andCorrellaS.Detweiler † JosVanderleyden, *KathleenMarchal, ‡TineL.A.Verhoeven, KristofEngelen, SigridC.J.DeKeersmaecker, hilA Itself Salmonellaenterica SerovarTyphimuriumHilARegulatoryProtein,Including MicroarrayAnalysisandMotifDetectionRevealNewTargetso

0021-9193/05/$08.00

⫹0 doi:10.1128/JB.187.13.4381–4391.2005

Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Microarray Analysis and Motif Detection Reveal New Targets of the

Salmonella enterica Serovar Typhimurium HilA Regulatory Protein,

Including hilA Itself

Sigrid C. J. De Keersmaecker,

* Kathleen Marchal,

‡ Tine L. A. Verhoeven,

Kristof Engelen,

Jos Vanderleyden,

and Corrella S. Detweiler

†

Centre of Microbial and Plant Genetics, K. U. Leuven, Kasteelpark Arenberg 20, 3001 Leuven, Belgium,

_ESAT-SCD,

K. U. Leuven, Kasteelpark Arenberg 10, 3001 Leuven, Belgium,

_{and Department of Microbiology and}

Immunology, Stanford University School of Medicine, Stanford, California 94305-5124

Received 7 February 2005/Accepted 1 April 2005

DNA regulatory motifs reflect the direct transcriptional interactions between regulators and their target

genes and contain important information regarding transcriptional networks. In silico motif detection

strat-egies search for DNA patterns that are present more frequently in a set of related sequences than in a set of

unrelated sequences. Related sequences could be genes that are coexpressed and are therefore expected to

share similar conserved regulatory motifs. We identified coexpressed genes by carrying out microarray-based

transcript profiling of Salmonella enterica serovar Typhimurium in response to the spent culture supernatant

of the probiotic strain Lactobacillus rhamnosus GG. Probiotics are live microorganisms which, when

adminis-tered in adequate amounts, confer a health benefit on the host. They are known to antagonize intestinal

pathogens in vivo, including salmonellae. S. enterica serovar Typhimurium causes human gastroenteritis.

Infection is initiated by entry of salmonellae into intestinal epithelial cells. The expression of invasion genes

is tightly regulated by environmental conditions, as well as by many bacterial factors including the key

regulator HilA. One mechanism by which probiotics may antagonize intestinal pathogens is by influencing

invasion gene expression. Our microarray experiment yielded a cluster of coexpressed Salmonella genes that

are predicted to be down-regulated by spent culture supernatant. This cluster was enriched for genes known

to be HilA dependent. In silico motif detection revealed a motif that overlaps the previously described HilA box

in the promoter region of three of these genes, spi4_H, sicA, and hilA. Site-directed mutagenesis,

␤-galactosi-dase reporter assays, and gel mobility shift experiments indicated that sicA expression requires HilA and that

hilA is negatively autoregulated.

Infections with Salmonella serotypes are a major cause of

food-borne diseases worldwide (89). Salmonella enterica

sero-var Typhimurium usually causes gastroenteritis. Although this

is often a self-limiting disease marked by diarrhea and

abdom-inal cramps, the infection can be more severe, resulting in

bacteremia, fever, or even death (72). Salmonellosis is initiated

when S. enterica serovar Typhimurium crosses the intestinal

mucosa of a host (41). Many of the genes required for

Salmo-nella epithelial cell invasion are encoded on SalmoSalmo-nella

patho-genicity island 1 (SPI1) (23, 101, 105, 106). The invasive

phe-notype varies greatly in response to growth under different

environmental conditions (e.g., osmolarity, oxygen tension,

pH) (63, 65).

An intricate regulatory network is responsible for

transmit-ting environmental signals into appropriate gene expression.

HilA, a member of the ToxR/OmpR-like family of

transcrip-tional regulators, is a major player in this network. Its

expres-sion is dependent upon several transcription factors that are

important for virulence, including PhoP, RtsA, SirA, HilC,

HilD, and Fis (9, 10, 35, 61, 63, 78, 90–92, 97). HilA in turn

activates genes encoding the SPI1 type III secretion machinery

and also InvF, which induces the expression of SPI1 secreted

effectors (2, 7, 8, 81). Activation of these effectors by InvF

requires SicA, a type III secretion system chaperone (22, 24,

32), which has been suggested to stabilize a complex between

InvF, RNA polymerase, and DNA (25). HilA also regulates

genes in the pathogenicity island SPI4, which is required for

the enteric phase of pathogenesis (74, 103).

The SPI1 regulatory cascade is believed to be induced in the

small intestine (16, 23, 50), where salmonellae encounter

mul-tiple and diverse bacterial species belonging to the endogenous

intestinal microbiota (44, 46, 70). There has been recent

inter-est in using some of these intinter-estinal bacterial species as

pro-biotics for the prevention and treatment of food-borne

infec-tious diseases, including salmonellosis (62). Probiotics are live

microorganisms which, when administered in adequate

amounts, confer a health benefit on the host (39, 40).

We examined gene expression profiles of S. enterica serovar

Typhimurium in spent culture supernatant (SCS) of the

pro-biotic Lactobacillus rhamnosus GG (L. rhamnosus GG) (94),

which has been reported to antagonize Salmonella infection

(47, 57), to define coexpressed genes. Data analysis unveiled a

cluster of genes with an expression profile corresponding to

* Corresponding author. Mailing address: Centre of Microbial and

Plant Genetics, K. U. Leuven, Kasteelpark Arenberg 20, 3001 Leuven,

Belgium. Phone: 32 16 321631. Fax: 32 16 321966. E-mail: sigrid

.dekeersmaecker@biw.kuleuven.be.

‡ Present address: Centre of Microbial and Plant Genetics, K. U.

Leuven, Kasteelpark Arenberg 20, 3001 Leuven, Belgium.

† Present address: Molecular Cellular and Developmental Biology

Department, University of Colorado, 347 UCB, Boulder, CO

80309-0347.

genes repressed by L. rhamnosus GG SCS. This cluster was

enriched for genes known to be HilA regulated. Motif

discov-ery revealed the presence of a conserved box overlapping with

the previously described HilA box (59) in the promoter region

of invF and prgH and of spi4_H, sicA and hilA. Using site

directed mutagenesis, reporter constructs, and gel mobility

shift assays, we confirmed that these latter genes are three

additional targets of the master regulator HilA and we could

further link the repression of Salmonella’s invasion regulatory

system to a probiotic effect.

MATERIALS AND METHODS

Bacterial strains, plasmids and growth conditions.The bacterial strains and plasmids used in this study are listed in Table 1. All strains were grown at 37°C.

Lactobacillus rhamnosus GG (ATCC 53103) was inoculated from a glycerol stock

(⫺80°C) in Man-Rogosa-Sharpe medium (MRS, Difco) (27). S. enterica serovar Typhimurium and Escherichia coli were grown in Luria-Bertani (LB) broth (87).

