown under erythroid permissive conditions in DMEM (Westburg,}

Leusden, The Netherlands) supplemented with 12% FCS, 10 mg/mL bovine serum albumin, 1% pen-strep, 1.9 mM sodium bicarbonate, 1 µM b-estradiol, 1 µM dexamethasone, 0.1 mM 2-mercaptoethanol, 0.3 mg/mL rHu Holo-Transferrin (Sigma, city country), 40 ng/ mL rHu IGF-1 (Sigma), 20 ng/mL SCF, 5 U/mL rHu EPO. Cells were also cultured under myeloid liquid conditions (IMDM supplemented with 20% FCS (Sigma, Zwijndrecht, The Netherlands), 1% pen-strep, interleukin 3 (IL-3; Gist-Brocades, Delft, The Netherlands), and stem cell factor (SCF, Amgen,Thousand Oaks, USA)).

Long-term cultures on stroma

Long-term cultures were performed as previously described20_{. Using MS5 stromal cells,}

CB CD34+ _{cells were expanded in long-term culture (LTC) medium (Gartner’s) (αMEM}

supplemented with 12.5% heat-inactivated horse serum, 12.5% heat-inactivated FCS, 1% pen-strep, 1μM hydrocortisone (Sigma) and 57.2 μM β-mercaptoethanol (Sigma)), with or without cytokines (SCF (20ng/mL)) and EPO (2U/mL)). Cultures were grown at 37°C and 5% CO2.

CFC assays

For colony forming cells (CFC) assays, GFP+ _CD34+ _{cells were plated in duplicate in 1 mL}

methylcellulose (H4230, Stem Cell Technologies, city country) supplemented with 20ng/ mL IL-3, interleukin-6, SCF, recombinant Human granulocyte-colony stimulating factor (G-CSF), Flt-3L, 10ng/mL granulocyte macrophage (GM)-CSF, and 1U/mL Epo. Colonies were scored within 10 to 14 days after plating.

Mouse Experiments

The humanized ectopic bone model was created as previously described21,22_{. Briefly, four}

hybrid scaffolds consisting of three 2–3mm biphasic calcium phosphate (BCP) particles engulfed in human MSCs were implanted subcutaneously into female NSG mice. Eight

3

three of the four scaffolds.

Lentiviral transductions

The lentiviral short hairpin RNA vector of human ASXL1 was a generous gift from prof. dr. Giovanni Morrone (University of Catanzaro Magna Græcia, Catanzaro, Italy). ASXL1 hairpins target the following sequences (1) GCTATGTCACAGGACAGTAAT and (2) CCAGGAGAATCAGTGCGTATA. The ASXL1 hairpin was cloned from a puro vector into the pLKO.1 lentiviral vector containing mCherry by cutting the restrictions sites with MUNI and SACII. As control, a pLKO.1 mCherry vector containing a scrambled (SCR) short hairpin was used. The TP53 hairpin targets the following sequence GACTCCAGTGGTAATCTACT and was cloned into a pHRTrip GFP vector. Lentiviral particles were produced by using the Fugene transfection system (Promega, Madison, WI, USA) together with the packaging construct PAX2, glycoprotein envelope plasmid VSV-G, and construct of interest. 293T cells were then transiently transfected and stable transduction of cell lines or CB CD34+

cells was performed. Transduction efficiencies were measured by fluorescence-activated cell sorter (FACS) analysis. Knockdown was verified by real-time polymerase chain reaction and Western blot.

Flow cytometry analysis

The following antibodies were used: brilliant violet anti-CD45 (H130, Biolegend, Alphen a/d Rijn, The Netherlands), allophycocyanin (APC)-conjugated anti-CD34 (581, BD Biosciences, Alphen a/d Rijn, The Netherlands), phycoerythrin (PE) anti-CD14 (HCD14, Biolegend), pacific blue (PB)-conjugated anti-CD15 (W6D3, Biolegend), brilliant violet anti-CD71 (M-A712, BD), R-PE anti-Glycophorin-A (JC159, Dako, Heverlee, Belgium). All cells were blocked with anti-human FcR block (Stem Cell Technologies) and murine cells were additionally blocked with anti-mouse Fc-γ (BD). Cells were then incubated with antibodies for 30 minutes at 4°C. All FACS analyses were performed on a FACS LSR-II, cells were sorted on a MoFlo-XDP or -Astrios (DakoCytomation, Carpinteria, CA, USA) and data were analysed using FlowJo vX.0.7.

Real time polymerase chain reaction

Total RNA was isolated using the RNeasy kit from QIAGEN (Venlo, The Netherlands) in accordance with the manufacturer’s recommendations. RNA was reverse transcribed with iScript reverse transcriptase (Biorad). Using the iQ SYBR Green supermix (Biorad), cDNA was real-time amplified with the CFX connect Real-Time System (Biorad) thermocycler. For primers and primer sequences, see Supplementary Table S I.

Annexin V staining

Cells were washed with calcium buffer (10 mM HEPES, 140 mM NaCL, 2.5 mM CaCl2) and Annexin-V-APC antibody (IQ products IQ-120F/A) was added for 20 minutes at 4°C. Cells were washed with calcium buffer and analyzed by FACS LSR-II.

Statistical Analysis

Student t-test from GrapPad Prism was used to analyze data. Data were expressed as means±s.d. and *p<0.05, *p<0.01, ***p<0.001 were considered significant.

RESULTS

Double loss of ASXL1 and TP53 rescues replating potential of HPSC

To delineate the role of ASXL1 and TP53 loss in hematopoiesis, we used an RNAi approach. We performed knockdown of control vectors (shSCR/shSCR, hereafter called control), knockdown of ASXL1 alone (shSCR/shASXL1, hereafter named shASXL1), knockdown of TP53 alone (shTP53/shSCR, hereafter called shTP53), or double knockdown (shTP53/ shASXL1). We transduced CD34+ _{cord blood cells in triplicates, sorted double transduced}

cells and confirmed knockdown with qRT-PCR and western blot (Fig 1A, S1A). Additionally,

knockdown of an independent set of hairpins was conducted and verified (S1B). Efficacy of transduction efficiency was equal among hairpins, as shown in S1C.

We previously observed that knockdown of ASXL1 decreases colony forming potential due to enhanced apoptosis18_{. To demonstrate whether downregulation of p53 can counteract}

this phenotype, we co-transduced CD34+ _{CB cells with shTP53 in the context of shASXL1.}

CD34+ _{cells were sorted and plated into a colony-forming assay, allowing for colony}

formation within 14 days (Fig 1B, S1D). Upon replating, granulocytic colony formation

of the TP53/ASXL1 double knockdown was enhanced four-fold when compared to the control (hairpin #1 p<0.01, hairpin #2 p<0.001), and more than three-fold when compared to ASXL1 and TP53 single knockdown (hairpin #1 p<0.05, hairpin #2 p<0.001). In addition, long-term suspension cultures were used to study the phenotypes of ASXL1 and TP53/ ASXL1 cells. Throughout time, shASXL1 cells revealed diminished growth compared to control cells (Fig 1C), which could partially be rescued by down-regulation of TP53.

FACS analyses of ASXL1 cells vs. TP53/ASXL1 cells demonstrated similar CD14 and CD15 percentage and total cell numbers (S2A). When cells were plated in CFC assays at different time points, cells with a double loss of ASXL1 and TP53 displayed significantly

3

Cumulative cell count myeloid liquid medium

days 0 50 100 150 0 20 40 60 80 100 shSCR shSCR

shSCR shASXL1shTP53 shSCRshTP53 shASXL1 shSCR shSCRshSCR shASXL1shTP53 shSCRshTP53 shASXL1

Colonies/ 1000 cells Colonies/ 30000 cells Replate *** ****** *** ** * * CFU-M CFU-G BFU-E 0 20 40 60 80 100 shSCR shSCR shSCR shASXl1 shTP53 shSCR shTP53 shASXL1 + + + + + + + + + + + + Colonies/ 10000 cells CFU-M CFU-G ** *** *** *** *** ** ** * ** *** *** ** ** ** * * ***** **

Day 8 Day 11 Day 15

Figure 1

B

A

C

_D

Figure 1. Double loss of ASXL1 and TP53 rescues replate potential of colonies. (A) Knockdown efficiency of ASXL1 and TP53 on mRNA levels at day 7 of myeloid liquid cultures (N=3).CFC analysis of CB cells expressing shSCR/shSCR, shSCR/shASXL1, shTP53/shSCR, shTP53/shASXL1 (N=4). (B) CFC analysis of CB cells expressing shSCR/shSCR, shSCR/shASXL1, shTP53/shSCR, shTP53/shASXL1 (N=4). (C) Cumulative cell count of transduced CB cells in myeloid liquid culture (N=3). (D) CFC analysis of cells from myeloid liquid cultures at different time points (N=2). (E) Cumulative cell count of transduced CB cells cultured on MS5 stroma (N=3). (F) CFC colonies derived from long-term culture initiating cell assay (N=2). (G) CFC colonies derived from long-term culture initiating cell assay (N=3).

Error bars represent standard deviation; *p<0.05; **p<0.01; ***p<0.001 shSCR shSCR shSCR shASXl1 shTP53 shSCR shTP53 shASXL1 weeks 0 1 2 3 4 5 0.1 1 10 100

Cumulative cell count MS5 co-culture

0 20 40 60 80 Colonies / 5000 cells shSCR shSCR_{shSCR shASXL1}shTP53 shSCR_{shTP53 shASXL1} CFU-M CFU-G 0 50 100 150 Colonies / 10000 cells shSCR shSCR_{shSCR shASXL1}shTP53 shSCR_{shTP53 shASXL1} 0 20 40 60 80 100 Colonies / 20000 cells shSCR shSCR_{shSCR shASXL1}shTP53 shSCR_{shTP53 shASXL1} * *** ** *** *** ** *** *** week 2 week 3 week 1 *_{* * **}* *****

E

F

G

Figure 1. Double loss of ASXL1 and TP53 rescues replate potential of colonies. (A) Knockdown

efficiency of ASXL1 and TP53 on mRNA levels at day 7 of myeloid liquid cultures (N=3).CFC analysis of CB cells expressing shSCR/shSCR, shSCR/shASXL1, shTP53/shSCR, shTP53/shASXL1 (N=4).