L. rhamnosus GG was grown in nonshaking conditions. Except for common

cloning procedures and as otherwise stated, salmonellae were cultured under high-osmolarity and limited-aeration conditions, previously shown to promote the induction of SPI1 genes and to induce adherence and invasiveness (8, 56, 63). For agar plates, 15 g/liter agar was added. If appropriate, antibiotics were added at following final concentrations: ampicillin, 100␮g/ml; streptomycin, 25 ␮g/ml; and tetracycline, 10␮g/ml or 30 ␮g/ml (when growing plasmid containing strains for␤-galactosidase assays).

Strain and plasmid construction.Standard protocols were used for buffer preparation, cloning, plasmid isolation, and E. coli competent cell preparation and transformation (87). Salmonellae were transformed as previously described

(82). Plasmids isolated from SL1344 were back transferred to E. coli and reiso-lated prior to restriction analysis. Restriction enzymes were used according to the manufacturer’s instructions. DNA fragments were agarose-purified using the QIAquick Gel Extraction kit (Qiagen).

The primers used for PCR (purchased from Eurogentec) are listed in Table 2. PCR was carried out in a Personal Mastercycler (Eppendorf). PCR amplification of the spi4_H putative promoter region was done with the proofreading Pfx enzyme (construction of pFAJ1932), according to the manufacturer’s instruc-tions.

Primers RHI-168 and RHI-169 were used to amplify a 1,520-bp DNA frag-ment upstream of the spi4_H gene from the SL1344 chromosomal DNA. The 1,520-bp PCR fragment was digested with EcoRI and PstI and cloned into pUC18 that had been digested with EcoRI and PstI, yielding pFAJ1932. Re-striction and sequence analysis of pFAJ1932 confirmed the directional insertion of the putative spi4_H promoter in pUC18 (data not shown).

The construction of the hilA-lacZY (pLS31) and sicA-lacZY (pHD11) reporter fusions has been described previously (22, 90). pLS31 and pHD11 were electro-porated into SL1344 and VV302 after propagation through LB5010. Cloning steps were performed in E. coli DH5␣ and TOP10F⬘.

Single-base-pair substitutions in the putative HilA box occurring in the hilA and sicA promoter sequences were introduced via a PCR approach using the QuickChange site-directed mutagenesis kit (Stratagene), according to the man-ufacturer’s instructions. Since the pLS31 and pHD11 plasmids were too large to obtain a successful point mutation, the promoter containing fragments of both reporter plasmids were subcloned as EcoRI/BamHI fragments into the corre-sponding sites of pUC19, yielding pCMPG5321 and pCMPG5322, respectively. The primers applied in the mutagenesis protocol are displayed in Table 2. As a result of the engineered mutation, the unique SfaNI site in the sicA promoter fragment disappeared. In the hilA promoter fragment a unique SfaNI site was created and the unique BstNI site disappeared. This information combined with sequence analysis allowed us to confirm the single-base-pair substitutions. The

TABLE 1. Bacterial strains and plasmids

Strain or plasmid Relevant characteristics Source or reference

E. coli DH5

␣

F

␾80⌬lacZM15 ⌬(lacZYA argF)U169 deoP recA1 endA1 hsdR17 (r

m

)

Gibco BRL

E. coli TOP10F

⬘

F

⬘ [lacI

_{Tn10(TetR)] mcrA}

_{⌬(mrr-hsdRMS-mcrBC) ␾80lacZ⌬M15 ⌬lacX74 deoR}

recA1 araD139

⌬(ara-leu)7697 galU galK rpsL (Str

_{) endA1 nupG}

Invitrogen

L. rhamnosus GG (LGG)

Wild type; human isolate

ATCC 53103

S. enterica serovar Typhimurium

SL1344

xyl hisG rpsL; virulent; Sm

₄₅

S. enterica serovar Typhimurium

VV302

SL1344

⌬hilA-523; hilA mutant

7

S. enterica serovar Typhimurium

LB5010

LT2 derivative; restriction negative, modification positive (r

m

) for hsdLT, hsdSA,

and hsdSB; galE strain sensitive to phage P1; metA22 metE551 ilv-452 leu-3121 trp

⌬2

xyl-404 galE856 hsdLT6 hsdSA29 hsdSB121 rpsL120; noninvasive

14

Plasmids

pCMPG5321

917-bp fragment of pLS31, containing promoter of hilA (PhilA), cloned into pUC19

(EcoRI-BamHI); Amp

This work

pCMPG5322

404 bp fragment of pHD11, containing promoter of sicA (PsicA), cloned into pUC19

(EcoRI-BamHI); Amp

This work

pCMPG5324

Point-mutated pCMPG5321, i.e. C3T at position

⫹78 of hilA; Amp

_{This work}

pCMPG5325

Point-mutated pCMPG5322, i.e. T3C at position

⫹2 of sicA; Amp

_{This work}

pCMPG5401

Point-mutated PhilA as an EcoRI-BamHI fragment of pCMPG5324 cloned into

pRW50; Tc

This work

pCMPG5402

Point-mutated PsicA as an EcoRI-BamHI fragment of pCMPG5325 cloned into

pRW50; Tc

This work

pFAJ1932

1,520-bp PCR fragment containing part of the spi4 H promoter (Pspi4_H) (8821 3

10340 of GenBank entry AF060869) cloned into pUC18 (EcoRI-PstI); Amp

This work

pHD11

pRW50 containing 404 bp fragment carrying promoter region of sicA (EcoRI/BamHI)

(intergenic sequence between spaS and sicA (137 bp) along with 192 bp of the 3

⬘

end of spaS and 76 bp of sicA); Tc

22

pLS31

pRW50 containing

⫺497 to ⫹420 of hilA (EcoRI/BamHI); Tc

₉₀

pRW50

Low-copy-number transcriptional reporter fusion vector (lacZY; 1-2 copies per cell);

Tc

58

pBAD/Myc-His

Cloning vector to make C-terminal Myc- and His-tagged proteins expressed under

arabinose control; Amp

Invitrogen

pCMPG5338

hilA ORF cloned in pBAD/Myc-His

This work (59)

pUC18

2.7-kb cloning vector; Amp

₁₀₄

point-mutated hilA and sicA promoter fragments were subcloned into pRW50, resulting in pCMPG5401 and pCMPG5402, respectively. These reporter plas-mids were electroporated into SL1344 and VV302.

The construction of pCMPG5338 is based on the design of pCH112 (59). Briefly, primers PRO-407 and PRO-408 (Table 2) were used to amplify hilA with

S. enterica serovar Typhimurium SL1344 genomic DNA as a template, while

simultaneously introducing restriction sites. The PCR fragment was cloned into Invitrogen’s pBAD/His plasmid, creating an in-frame fusion with the Myc-His C-terminal tag. To this end, both the PCR product and the vector were digested with NcoI and XbaI and subsequently ligated using T4 DNA ligase, yielding pCMPG5338. The tagged HilA is functional and able to activate inva-sion gene promoters (data not shown).