(B) CFC analysis of CB cells expressing shSCR/shSCR, shSCR/shASXL1, shTP53/shSCR, shTP53/

shASXL1 (N=4). (C) Cumulative cell count of transduced CB cells in myeloid liquid culture (N=3). (D)

CFC analysis of cells from myeloid liquid cultures at different time points (N=2). (E) Cumulative cell

count of transduced CB cells cultured on MS5 stroma (N=3). (F) CFC colonies derived from long-term

culture initiating cell assay (N=2). (G) CFC colonies derived from long-term culture initiating cell assay

(N=3).

more granulocytic colonies than shASXL1 (p<0.05) and control cells (Fig 1D). When

looking at gene expression at day 7, ASXL1 and TP53 were significantly down-modulated but downstream targets such as p21 and Bax were not significantly changed (S2B). Subsequently it was studied whether comparable results can be obtained if the transduced cells were cultured in the context of a stromal microenvironment. Therefore, long-term stromal cultures with a MS5 stromal layer were initiated (Fig 1E). A comparable degree of expansion

was observed in the different subgroups of transduced cells. FACS analyses of double TP53/ ASXL1 and ASXL1 single knockdown cells in suspension showed comparable CD14/CD15 percentage, as well as similar cell numbers over time (S2C, week 2 and 3). However, CFC formation in time demonstrated a strong decline of CFU-GM numbers in the shASXL1 cells, which could partially be rescued by down-regulation of p53, in particular of the granulocytic lineage (Fig 1F, week 3, p<0.01). To demonstrate these findings in more detail the

long-term culture initiating cell (LTC-IC) assay was used as a read-out for the ability of primitive progenitors to form colonies after an extended period in culture (Fig 1G). The data clearly

shows that loss of ASXL1 significantly reduces the cobblestone forming potential (control vs shASXL1, p<0.05) and additional knockdown of TP53 restores the phenotype.

Taken together, these data suggest that an additional knockdown of TP53 with ASXL1 gives an advantage for progenitors in suspension. Moreover, TP53 loss rescues the detrimental effect of ASXL1 loss on primitive progenitors and their ability to adhere to the bone marrow

in vitro and thereby restores primitive progenitors to similar numbers as control cells.

TP53 knockdown partially rescues adverse shASXL1 induced apoptotic phenotype of erythroid cells

To demonstrate whether similar findings can be observed of the erythroid lineage, CB CD34+

cells were transduced and cultured under erythroid permissive conditions. Persistent during culturing, shTP53/shASXL1 cells had a growth advantage over shASXL1 cells (Fig 2A).

On day 24, cells with a double knockdown had similar cumulative cell count to control cells and a significantly higher cell count than ASXL1 single cells (p<0.05). The knockdown of ASXL1 was accompanied with an increase in Annexin V+_{, which was rescued with additional}

3

Cumulative cell count erythroid liquid medium

days shSCR shSCR shSCR shASXl1 shTP53 shSCR shTP53 shASXL1 * * * * 0 5 10 15 20 25 Annexin V+ (%) shSCR shSCR

shSCR shASXL1shTP53 shSCRshTP53 shASXL1shSCR shSCRshSCR shASXL1shTP53 shSCRshTP53 shASXL1

Day 10 Day 13 shSCR/shSCR shTP53/shSCR shTP53/shASXL1 shSCR/shASXL1 * * * * 0 50 100 Erythroid differentiation (%) Day 10 shSCR shSCR shSCR shASXL1shTP53 shSCRshTP53 shASXL1 0 10 20 30 40

shSCR shSCR_{shSCR shASXL1}shTP53 shSCR_{shTP53 shASXL1}shSCR shSCR_{shSCR shASXL1}shTP53 shSCR_{shTP53 shASXL1}shSCR shSCR_{shSCR shASXL1}shTP53 shSCR_{shTP53 shASXL1}

Annexin V+ (%) CD71mid CD71bright/ GPA+ CD71bright *** * * * ** * * * * ** *

Figure 2

A

B

C

E

Figure 2. TP53 knockdown par ally rescues adverse shASXL1 induced apopto c phenotype of erythroid cells. (A) Cumula ve cell count of transduced CB cells cultured

+

under erythroid permissive condi ons (N=3). (B) Total percentage of Annexin V cells at day 10 and 14 in erythroid liquid cultures (N=3). (C) Percentage of erythroid

+

differen a ng cells at different stages and their percentage of Annexin V at day 10 of erythroid liquid cultures (N=3). (D) Gene expression of ASXL1 and TP53 normalized to NACA and RPS11 at 48hours (N=2) and day 7 of erythroid liquid cultures (N=4) (E) Gene

shSCR/shSCR shTP53/shSCR shTP53/shASXL1 shSCR/shASXL1 HOXA9 p21 BCL2 GATA2 0 2 4 6 8 Relative expression BNIP3L PIM1 0.0 0.5 1.0 1.5 Relative expression *** ****** ** *** ***** * **** *** ***** * ********* *** *** **

D

Figure 2. TP53 knockdown partially rescues adverse shASXL1 induced apoptotic phenotype of erythroid cells. (A) Cumula ve cell count of transduced CB cells cultured under erythroid permissive

condi ons (N=3). (B) Total percentage of Annexin V+ _{cells at day 10 and 14 in erythroid liquid cultures}

(N=3). (C) Percentage of erythroid differen a ng cells at different stages and their percentage of Annexin

V+ _{at day 10 of erythroid liquid cultures (N=3). (D) Gene expression of ASXL1 and TP53 normalized to}

NACA and RPS11 at 48hours (N=2) and day 7 of erythroid liquid cultures (N=4). (E) Gene expression

Throughout erythroid differentiation, cells pass through several stages of maturation. Differentiating from the immature cells in the CD71mid _{compartment towards the CD71}bright_,

CD71bright_/GPA+_{, and GPA}+_{, the final erythroid stadium. At day 10, cells with double}

knockdown of TP53 and ASXL1 revealed a significantly greater percentage of CD71mid _cells

compared to controls and shTP53 cells (Fig 2C, p<0.05). The apoptotic phenotype of ASXL1

single knockdown was significantly and transiently rescued within the CD71mid _compartment

(Day 10, shSCR/shSCR vs shTP53/shASXL1, p<0.05) and CD71bright _{(shSCR/shASXL1}

vs shTP53/shASXL1 p<0.01) (Fig 2C, S3A). Total cell numbers of shTP53/shASXL1

erythroid differentiating cells were unchanged when compared to shASXL1 single (S3B). A stable reduction in gene expression was observed in time (Fig 2D). Furthermore, reduction

of ASXL1 was associated with the up- and down-regulation of HOXA9, BNIP3L, GATA2, and PIM1 (Fig 2E). Additional knockdown of TP53 rescued loss of gene expression only

for GATA2 and PIM1. When looking at potential p53-related genes that could be involved in the rescue (Day 7), only BCL-2 appeared to be significantly changed (Fig 2E). The direct

downstream targets DAPK, BAX and PUMA did not display significantly altered gene expression (S3C). These findings suggest that the favorable phenotype of shTP53/shASXL1 is not due to an increase in total cell numbers but rather due to reduced apoptosis and enhanced cell survival.

Bone marrow microenvironment in vitro gives partial growth advantage but does not alter cell fate of shTP53/shASXL1 erythroid cells

The double knockdown of ASXL1 with TP53 led to a partial rescue of erythroid differentiating cells under liquid permissive cultures. We therefore investigated whether erythroid cells would receive additional benefits from a bone marrow microenvironment. Cells were transduced and grown on MS5 stromal cells with the addition of EPO and SCF to stimulate cell development and differentiation along the erythroid lineage. The double knockdown permitted a growth advantage over ASXL1 loss alone (Fig 3A, day 14, p<0.05) and double

loss of ASXL1 and TP53 was accompanied by a significant reduction in apoptosis when compared to ASXL1 knockdown (Fig 3B, Day 10, p<0.05). Throughout culturing, shTP53/

shASXL1 cells exposed a greater percentage of CD71mid _{than compared to shASXL1 cells}

(S3A, Fig 3C, day 10&14) with a consistently higher cell number (S4B). At day 14, shTP53/

shASXL1 cells had a significantly lower percentage of GPA+ _{compared to control, which was}

similar to shASXL1. Annexin V stainings conducted within the differentiation compartments revealed lower apoptosis of shTP53/shASXL1 compared to shASXL1 cells (Fig 3C). This

data suggests that intrinsic cues are responsible for the negative phenotype of the ASXL1 cells and extrinsic cues of the microenvironment affect the erythroid differentiation.

3

Figure 3

shSCR shSCR_{shSCR shASXL1}shTP53 shSCR shSCR shSCR_{shSCR shASXL1}shTP53 shSCR shSCR shSCR_{shSCR shASXL1}shTP53 shSCR

CD71mid CD71bright/ GPA+ GPA+ CD71bright ** *

shTP53 shASXL1 _{shTP53 shASXL1} shTP53 shASXL1 shTP53 shASXL1

* 0 5 10 0.1 1 10 100 1000 shSCR shSCR shSCR shASXl1 shTP53 shSCR shTP53 shASXL1 14 Cumulative cell count MS5 co-culture +Epo, SCF

days * * * * 0 2 4 6 8 10 12 Annexin V+ (%) * ** Day 10 Day 14 shSCR/shSCR shTP53/shSCR shTP53/shASXL1 shSCR/shASXL1 *

A

C

B

Figure 3. Bone marrow microenvironment in vitro gives partial growth advantage but does not alter cell fate of shTP53/shASXL1 erythroid cells. (A) Cumulative cell count of

transduced CB cells cultured on stroma complemented with EPO and SCF (N=3). (B)

+

Percentage of Annexin V cells at day 10 and 14 of suspension culture (N=3). (C)

+

Percentage of erythroid differentiating cells at different stages and their Annexin V percentage at day 14 (N=3).

Error bars represent standard deviation; *p<0.05; **p<0.01

Figure 3. Bone marrow microenvironment in vitro gives partial growth advantage but does not alter cell fate of shTP53/shASXL1 erythroid cells. (A) Cumulative cell count of transduced CB cells

cultured on stroma complemented with EPO and SCF (N=3). (B) Percentage of Annexin V+ _{cells at day}

10 and 14 of suspension culture (N=3). (C) Percentage of erythroid differentiating cells at different stages

and their Annexin V+ _{percentage at day 14 (N=3).}

Error bars represent standard deviation; *p<0.05; **p<0.01

Humanized bone marrow-like niche in the mouse does not lead to transformation of cells with double knockdown

The incomplete rescue of ASXL1 by an additional loss of TP53 cultured on MS5s may be partly due to the lack of a supportive microenvironment or due to a limited exposure time. Our lab previously proved that using a scaffold setting in vivo leukemic properties

are better maintained within a human niche than a mouse niche21_{. We therefore argued}

that a human microenvironment within a mouse may be optimal for cell survival and possibly malignant transformation. To this end, we transduced CD34+ _{CB cells with}

shTP53/shASXL1, injected them directly into three scaffolds per mouse, bled the mice in intervals and sacrificed after 48 weeks (Fig 4A). Remaining transduced CD34+ _{CB cells}

were sorted to determine knockdown efficiency. Figure 4B shows the sorting gates, which

4 3 1 2 CB CD34+ non-sorted GFP mCherry Intra-scaffold shTP53 shASXL1/ Bleeds Dissection 0 1 2 3 4 5 Human engraftment (%) Bone Marrow Spleen Liver 1L 1NC 1R 2R 100101102103104105 100 101 102 103 104 105Bone Marrow 100101102103104105 100 101 102 103 104 105 Liver 100101102103104105 100 101 102 103 104 105 Spleen