All constructs were confirmed by sequencing. Sequences were determined by the chain termination dideoxynucleoside triphosphate method (88) either with the AutoRead sequencing kit (Pharmacia-LBK) on an automated sequencer (ALX; Pharmacia-LBK) or via cycle sequencing using the BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems), ethanol/EDTA/sodium acetate precipitation, and subsequent separation of DNA fragments on an ABI 3100-Avant DNA analyzer (Applied Biosystems), according to the manufacturer’s instructions. The Cy5-labeled M13 reverse and forward primers were used for sequence confirmation of spi4_H putative promoter region (pFAJ1932) and mutated hilA and sicA promoter sequences (pCMPG5324 and pCMPG5325). The hilA overexpression construct (pCMPG5338) was sequenced using primers PRO-407 and PRO-408 (Table 2). Sequence data banks were screened for similarities by using the BLAST program (4, 5).

Lactobacillus rhamnosus GG spent culture supernatant.Lactobacillus rhamno-sus GG was grown in 10 ml of MRS broth at 37°C overnight without shaking. The

culture was inoculated from a⫺80°C glycerol stock. This L. rhamnosus GG overnight culture was used to inoculate (1:100) fresh MRS broth (350 ml in a 500-ml Erlenmeyer). SCS was obtained from a 24-h culture (37°C, without agitation) by centrifugation for 30 min at 10,000⫻ g at 4°C, followed by filter sterilization (0.22␮m; Millipore).

Microarray printing.We used a dedicated array consisting of approximately 500 genes. These genes were hand-picked with a bias towards known virulence determinants and genes we thought may play undiscovered roles in virulence. All steps of PCR product precipitation, resuspension and dilution, glass slide prep-aration, printing, and processing after printing were performed as previously described (17, 34).

Sample preparation.Salmonella strain SL1344 was grown overnight in

nonaer-ated culture at 37°C. Overnight cultures were 1:50 diluted into fresh LB medium and incubated for another 3 to 7 h in the same conditions. Cells reached the mid-log phase and were used for induction with SCS. To this end, 109

S. enterica

serovar Typhimurium SL1344 cells were centrifuged 5 min at 6,000⫻ g and 5 ml of the mixture of LB and L. rhamnosus GG SCS (at a 1:12 ratio; pH 5) was used to resuspend the cell pellet. As controls, the following induction media were used in a similar experiment: MRS in fresh LB broth and brought to pH 5 (with HCl), MRS in fresh LB broth (at a 1:12 ratio) (pH⫽ 6.8), and L. rhamnosus GG SCS in fresh LB broth (at a 1:12 ratio) and brought to pH 6.8 (with NaOH). All induction media were filter sterilized (0.22␮m) prior to use. After 1 and 5.5 h of induction,⬇109

CFU of each condition were used for RNA isolation. The cultures were centrifuged (1 min at 14,000⫻ g) in the presence of Bacterial Protect reagent (Qiagen) according to the manufacturer’s instructions for RNA stabilization. No antibiotics were added to the media.

RNA isolation, labeling, and slide hybridization.Total RNA was isolated with the Qiagen RNeasy mini kit according to the manufacturer’s protocol.

Contam-inating genomic DNA was removed from the RNA samples on-column with Qiagen RNase-free DNase. Removal of DNA was checked by PCR. Prior to labeling, the concentration of total RNA was determined by measuring the absorbance at 260 nm (UV/VIS Lambda 2, Perkin Elmer). cDNA was synthe-sized from 50␮g RNA with pd(N)6random hexamer (Amersham Biosciences) and labeled as previously described (34). Genomic Salmonella DNA was used as a labeling and hybridization reference. For each condition, the Cy3 and Cy5 reactions were combined and further handled as described (86). Hybridization took place overnight under a glass coverslip in a humidified slide chamber submerged in a 62°C water bath. The hybridized slides were washed (34), dried, and scanned for fluorescence with a commercial laser scanner (GenePix Scanner 4000A; Axon Instruments Inc., Foster City, CA). Signal intensities and back-ground measurements were obtained for each spot on the array by using the GenePixPro 3.0 software program (Axon Instruments, Foster City, CA).

Data analysis.Background corrected median values were used for further analysis. Data were normalized using analysis of variance (MatLab script pro-vided by Kerr et al.) (54). This reference design model includes an array main factor, a variety main factor, factors compensating for dye and condition related variation, a gene main factor and the factor of interest, i.e., the variety gene interaction factor, which reflects differences in gene expression level that are not explained by the factor levels (effects) of the main variety and gene factors (36, 52–54). Each of the conditions tested corresponded to a separate variety effect. The independent genomic reference was considered as an additional variety effect.

Normalized values (VG effects) of the nonreference samples were used to cluster the data. Genes with similar expression profiles across the different conditions were grouped by means of the adaptive quality-based cluster algo-rithm (28) with 0.85% as quality criterion. Subsequently, we searched for statis-tically overrepresented motifs in the intergenic regions of the coexpressed genes (genes within a cluster). Intergenic regions in this study are defined as a region that contains the noncoding region between two coding regions and are extracted from GenBank files (11) using the modules of INCLusive (19). For the genes in the clusters that are known to belong to an operon, the intergenic region up-stream the first gene of the operon was selected. We used Motif Sampler (67, 99), a motif detection procedure based on Gibbs sampling. This algorithm identifies conserved patterns based solely on statistical properties and no prior information on what the motif should look like is required (55). For each data set (cluster) the algorithm was run 100 times using the following parameter settings: motif length 8 to 12 and background order 3.

␤-Galactosidase activity assays. The lacZY fusion strains in either a wild-type SL1344 (45) or hilA deletion background VV302 (7) were grown under dere-pressing conditions (i.e., high osmolarity [LB, 10 g/liter NaCl], oxygen-limiting) (56) (Fig. 3A and 4A) and repressing conditions (low osmolarity [LB, 0 g/liter NaCl], aeration) (Fig. 4B). Expression of lacZY fusions was assessed using ␤-galactosidase assays as previously described (71), with minor modifications, resulting in the following optimized microtiter plate-based protocol.