1L

2R

Figure 4

A

Human engraftment in blood (%)

Weeks post transplantation

7 10 18 30 34 38 43 48 0.0 0.5 1.0 1.5 _1L 1NC 1R 2L 2NC 2R shTP53 shASXL1 100101 102 103 104 105 100 101 102 103 104 105 28,3% 9,86% 26,0% 35,9% Day of injection 0.0 0.5 1.0 1.5 Relative expression shSCR shSCR_{shSCR shASXL1}shTP53 shSCR_{shTP53 shASXL1} ASXL1 0.0 0.5 1.0 1.5 TP53 shSCR shASXL1shTP53 shSCRshTP53 shASXL1 shSCR shSCR * ** ** * * ** * **

B

C

D

E

F

G

Figure 4. Humanized bonemarrow-like niche in the mouse does not lead to transformation of cells with double knockdown. (A) Graphic overview of experimental set-up. (B) FACS plot of transduction efficiency of

shTP53 and shASXL1 at day of injection. (C) Gene expression normalized to NACA and RPS11 at day of injection. Shown are internal repeats. (D) Percentage of human engraftment in the blood for six mice. Cage: 1 or 2; cut ear: L=left; R=right; NC=no-cut. (E) Percentage human engraftment in bone marrow, liver, and spleen for four mice. (F) FACS plot GFP/mCherry positive cells within mouse organs for two mice. (G) Representative H&E staining showing development of bone and human cell engraftment (arrows).

Error bars represent standard deviation; *p<0.05; **p<0.01

Figure 4. Humanized bonemarrow-like niche in the mouse does not lead to transformation of cells with double knockdown. (A) Graphic overview of experimental set-up. (B) FACS plot of transduction

efficiency of shTP53 and shASXL1 at day of injection. (C) Gene expression normalized to NACA and

RPS11 at day of injection. Shown are internal repeats. (D) Percentage of human engraftment in the blood

for six mice. Cage: 1 or 2; cut ear: L=left; R=right; NC=no-cut. (E) Percentage human engraftment in

bone marrow, liver, and spleen for four mice. (F) FACS plot GFP/mCherry positive cells within mouse

organs for two mice. (G) Representative H&E staining showing development of bone and human cell

engraftment (arrows).

3

knockdown for ASXL1 and TP53 within the groups (Fig 4C). Engraftment of human

CD45+ _{cells was low throughout maturing of the mouse and declined after 34 weeks (Fig}

4D). After sacrificing, bone marrow, spleen and liver were examined for human engraftment,

and the TP53 (GFP)/ASXL1 (mCherry) percentage in the bone marrow, liver and spleen was analyzed (Fig 4E). FACS data suggested that GFP and mCherry double positivity was

mostly due to auto fluorescence (Fig 4F), suggesting that a combined knockdown of ASXL1

and TP53 is inefficient in allowing for long-term engraftment and subsequently malignant transformation. Additionally, scaffolds were embedded and examined for the presence of CD45+ _{cells (Fig 4G). Few human CD45}+ _{cells could be found within the scaffolds, suggesting}

that cells with a double knockdown of ASXL1 and p53 did not benefit from the human bone marrow microenvironment.

DISCUSSION

ASXL1 has critical function in the up-make of the hematopoietic compartment whereby loss of function is associated with embryonic lethality at high frequency. Heterozygous mice have a milder phenotype and can develop a MDS-like phenotype but only in the presence of an co-mutation such as TET2 or in the background of NRAS12GD14,15_{. In healthy individuals ASXL1}

mutations can also be demonstrated in low-frequency but without displaying a malignant phenotype23,24_{. Many of these persons present with clonal hematopoiesis of indeterminate}

potential (CHIP) where clones with a mutation of one leukemogenic gene demonstrate preferential expansion25,26_{. However, current studies suggest that additional mutations are}

necessary for CHIP to progress into MDS or AML. TP53 is, like ASXL1, often present in CHIP27_{. A co-mutation of both genes is frequently observed, implying that hematopoietic}

clones have a selection benefit and may contribute to MDS and/or AML development. In this study, we investigated the loss of ASXL1 alone and in combination with TP53 knockdown. We observed a strong apoptotic effect of ASXL1 knockdown on cell proliferation and differentiation, specifically along the erythroid lineage but without triggering malignant transformation. Furthermore, colony formation and stem cell frequency was impaired. Additional knockdown of TP53 restored stem cell frequency of shASXL1 cells to normal levels and had an overall beneficial effect on HSPC development. In vivo studies showed that

the adverse effects of ASXL1 loss on HSPCs were too dominant and additional loss of TP53 was not sufficient to allow for engraftment of cord blood cells and malignant transformation. Recent studies of clonal evolution in MDS have demonstrated that ASXL1 and TP53 frequently co-occur in high-risk MDS but that also additional mutations emerge during malignant transformation4,28_{. We have shown that in general cells benefit from a combined}

knockdown of TP53 and ASXL1 versus single knockdown of ASXL1. Conversely, high-risk MDS patients can present with three mutations or more suggesting that two mutations might be too limited to recapitulate the full spectrum of malignant transformation in human HPSC29,30_.

Moreover, the type of ASXL1 and TP53 abrogation may also be of importance. Many mouse studies have shown that loss of TP53 leaves mice prone to develop tumours10,31_{. Lack of}

evidence that a mutated ASXL1 protein is functional suggested that a RNAi approach might be an appropriate way to mimic patient setting. However, recent studies have shown that overexpressed mutated ASXL1 proteins are capable of acting within the PR-DUB pathway and globally erase and diminish H2AK119ub and H3K27me3, respectively32,33_{. Similarly, TP53}

mutations are also associated with loss of function. However, new studies have demonstrated that mutated TP53 protein can also gave additional functions by directly targeting chromatin modifiers and by affecting the proteasome gene transcription34,35_{. Therefore, a combined}

knockdown of ASXL1 and TP53 may not reflect the total mutational status as observed in MDS and AML. Furthermore, the order of mutation may play crucial role in what phenotype cells present with. Ortmann et al. discovered that TET2 mutations preceding JAK2 V617F heavily influenced the JAK2 V617F activated transcriptional program36_{. The order of mutation}

appeared to be of such importance that it affected the clonal evolution in patients.

In our mouse model, we observed a lack of engraftment in part due to lack of expansion of cells. A study conducted by Wong et al suggests that additional external cues are necessary to allow for increased cells expansion37_{. They demonstrated in their mouse model that}

TP53 mutated HSPCs revealed preferential expansion after exposure to chemotherapy treatment, leading to therapy-related AML and MDS37_{. While the human bone marrow}

niche is capable of maintaining leukemic cell properties it may not be sufficient for ASXL1/ TP53 transforming myeloid cells without an additional stress factor. In summary, our data demonstrate that ASXL1 compromised cells benefit from loss of TP53 but do not lead to malignant transformation.

3

REFERENCES

1. Jaiswal S, Ebert B. MDS Is a Stem Cell Disorder After All. Cancer Cell 2014;25713–714.

2. Cazzola M, Della Porta MG, Malcovati L. The genetic basis of myelodysplasia and its clinical relevance. Blood 2013;122(25):4021–4034. 3. Dombret H. Gene mutation

and AML pathogenesis. Blood 2011;118(20):5366–5367. 4. Sallman DA, Komrokji R,

Vaupel C, et al. Impact of TP53 mutation variant allele frequency on phenotype and outcomes in myelodysplastic syndromes. Leukemia 2016;30(3):666–673. 5. Bejar R, Stevenson K, Abdel-Wahab

O, et al. Clinical effect of point mutations in myelodysplastic syndromes. N Engl J Med 2011;364(26):2496–2506. 6. Guimaraes DP, Hainaut P. TP53:

a key gene in human cancer. Biochimie 2002;84(1):83–93. 7. Jasek M, Gondek LP, Bejanyan N,

et al. TP53 mutations in myeloid malignancies are either homozygous or hemizygous due to copy number-neutral loss of heterozygosity or deletion of 17p. Leukemia 2010;24(1):216–219. 8. Levine AJ. p53, the cellular

gatekeeper for growth and division. Cell 1997;88(3):323–331. 9. Soussi T, Wiman KG. Shaping

genetic alterations in human cancer: the p53 mutation paradigm. Cancer Cell 2007;12(4):303–312. 10. Donehower LA, Harvey M, Slagle

BL, et al. Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours. Nature 1992;356(6366):215–221. 11. Clarke AR, Purdie CA, Harrison

DJ, et al. Thymocyte apoptosis induced by p53-dependent and

independent pathways. Nature 1993;362(6423):849–852. 12. Blagosklonny MV. p53 from

complexity to simplicity: mutant p53 stabilization, gain-of-function, and dominant-negative effect. FASEB J Off Publ Fed Am Soc Exp Biol 2000;14(13):1901–1907. 13. Bejar R, Stevenson KE, Caughey

BA, et al. Validation of a Prognostic Model and the Impact of Mutations in Patients With Lower-Risk Myelodysplastic Syndromes. J Clin Oncol 2012;30(27):3376–3382. 14. Abdel-Wahab O, Adli M, LaFave

LM, et al. ASXL1 Mutations Promote Myeloid Transformation through Loss of PRC2-Mediated Gene Repression. Cancer Cell 2012;22(2):180–193. 15. Abdel-Wahab O, Gao J, Adli M,

et al. Deletion of Asxl1 results in myelodysplasia and severe developmental defects in vivo. J Exp Med 2013;210(12):2641–2659. 16. Wang J, Li Z, He Y, et al. Loss of Asxl1 leads to myelodysplastic syndrome-like disease in mice. Blood 2014;123(4):541–553. 17. Inoue D, Kitaura J, Togami K, et

al. Myelodysplastic syndromes are induced by histone methylation-altering ASXL1 mutations. J Clin Invest 2013;123(11):4627–4640. 18. Hilgendorf S, Folkerts H, Schuringa

JJ, Vellenga E. Loss of ASXL1 triggers an apoptotic response in human hematopoietic stem and progenitor cells. Exp Hematol [Epub ahead of print]. 19. Shi H, Yamamoto S, Sheng M,

et al. ASXL1 plays an important role in erythropoiesis. Sci Rep 2016;628789.

20. Schepers H, van Gosliga D, Wierenga ATJ, Eggen BJL, Schuringa JJ, Vellenga E. STAT5 is required for long-term maintenance

stem/progenitor cells. Blood 2007;110(8):2880–2888. 21. Antonelli A, Noort WA, Jaques J,

et al. Establishing human leukemia xenograft mouse models by implanting human bone marrow-like scaffold-based niches. Blood 2016;128(25):2949–2959. 22. Sontakke P, Carretta M, Jaques

J, et al. Modeling BCR-ABL and MLL-AF9 leukemia in a human bone marrow-like scaffold-based xenograft model. Leukemia 2016;30(10):2064–2073. 23. Xie M, Lu C, Wang J, et al.