Single colonies were inoculated into 96-well plates containing 300␮l medium, supplemented with the appropriate antibiotics, and incubated in either dere-pressing or redere-pressing conditions. Overnight cultures were diluted 1:50 into fresh medium (with the appropriate antibiotics) and cultured for another 4 to 5 h in the same conditions. These cultures were used when assessing the effect of hilA deletion background and point mutations in the putative HilA box on the re-porter plasmids. To 10␮l of cell suspensions (optical density at 595 nm [OD-595] of⬇0.3), 90 ␮l of LacZ buffer (50 mM NaHPO4[pH 7.0], 14.3 mM ␤-mercap-toethanol, 1 mM Na2EDTA, 0.1% Triton X-100, 0.1% Na-laurylsarcosine, 25

TABLE 2. Primer sequences used for PCR

Name Sequence (from 5⬘ to 3⬘) Description

M13 reverse

CAGGAAACAGCTATGACC

Sequencing

M13 universal

GTTGTAAAACGACGGCCAGT

Sequencing

RHI-168

CCGAATTCAGGGCGCCTATGATATTGAAATC

Putative spi4_H promoter region

RHI-169

GGCTGCAGTTAACGTGTAGCTGCCATCCGCC

Putative spi4_H promoter region

RHI-184

CTGACTCTCTCTGCATCAGGATATACGGCAG

Site-directed mutagenesis hilA

RHI-185

CTGCCGTATATCCTGATGCAGAGAGAGTCAG

Site-directed mutagenesis hilA

RHI-186

GGGTTTAATAACTGCACCAGATAAACGCAGTCG

Site-directed mutagenesis sicA

RHI-187

CGACTGCGTTTATCTGGTGCAGTTATTAAACCC

Site-directed mutagenesis sicA

PRO-407

TTAACCATGGCTCATTTTAATCCTGTTCC

Forward hilA in pCMPG5338 (59)

PRO-408

TTGTTCTAGAATTAATTTAATCAAGCGGGG

Reverse hilA in pCMPG5338 (59)

mM ortho-nitrophenylgalactopyranoside [ONPG, Sigma]) was added. The cul-tures were diluted 10-fold prior to␤-galactosidase activity measurement when pLS31-containing strains were used. This dilution was taken into consideration when calculating the Miller units.

The mixture was incubated at 30°C and the reaction was stopped by adding 35 ␮l of a 1 M Na2CO3solution once sufficient yellow color had developed. The reaction was stopped at at least three different time points (replicates) to ascer-tain that enzyme activity was still linearly increasing with incubation time. The time of reaction was recorded. Optical density was measured at both 420 and 550 nm (OD420and OD550). Identical treatments were performed with LacZ buffer without cells as control to correct measured sample values. Miller units of ␤-galactosidase activity were calculated as 1,000 times the increase in absorbance at 420 nm per minute per unit of optical density at 550 nm of the cell suspension: Miller units⫽ 1,000 ⫻{[(OD420, ONPG⫺ 1.75 ⫻ OD550, ONPG)⫻ v1]/(t⫻ vt⫻

OD595)} where t is the time of the reaction in minutes; OD595reflects the cell density just before the assay; OD420, ONPGreflects absorbance by ONPG, mea-sured after reaction; OD550, ONPGreflects cell density measured after reaction, used as correction for light scattering by cell debris; 1.75 is the corresponding correction factor; v1is the volume (␮l) of cells used in the reaction mixture; and

vtis the total volume (␮l) of the reaction mixture.

Gel mobility shift assays.The promoter regions upstream of hilA, sicA, and

spi4_H were obtained by digestion of plasmids pLS31 (90) and pHD11 (22) with

EcoRI and BamHI and pFAJ1932 with EcoRI and PstI. The point mutated promoter fragments were isolated by digestion of pCMPG5324 and pCMPG5325 with EcoRI and BamHI, respectively. The DNA fragments were purified by agarose gel electrophoresis followed by gel extraction with a QIAquick gel extraction kit; 100 ng of each fragment was end-labeled at 37°C for 15 min with digoxigenin-11-ddUTP using a digoxigenin gel shift kit (Roche Applied Science, Penzberg, Germany), according to the manufacturer’s instructions. Labeling efficiency was checked by comparing spotted dilution series of labeling reaction to a labeled control-fragment in a direct detection assay, as outlined in the protocol of the kit.

HilA⫹and HilA⫺extracts were prepared by ultracentrifugation of, respec-tively, sonicated arabinose-treated (0.02%) and untreated TOP10 cells carrying pCMPG5338, as previously described (59). Since it was reported that as an artifact of overproduction of the protein, HilA is membrane associated (59, 84), only membrane-associated fractions of the extracts were used, i.e., the pellet of the ultracentrifuged extracts. Protein concentration was determined by the Bio-Rad protein assay (13), according to the manufacturer’s instructions. Western blotting (data not shown), using anti-c-Myc antibodies (M4439, Sigma), con-firmed the presence of HilA in the membrane fraction of HilA⫹extracts. No HilA could be detected in the HilA⫺extract. This extract was used as a negative control.

DNA binding reactions were carried out as previously described (97) in a total volume of 15␮l containing 5 ␮l of 3x DNA binding buffer (129 mM Tris-HCl, 90 mM potassium acetate, 24 mM MgSO4, 81 mM ammonium acetate, 3 mM dithiothreitol, 240 mM KCl, 30% glycerol) and different concentrations of the HilA⫹extract in 5␮l total volume (2.2 ␮g/␮l to 81 ng/␮l), 2 ␮l of labeled DNA fragment (⬇0.4 ng/␮l, as recommended by the manufacturer of the applied digoxigenin kit), 2␮l of poly(dI-dC) (1 ␮g/␮l), 1 ␮l of bovine serum albumin (1 ␮g/␮l), and 0.5 ␮l of 0.5 M EDTA. HilA⫺_{extract was used at a concentration of} 666 ng/␮l. Nonspecific competitor DNA [poly(dI-dC)] and protein (bovine se-rum albumin) were added to all reactions to minimize nonspecific interactions of the labeled DNA fragments with the proteins. DNA binding reactions were carried out at room temperature for 25 min. Reactions were separated on native Tris-borate-EDTA (TBE)-polyacrylamide gels (5%) prepared and run at 8 mA for 1 h with 20␮l of freshly made 5% thioglycolate in the cold room (59). After 2 to 5 h of electrophoresis (depending on the size of the probe) at 8 V cm⫺1in 0.5⫻ TBE buffer, gels were electroblotted (40 min, 300 mA; LKB Bromma 2117 Multiphor II electrophoresis unit) and further handled for chemiluminescent detection as outlined by the manufacturer of the digoxigenin gel shift kit (Roche Applied Science, Penzberg, Germany).

RESULTS AND DISCUSSION

Identification of clusters containing genes with similar

ex-pression profiles.

To identify coexpressed genes, we brought

salmonellae into contact with different conditions related to

the probiotic lactic acid bacterium L. rhamnosus GG and

per-formed S. enterica serovar Typhimurium cDNA microarray

experiments. RNA was extracted at 1.0 and 5.5 h after

expo-sure to SCS. It has been reported that the promoter of an

important Salmonella SPI-1 invasion gene, sicA (51), is

acti-vated in the intestinal lumen by 1 h after infection and in the

Peyer’s patches by 5 h, but is repressed after 24 h of infection

(15). The different experimental conditions included: L.

rham-nosus GG spent culture supernatant (SCS) and sterile MRS

medium, both at neutral pH and at pH 5.0. However,

neutral-izing the pH of the SCS eliminates its growth-inhibitory effect

on salmonellae (95), so these data should be interpreted with

caution. In total, we performed microarray experiments with

RNA isolated from bacteria exposed to seven different

condi-tions, described as follows: SCS pH 5.0 (1 h), SCS pH 5.0 (5.5

h), sterile MRS medium pH 6.8 (1 h), MRS pH 6.8 (5.5 h),

MRS pH 5.0 (1 h), MRS pH 5.0 (5.5 h), and SCS pH 6.8 (1 h).