Age-related mutations associated with clonal hematopoietic expansion and malignancies. Nat Med 2014;20(12):1472–1478. 24. Jaiswal S, Fontanillas P, Flannick

J, et al. Age-Related Clonal Hematopoiesis Associated with Adverse Outcomes. N Engl J Med 2014;371(26):2488–2498. 25. Steensma DP, Bejar R, Jaiswal

S, et al. Clonal hematopoiesis of indeterminate potential and its distinction from myelodysplastic syndromes. Blood 2015;126(1):9– 16.

26. Heuser M, Thol F, Ganser A. Clonal Hematopoiesis of Indeterminate Potential. Dtsch Arzteblatt Int 2016;113(18):317–322. 27. Link DC, Walter MJ. ’CHIP’ping

away at clonal hematopoiesis. Leukemia 2016;30(8):1633–1635. 28. Della Porta MG, Gallì A,

Bacigalupo A, et al. Clinical Effects of Driver Somatic Mutations on the Outcomes of Patients With Myelodysplastic Syndromes Treated With Allogeneic Hematopoietic Stem-Cell Transplantation. J Clin Oncol Off J Am Soc Clin Oncol [Epub ahead of print]. 29. Haferlach C. Genes break barrier

30. Papaemmanuil E, Gerstung M, Malcovati L, et al. Clinical and biological implications of driver mutations in

myelodysplastic syndromes. Blood 2013;122(22):3616–3627; quiz 3699.

31. Kemp CJ, Donehower LA, Bradley A, Balmain A. Reduction of p53 gene dosage does not increase initiation or promotion but enhances malignant progression of chemically induced skin tumors. Cell 1993;74(5):813–822. 32. Inoue D, Matsumoto M, Nagase R,

et al. Truncation mutants of ASXL1 observed in myeloid malignancies are expressed at detectable protein levels. Exp Hematol 2016;44(3):172–176.e1. 33. Balasubramani A, Larjo A, Bassein

JA, et al. Cancer-associated ASXL1 mutations may act as gain-of-function mutations of the ASXL1– BAP1 complex. Nat Commun 2015;67307.

34. Zhu J, Sammons MA, Donahue G, et al. Gain-of-function p53 mutants co-opt chromatin pathways to drive cancer growth. Nature 2015;525(7568):206–211. 35. Walerych D, Lisek K, Sommaggio

R, et al. Proteasome machinery is instrumental in a common gain-of-function program of the p53 missense mutants in cancer. Nat Cell Biol 2016;18(8):897–909. 36. Ortmann CA, Kent DG, Nangalia

J, et al. Effect of mutation order on myeloproliferative neoplasms. N Engl J Med 2015;372(7):601–612. 37. Wong TN, Ramsingh G, Young AL,

et al. Role of TP53 mutations in the origin and evolution of therapy-related acute myeloid leukaemia. Nature 2015;518(7540):552–555.

3

SUPPLEMENTARY FIGURES

Supplemental Figure 1

A

B

Colonies/ 1000 cells Colonies/ 30000 cells Replate ****** CFU-M CFU-G BFU-E 0 50 100 150 ** * ₀ 40 80 120 shSCR shSCR shSCR shASXL1 (#2)shTP53 (#2) shSCR shTP53 (#2) shASXL1 (#2) *** *** *** shSCR shSCR 100 101 102 103 104 100 ₁₀1 ₁₀2 ₁₀3 ₁₀4 100 101 102 103 104 100 101 102 103 104 shSCR shASXL1 (#2) 100 101 102 103 104 100 ₁₀1 ₁₀2 ₁₀3 ₁₀4 100 101 102 103 104 100 101 102 103 104 shSCR shSCR shSCR shASXL1 16,1% 30,4% 30,4% 35,6% 11,7% 52,5% 18,4% 17,4% 8,85% 46,6% 21,2% 23,3% 11,8% 33,2% 21,0% 34,0% 100 101 102 103 104 100 ₁₀1 ₁₀2 ₁₀3 ₁₀4 100 101 102 103 104 100 ₁₀1 ₁₀2 ₁₀3 ₁₀4 shTP53 shSCR shTP53 shASXL1 6,9% 40,6% 27,8% 24,7% 8,1% 33,6% 25,5% 32,9% 100 101 102 103 104 100 ₁₀1 ₁₀2 ₁₀3 ₁₀4 100 101 102 103 104 100 101 102 103 104 shASXL1 (#2) shSCR shTP53 (#2) shTP53 (#2) 15,6% 33,3% 17,1% 34,0% 14,0% 41,0% 18,8% 26,2%

D

C

Supplemental Figure 1. Reduced apoptosis of maturing erythroid cells. (A) Protein levels of hairpin #1. (B) Gene expression hairpin #2 normalized to NACA and RPS11 and protein levels. (C) Flow cytometry of efficacy of two independent hairpins. (D) CFC analysis of CB cells expressing hairpin #2 shSCR/shSCR, shSCR/shASXL1, shTP53/shSCR, shTP53/shASXL1 (N=3).

Error bars represent standard devia on; *p<0.05; **p<0.01; ***p<0.001

Supplemental Figure 1. Reduced apoptosis of maturing erythroid cells. (A) Protein levels of hairpin

#1. (B) Gene expression hairpin #2 normalized to NACA and RPS11 and protein levels. (C) Flow

cytometry of efficacy of two independent hairpins. (D) CFC analysis of CB cells expressing hairpin #2

Supplemental Figure 2

p21 DAPK BCL2 PUMA BAX 0 1 2 3 4 5 Relative expression shTP53 shSCR shSCR shSCR shSCR shASXL1 shTP53 shASXL1

Supplemental Figure 2. Downstream targets of TP53 unaltered. (A) CD14+ and

CD15+ cells from myeloid liquid cultures at different me points (N=2). (B) Gene expression normalized to NACA and RPS11 at day 7 of myeloid liquid cultures (N=2). (C) CD14+ and CD15+ cells from suspension at different me points (N=2). shTP53 shSCR shSCR shSCR shSCR shASXL1 shTP53 shASXL1 CD14+ (%) 0 5 10 15 20 25 30 Day 11 Day 15 1 10 100 1000 10000 100000 Day 11 Day 15 Cell number CD14+ 0 10 20 30 40 50 60 70 CD15+ (%) Day 11 Day 15 * * * ** * * * * 1 10 100 1000 10000 100000 1000000 Day 11 Day 1 Cell number CD15+ shTP53 shSCR shSCR shSCR shSCR shASXL1 shTP53 shASXL1

A

B

C

Supplemental Figure 2. Downstream targets of TP53 unaltered. (A) CD14+ _{and CD15}+ _{cells from}

myeloid liquid cultures at different me points (N=2). (B) Gene expression normalized to NACA and

RPS11 at day 7 of myeloid liquid cultures (N=2). (C) CD14+ _{and CD15}+ _{cells from suspension at different}

3

shSCR shSCR_{shSCR shASXL1}shTP53 shSCR_{shTP53 shASXL1}shSCR shSCR_{shSCR shASXL1}shTP53 shSCR_{shTP53 shASXL1}shSCR shSCR_{shSCR shASXL1}shTP53 shSCR_{shTP53 shASXL1}

Annexin V+ (%) CD71mid CD71bright/ GPA+ CD71bright 1.0×1000 1.0×1001 1.0×1002 1.0×1003 1.0×1004 1.0×1005 1.0×1006 1.0×1007

Cell numbers of erythroid differentiating cells shSCR shSCR shSCR shASXL1 shTP53 shSCR shTP53 shASXL1 + + + + Day 10 Day 13 + + + + + + + + + + + + + + + + + + + + * * * *

Day 10 Day 13 Day 10 Day 13

* * * * ** _* * * * *

Supplemental Figure 3

A

B

DAPK PUMA BAX

0 1 2 3 4 Relative expression shTP53 shSCR shSCR shSCR shSCR shASXL1 shTP53 shASXL1

Supplemental Figure 3. Reduced apoptosis of maturing erythroid cells. (A)

Day 13: Percentage of cells in stages of erythroid differen a on and their

+

percentage of Annexin V (N=3). (B) Total numbers of cells of erythroid

C

Supplemental Figure 3. Reduced apoptosis of maturing erythroid cells. (A) Day 13: Percentage of

cells in stages of erythroid differen a on and their percentage of Annexin V+ _{(N=3). (B) Total numbers of}

cells of erythroid differen a on in different stages (N=3). (C) Gene expression of target genes normalized

against NACA and RPS11 at day 7 of erythroid liquid cultures (N=2).

Supplemental Figure 4

shSCR shSCR_{shSCR shASXL1}shTP53 shSCR shSCR shSCR_{shTP53 shASXL1shSCR shASXL1}shTP53 shSCR shSCR shSCR_{shSCR shASXL1}shTP53 shSCR shTP53 shASXL1 shTP53 shASXL1 shSCR shSCR shSCR shASXL1shTP53 shSCRshTP53 shASXL1

A

Day 10 Day 14 Day 10 Day 14 Day 10 Day 14 Day 10 Day 14 * **

B

Supplemental Figure 4. Double loss gives advantage to total cell numbers. (A) Day 10: Percentage of erythroid differen a on throughout

different stages and the respec ve Annexin V+ percentage. (B) Total cell numbers of erythroid differen a ng cells at different stages.

Error bars represent standard devia on; *p<0.05; **p<0.01

Supplemental Figure 4. Double loss gives advantage to total cell numbers. (A) Day 10: Percentage of

erythroid differen a on throughout different stages and the respec ve Annexin V+ _{percentage. (B) Total cell}

numbers of erythroid differen a ng cells at different stages. Error bars represent standard devia on; *p<0.05; **p<0.01

3

SUPPLEMENTARY TABLES

Table S I. List of qPCR primer sequences in this study

Gene Forward primers (5’ to 3’) Reverse primers (5’ to 3’)

ASXL1 GGTCAAATGAAGCGCAACAGAG ACGGAGGTTGGTGTTGACAAG

BAX CCAGCAAACTGGTGCTCAAG GGAGGCTTGAGGAGTCTCAC

BCL2 AACATCGCCCTGTGGATGAC GGCCGTACAGTTCCACAAAG

BNIP3L ACACGTACCATCCTCATC GATCTGCCCATCTTCTTG

CDKN1A CGACTGTGATGCGCTAATGG CGTTTTCGACCCTGAGAG

DAPK GGTCTTGAGGCAGATATG GTAGTTGACAGCGGATAC

GATA2 AGCAAGGCTCGTTCCTGTTC GTCGGTTCTGCCCATTCATC

HOXA9 TGCAGTTTCATAATTTCCGTCG ACGTAGTAGTTGCCCAGGGCC

NACA GCCCTGCTTCAGATACTTAC GAGACAGCTTCACCTTGAAC

P53 GAGATGTTCCGAGAGCTGAATGAGGC TCTTGAACATGAGTTTTTTATGGCGGGAGG

PIM1 TCAAACACGTGGAGAAGG TAATGACGCCGGAGAAAC

PUMA GACCTCAACGCACAGTACG GGCAGGAGTCCCATGATGAG