Genes with similar expression profiles over the different

conditions, i.e., genes that are coexpressed, were grouped by

cluster analysis. The expression pattern of one cluster

indi-cated that it contains genes repressed by Lactobacillus SCS.

This cluster was enriched for genes important for cell invasion

by salmonellae, including hilA, invA, invF, invI, prgH, prgJ, sicA,

sigD (sopB), sipB, sopE, spaO, spaQ, spaR, spi4_C, spi4_F,

spi4_H, spi4_O, spi4_P, spi4_R, sptP, and yjbA. One of these

genes, hilA, is a key virulence regulator that responds to several

environmental signals (8, 61) and is potentially a target for

therapeutics, including probiotics. Repression of hilA results in

the down-regulation of multiple genes important for invasion,

including many of the genes that had lower RNA levels in SCS.

Moreover, PhoP is a postulated repressor of hilA (8, 10, 42,

81), and RNA levels of both phoP and genes belonging to the

PhoP regulon (e.g., pagM, mgtB, marB) (43) increased upon

exposure to SCS. These data suggest that L. rhamnosus GG

exerts its antagonistic effect on salmonellae in part by

repress-ing Salmonella invasion genes.

While the effect of Lactobacillus acidophilus supernatant on

the cell entry of salmonellae has been described before (18),

putative Salmonella target genes were not identified. The

ob-servation could be partly explained by the effect of low pH on

the expression of virulence genes such as hilA (8, 30). This was

also observed in our MRS at pH 5. However, in SCS pH 5, the

observed repression was more severe, i.e., eightfold difference

for hilA (data not shown). This could be due to lactic acid, a

major compound present in Lactobacillus SCS. It has been

suggested that lactic acid inhibits hilA expression (30, 31), but

follow-up experiments were not performed. We found that

exposure of salmonellae to L. rhamnosus GG SCS reduces the

RNA levels of multiple invasion genes. This microarray

exper-iment was applied to generate clusters of coexpressed genes to

focus further experiments on the regulation of these genes.

Validation of clusters through motif detection: a shifted

putative HilA box.

Coexpressed genes may have similar

tran-scriptional regulatory mechanisms and their promoter regions

may contain common motifs or regulatory elements that bind

transcription factors (73, 98, 100). Motif detection strategies

involve searching for DNA patterns that are overrepresented

in a set of related sequences relative to a set of unrelated

sequences. The putative promoter regions of the genes in the

cluster that had lower RNA levels upon SCS exposure and that

contain multiple Salmonella invasion genes was subjected to

motif detection using Gibbs sampling (67, 99, 100).

described HilA box (59) (Fig. 1). The HilA box was initially

suggested to consist of two nearly perfect 6-nucleotide direct

repeats centered around a T in the prgH and invF promoters,

TTTCATNNTNNTTkCAT (59). The overrepresented motif

in

the

cluster

revealed

by

our

in

silico

analysis

(tN

TgCAtCAGga) overlaps the HilA box and includes the

three nucleotides shown to be essential for HilA binding (59)

(Fig. 1). We detected this motif in the promoter regions of

prgH and invF, known HilA targets (7). In addition, the

tN

TgCAtCAGga motif is present in the promoters of three

additional genes, sicA, hilA, and spi4_H (Fig. 1).

HilA box found in promoter region of spi4_H.

SPI4 has a

major role in influencing intestinal colonization of mammalian

species (74). The SPI4 gene spi4_H (GenBank entry

AF060869) was originally described by Wong et al. (103).

How-ever, the current annotation of the S. enterica serovar

Typhi-murium LT2 genome (69) lacks spi4_H and the original spi4_H

sequence is now located within a strikingly large (16,679 bp)

gene, STM4261, recently named both icgA

(invasion-coregu-lated gene A) (35) and siiE (Salmonella intestinal infection

gene E) (74). icgA/siiE is a putative homologue of HlyA (

␣-hemolysin) (29) and is predicted to encode a type 1 exported

RTX (repeat in toxin) pore-forming toxin or adhesin (35).

Based on MudJ fusion experiments, icgA/siiE was suggested to

be directly or indirectly regulated by HilA (35).

We found that the upstream region of the originally

de-scribed spi4_H gene contains a putative HilA box (Fig. 1 and

2A). In addition, gel mobility shift assays demonstrated the

binding of HilA to the spi4_H promoter (Fig. 2B). These

re-sults are consistent with the original description of spi4_H as a

gene that is regulated by SirA in a HilA-dependent manner

(BA1501 MudJ fusion, depicted in Fig. 2B) (1). Ellermeier and

Slauch (35) also described HilA regulation of icgA::MudJ,

however, they did not describe where their MudJ insertion

occurred in STM4261 (icgA). Therefore, the lacZ expression

they observed could correspond to that of spi4_H.

However, under the conditions we used, LB medium and

low oxygen, the spi4_H promoter we amplified could not drive

the expression of the lacZY gene (data not shown). It is

pos-sible that the promoter region we amplified was incomplete or

that other environmental cues are required to induce spi4_H

expression. In sum, these data support the idea that the newly

annotated STM4261 locus likely either contains at least two

genes, icgA/siiE and spi4_H, or icgA/siiE and spi4_H

corre-spond to the same gene. However, this should be interpreted

with caution. Although gel mobility shift assays indicated that

HilA interacts with the amplified spi4_H upstream region, as

long as we cannot determine the right conditions to switch on

spi4_H expression and prove that it encodes a functional gene,

the role of HilA and its interaction with the motif found

up-stream of this possible gene is premature.

HilA binds to and regulates sicA via the HilA box.

The

presence of an HilA consensus sequence in the sicA promoter

region has not been previously reported, and HilA is not

gen-erally believed to directly activate the sicA promoter. To

de-termine whether sicA is regulated by HilA, expression studies

using an episomal sicA reporter gene fusion were conducted.

The sicA reporter contained either a wild-type (pHD11 (22) or

a mutant (pCMPG5402) HilA box. The third T (italic) in the

HilA box consensus sequence, tN

TgCAtCAGg, was

previ-ously shown to be critical for HilA DNA binding to the prgH

and invF promoters (Fig. 1) (59, 60). Therefore, in the sicA

promoter, we substituted this T with a C (Fig. 1). Reporter

gene fusion assays were performed under multiple

environ-mental conditions and in wild-type and hilA deletion

back-grounds (Fig. 3A).

In a hilA deletion background, sicA reporter expression is

significantly reduced, as reported previously (24). The single

T-to-C substitution in the putative HilA box of the sicA

re-porter construct (pCMPG5402, i.e., sicA*-lacZY) completely

abolished expression in both the wild-type and hilA deletion

backgrounds (Fig. 3A). A similar observation was made by

Lostroh et al. (59) regarding the invF and prgH promoters.

Thus, the putative HilA box is important for HilA-dependent

sicA induction.

To determine whether HilA binds to the putative HilA box

within the sicA promoter region, we performed gel mobility

shift assays (Fig. 3B). The mobility of the sicA promoter

frag-ment decreased in the presence of HilA

extracts (Fig. 3B,

lanes 2 to 4). The addition of unlabeled promoter DNA as a

specific competitor diminished the amount of labeled sicA

fragment that shifted (Fig. 3B, lanes 6 to 7), confirming the

specificity of the protein-DNA interaction. Less of the mutant

sicA* (Fig. 3B, lane 11) than the wild-type promoter fragment

(Fig. 3B, lane 9) seemed to have altered mobility upon the

addition of the HilA

extract. These results suggest that HilA

specifically binds the putative HilA box in the sicA promoter

region. Since the putative HilA box coincides with the

tran-scription start site (25), it is possible that the abrogated

expres-sion of the mutated sicA reporter is due to ineffective DNA

FIG. 1. Alignment of the putative HilA-box. Motif detection revealed the presence of a HilA-box (59). However, the consensus sequence

retrieved by motif detection is shifted by 9 nucleotides and is indicated with a black box; consensus sequences as described in the literature are

boxed with a dotted line for comparison. Sequences upstream of the translational start site of the indicated genes were taken from the complete

genome sequence of S. enterica serovar Typhimurium (69) (NC_003197). Intergenic sequences were aligned using the motif positions as seeds and

edited in GeneDoc (76). Color coding: black indicates conserved in all aligned sequences, dark grey indicates conserved in at least 80% of the

aligned sequences, and light grey indicates conserved in at least 60% of the aligned sequences. The three nucleotides critical for binding and

activation (59) are indicated with an asterisk.

polymerase binding at the promoter. While this cannot be

ruled out, it is clear that HilA binds to this site and likely that

this binding plays an important role in sicA activation.

It has been suggested that expression of sicA occurs via

read-through transcription of invFGEABCIJspaOPQRSsicA

sipBCDA from a HilA-dependent promoter upstream of invF

(22). In this model, basal levels of SicA, along with InvF,

activate sicA expression from an InvF-dependent promoter

located between spaS and sicA (22). Our experimental and in

silico results indicate that sicA is directly regulated by HilA via

the putative HilA box immediately upstream of sicA. However,

HilA is not sufficient for heterologous sicA transcription in E.

coli (22). Thus, it seems likely that SicA, InvF, and HilA act in

concert to activate sicA.

HilA acts as an autorepressor under repressing conditions.

The identification of a putative HilA box in the hilA promoter

suggests that HilA may be autoregulated. Previous reports

have suggested that HilA self-regulates, but there are

conflict-ing data as to whether the regulation is positive or negative.

Specifically, a chromosomal hilA

␤-galactosidase reporter

strain in a hilA mutant background produced 50% less

␤-ga-lactosidase when the hilA lesion was complemented with a

plasmid-encoded hilA gene, in comparison to the

noncomple-mented strain (8). This suggested that the autoregulation is

negative. In contrast, an episomal hilA reporter gene produced

30% more

␤-galactosidase in a hilA

than in a hilA deletion

background, suggesting that the autoregulation is positive (8).

While activators usually bind upstream of open reading

FIG. 2. A. Genetic organization of S. enterica serovar Typhimurium SPI4. The systematic number designation (STM) of open reading frames

annotated in the S. enterica serovar Typhimurium genome (69) is given. The start and stop codons of the spi4_H genes, as annotated in GenBank

entry AF060869, have been indicated. Additional features on the diagram of SPI4 are as follows: the detected putative HilA box, the binding sites

of the primers used for amplification of the spi4_H promoter region (RHI-168 and RHI-169), and the insertion position of MudJ in BA1501, a

SirA and HilA-regulated fusion (1). B. HilA

extract alters the gel mobility of the spi4_H promoter DNA fragment. Gel mobility shift assays were

performed with the spi4_H probe as outlined in Materials and Methods. Lane 1 is a control showing the migration of the probe in the absence of

any added protein. Lanes 2 to 4 contain decreasing amount of HilA

extract (i.e., 33, 11, and 4

_{␮g). Lane 5 contains 33 ␮g total proteins of the}

HilA

extract. The arrows indicate the suggested DNA-protein interaction.

frames, repressors can bind both upstream and downstream

(6). Particularly in the case of autoregulation, downstream

repressor binding sites predominate (20). Examples of

Salmo-nella genes with repressor binding sites that are 3

⬘ of

transcrip-tion start sites are metF, regulated by MetR (21), and cysB

(autoregulation) (80). Since the putative HilA box at

⫹80 to

⬎⫹92, i.e., downstream of the transcription start of hilA (90),

it seemed likely that HilA represses its own expression.

In Fig. 4, we investigated the role of HilA in hilA expression

using an episomal hilA reporter gene fusion, pLS31 (90). Our

results support a role of HilA as an autorepressor. Under

derepressing conditions (high osmolarity, low oxygen) (8), no

clear difference in hilA expression is observed between a

wild-type and hilA deletion background (Fig. 4A). However, under

repressing conditions (low osmolarity and high oxygen) (8, 60)

hilA-lacZY expression was significantly higher in a hilA

dele-tion background relative to a wild-type background (Fig. 4B).

These data indicate that under derepressing conditions, HilA

has no effect on the hilA promoter, but under repressing

con-ditions, HilA significantly reduces its own expression level.

FIG. 3. HilA box in the promoter region of sicA is important for its HilA regulation. A. sicA reporter gene fusion assays. A single-base-pair

substitution was introduced into the promoter sequence of sicA present in pHD11 by site-directed mutagenesis, giving rise to pCMPG5402

(sicA*-lacZY). The lacZY fusion strains in either a wild-type (SL1344) (45) or hilA deletion background (VV302) (7) were grown under

derepressing conditions (i.e., high osmolarity [10 g/liter NaCl], oxygen-limiting) (56) and assayed for

_{␤-galactosidase activity (71). Values are}

expressed in Miller units and represent the mean of eight independent experiments. Miller unit values of strains containing the vector pRW50 (58)

were zero (data not shown). Error bars indicate standard deviations. B. HilA

extract alters the gel mobility of the sicA promoter DNA fragment.

Gel mobility shift assays were performed with the sicA (lanes 1 to 9) and sicA* (lanes 10 and 11) probe as outlined in Materials and Methods. Lanes

1, 8, and 10 are controls showing the migration of the probe in the absence of any added protein. Lanes 2 to 4 contain increasing amounts of HilA

extract (i.e., 16, 33, and 66

␮g). Lane 5 contains 10 ␮g of the HilA

extract. Lanes 6 and 7 contain increasing amounts of unlabeled sicA promoter

fragment as a specific competitor (i.e., 10 and 50 ng). Lane 11 contains 33

_{␮g of the HilA}

extract.

Identified HilA box in the hilA promoter is important for

hilA regulation.

As mentioned above, the third T (italic) in the

HilA box consensus sequence, tN

TgCAtCAGg, was

previ-ously shown to be critical for HilA DNA binding to the prgH

and invF promoters (Fig. 1) (59, 60). In the hilA promoter the

motif contains a C at the same position (Fig. 1). We tested the

effect of the single C3 T base pair substitution in the HilA box

of the hilA-lacZYA (pCMPG5401) reporter construct, i.e.,

hilA*-lacZY, on HilA-mediated expression. Compared to the

hilA-lacZY reporter, expression from the hilA* promoter was

reduced in both wild-type and hilA deletion backgrounds, in

both derepressing and repressing conditions (Fig. 4A and B).

This implies that the mutation not only interferes with the

putative HilA binding at the HilA box but also influences hilA

transcription level through a second mechanism, e.g., through

interference with the action of either DNA polymerase or of an

unidentified regulatory protein. In contrast to the hilA-lacZY

fusion, under derepressing conditions, the hilA* promoter was

repressed in the wild-type background (Fig. 4A).

These data suggest that the identity of the nucleotide at the

critical position in the HilA box may determine how tightly

HilA binds. To test this notion, in vitro DNA-binding assays

using Myc- and His-tagged HilA protein were performed.

Fig-ure 4C confirms the binding of HilA to the hilA promoter.

Indeed, incubation of labeled hilA promoter fragments with

extracts made from E. coli cells expressing the tagged HilA

protein from the arabinose-induced P

promoter (HilA

)

impeded the migration of the probe into a native gel (Fig. 4C,

lanes 2 and 6). In contrast, a retarded band was not observed

when the hilA probe was incubated with extracts lacking HilA

FIG. 4. Identified HilA box in the hilA promoter is important for hilA regulation. A and B. hilA reporter gene fusion assays. A single-base-pair

substitution was introduced into the promoter sequence of hilA present in pLS31 by site-directed mutagenesis, giving rise to pCMPG5401

(hilA*-lacZY). The lacZY fusion strains in either a wild-type (SL1344) (45) or hilA deletion background (VV302) (7) were grown under

derepressing conditions (i.e., high osmolarity [10 g/liter NaCl], oxygen-limiting) (56) (A) and repressing conditions (low osmolarity [0 g/liter NaCl],

aeration) (B) and assayed for

␤-galactosidase activity (71). Values are expressed in Miller units and represent the mean of eight independent

experiments. Miller unit values of strains containing the vector pRW50 (58) were zero (data not shown). Error bars indicate standard deviations.

C. HilA

extract alters the gel mobility of the hilA promoter DNA fragment. Gel mobility shift assays were performed with the hilA (lanes 1 to

6) and hilA* (lanes 7 and 8) probe as outlined in Materials and Methods. Lanes 1, 5, and 7 are controls showing the migration of the probe in the

absence of any added protein. Lanes 2, 6, and 8 contain 33

␮g of HilA

extract. Lane 3 contains 33

␮g of the HilA

extract. Lane 4 contains 100

ng unlabeled hilA promoter fragment as a specific competitor.

(HilA

, Fig. 4C, lane 3), demonstrating that the retardation of

the probe requires HilA. The addition of unlabeled competitor

DNA seemed to diminish the sequestration of the HilA-DNA

complex (Fig. 4C, lane 4), indicating that HilA binds

specifi-cally to the hilA promoter. Labeled hilA* promoter fragments

seemed to be more strongly bound by HilA than the hilA

promoter fragment (Fig. 4C, lane 8). These data suggest that

the C3 T substitution in the hilA promoter putative HilA box

allows for increased binding of HilA.

A T3 C substitution in the HilA boxes of sicA, invF, and

prgH (i.e., T3 C in caTcaggaw Fig. 1) appeared to result in

reduced HilA binding and severely reduced HilA-dependent

activation (Fig. 3A, 4A, and 4B) (59, 60). This is consistent with

the known importance of the T in the invF and prgH promoters

for HilA binding (59, 60). In contrast, a C3 T substitution in

the hilA promoter putative HilA box seemed to result in

in-creased HilA binding, which could be explained by the fact

that, in this promoter, HilA acts as a repressor and thereby

could reduce hilA expression (Fig. 4A and B) irrespective of

the conditions.

Concluding remarks.

Gene expression profiling experiments

followed by in silico motif detection on a cluster of coexpressed

S. enterica serovar Typhimurium genes revealed a motif,

pre-viously described as the HilA box, in the promoter regions of

spi4_H, sicA, and hilA. Site-directed mutagenesis, reporter

gene expression, and gel mobility shift assays indicated that

sicA expression requires HilA and that hilA is negatively

au-toregulated. Thus, HilA appears to act as an activator for the

sicA gene and as a repressor for the hilA gene. These results

allow some reflection on the design of the HilA transcriptional

network. Combining all knowledge of the HilA regulator, the

hilA-invF-sicA regulatory network could be categorized as a

feedforward loop network motif (93) (Fig. 5).

A feedforward loop rejects transient activation signals from

general transcription factors and responds only to persistent

signals. In addition, a feedforward loop allows for rapid system

shutdown. Together, this results in increased specificity and

tight temporal regulation. In this model, HilA and InvF act in

an AND-gate-like manner to control sicA expression. When

hilA is activated, the signal is transmitted to the output sicA by

two pathways, a direct one from HilA and a delayed one

through InvF (Fig. 5). If hilA activation is transient, InvF

can-not reach the level needed to significantly activate sicA, and the

input signal is not transduced through the circuit. Only when

HilA signals long enough to allow InvF to accumulate is sicA

activated. Once hilA is deactivated, sicA shuts down rapidly.

Tight temporal regulation of SicA through this feedforward

loop should avoid useless energy investment in production of

effector proteins when the environmental conditions are not

optimal for invasion. Especially in light of the SicA role as a

chaperone to InvF (24, 25), this feedforward loop could hold

biological relevance.

Experimental evidence also suggests a negative

autoregula-tion feedback (hilA) superimposed on the feedforward loop.

Negative autoregulation feedback appears in over 40% of

known transcription factors in E. coli (85). Negative

autoreg-ulation feedback reduces the rise time (i.e., the delay from the

initiation of production until half-maximal product

concentra-tion is reached) (85), favoring the dynamic behavior of the

transcription network (68). A shorter rise time is possible

be-cause the unrepressed promoter can be activated rapidly.

Later, a freshly produced repressor can shut off its own

pro-duction and the required steady-state concentration can be

quickly reached. A strong nonautoregulated promoter will

reach any given concentration faster but will stabilize at a much

higher steady state, which is undesirable due to metabolic cost,

possible toxic effects, and the long time required for its

subse-quent dilution when production is ceased (66, 77, 85). It would

be interesting to characterize the kinetic behavior of the

dif-ferent regulatory circuit elements controlling gene expression

during invasion of salmonellae once all regulatory mechanisms

for hilA expression and HilA activity and all targets of HilA are

identified.

ACKNOWLEDGMENTS

S. De Keersmaecker and K. Marchal were Research Associates of

the Belgian Fund for Scientific Research (FWO-Vlaanderen) when

this study was conducted. K. Engelen is a research assistant of IWT.

The work was initiated in the laboratory of S. Falkow, Stanford

Uni-versity, under support from the National Institutes of Health

(AI-26195). C. Detweiler was additionally supported by an American

Can-cer Society Fellowship (PF-99-146-01-MBC) and the University of

Colorado at Boulder. This work is also partially supported by

STWW-00162 and GBOU-SQUAD-20160 of the IWT.

We gratefully acknowledge C. Lee, V. Miller, S. Busby, and W. de

Vos for kindly providing strains and plasmids used in this study.

REFERENCES

1. Ahmer, B. M., J. van Reeuwijk, P. R. Watson, T. S. Wallis, and F. Heffron. 1999. Salmonella SirA is a global regulator of genes mediating enteropatho-genesis. Mol. Microbiol. 31:971–982.

2. Akbar, S., L. M. Schechter, C. P. Lostroh, and C. A. Lee. 2003. AraC/XylS family members, HilD and HilC, directly activate virulence gene expression independently of HilA in Salmonella typhimurium. Mol. Microbiol. 47:715– 728.

FIG. 5. Postulated HilA transcriptional regulation network.

HilA-InvF-SicA constitute a feedforward loop: the transcription factor HilA

regulates a second transcription factor, InvF, and both jointly regulate

sicA. hilA expression is proposed to be negatively autoregulated. An

additional transcriptional factor(s) X could be required for hilA

ex-pression. Other transcriptional regulators, HilC (33, 78, 79, 83, 90),

HilD (78, 90), Hha (38, 79), SirA/BarA (1, 3, 49, 83, 97), Fis (9, 91, 102)

and RtsA (35), known to regulate hilA expression by binding to hilA

promoter region, are included. HilD and HilC also activate expression

of a subset of SPI1 genes independently of HilA through activation of

invF transcription (2). SirA can bypass the hilA gene to regulate

inva-sion determinants (83) through directly binding to the hilC promoter

(97).

_{⫹, induction; ⫺, repression. For clarity, regulation of hilA}

ex-pression by the following genes is not depicted: phoPQ (10, 81), envZ/

ompR (64), phoBR (65), hilE (9, 37), H-NS and HU (hupB) (91, 102),

csrA (3), lon (12, 96), ams (RNase E) (37), pag (37), orgC (26, 37),

integration host factor (37), fadD (65), cpxA (75), and fliZ (33, 48, 65).

3. Altier, C., M. Suyemoto, A. I. Ruiz, K. D. Burnham, and R. Maurer. 2000. Characterization of two novel regulatory genes affecting Salmonella inva-sion gene expresinva-sion. Mol. Microbiol. 35:635–646.

4. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403–410.

5. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. H. Zhang, Z. Zhang, W.

Miller, and D. J. Lipman.1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25: 3389–3402.

6. Babu, M. M., and S. A. Teichmann. 2003. Functional determinants of transcription factors in Escherichia coli: protein families and binding sites. Trends Genet. 19:75–79.

7. Bajaj, V., C. Hwang, and C. A. Lee. 1995. HilA is a novel OmpR/ToxR family member that activates the expression of Salmonella typhimurium invasion genes. Mol. Microbiol. 18:715–727.

8. Bajaj, V., R. L. Lucas, C. Hwang, and C. A. Lee. 1996. Co-ordinate regu-lation of Salmonella typhimurium invasion genes by environmental and regulatory factors is mediated by control of hilA expression. Mol. Microbiol.

22:703–714.

9. Baxter, M. A., T. F. Fahlen, R. L. Wilson, and B. D. Jones. 2003. HilE interacts with HilD and negatively regulates hilA transcription and expres-sion of the Salmonella enterica serovar Typhimurium invasive phenotype. Infect. Immun. 71:1295–1305.

10. Behlau, I., and S. I. Miller. 1993. A PhoP-repressed gene promotes

Salmo-nella typhimurium invasion of epithelial cells. J. Bacteriol. 175:4475–4484.

11. Benson, D. A., I. Karsch-Mizrachi, D. J. Lipman, J. Ostell, B. A. Rapp, and

D. L. Wheeler.2002. GenBank. Nucleic Acids Res. 30:17–20.

12. Boddicker, J. D., and B. D. Jones. 2004. Lon protease activity causes down-regulation of Salmonella pathogenicity island 1 invasion gene expres-sion after infection of epithelial cells. Infect. Immun. 72:2002–2013. 13. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of

microgram quantities of protein utilizing the principle of protein-dye bind-ing. Anal. Biochem. 72:248–254.

14. Bullas, L. R., and J. I. Ryu. 1983. Salmonella typhimurium LT2 strains which are r- m⫹ for all three chromosomally located systems of DNA restriction and modification. J. Bacteriol. 156:471–474.

15. Bumann, D. 2002. Examination of Salmonella gene expression in an in-fected mammalian host using the green fluorescent protein and two-colour flow cytometry. Mol. Microbiol. 43:1269–1283.

16. Carter, P. B., and F. M. Collins. 1974. The route of enteric infection in normal mice. J. Exp. Med. 139:1189–1203.

17. Chan, K., S. Baker, C. C. Kim, C. S. Detweiler, G. Dougan, and S. Falkow. 2003. Genomic comparison of Salmonella enterica serovars and Salmonella

bongori by use of an S. enterica serovar Typhimurium DNA microarray. J.

Bacteriol. 185:553–563.

18. Coconnier, M. H., V. Lievin, M. F. Bernet-Camard, S. Hudault, and A. L.

Servin.1997. Antibacterial effect of the adhering human Lactobacillus

aci-dophilus strain LB. Antimicrob. Agents Chemother. 41:1046–1052.

19. Coessens, B., G. Thijs, S. Aerts, K. Marchal, F. De Smet, K. Engelen, P.

Glenisson, Y. Moreau, J. Mathys, and B. De Moor.2003. INCLUSive: A web portal and service registry for microarray and regulatory sequence analysis. Nucleic Acids Res. 31:3468–3470.

20. Collado-Vides, J., B. Magasanik, and J. D. Gralla. 1991. Control site loca-tion and transcriploca-tional regulaloca-tion in Escherichia coli. Microbiol. Rev. 55: 371–394.

21. Cowan, J. M., M. L. Urbanowski, M. Talmi, and G. V. Stauffer. 1993. Regulation of the Salmonella typhimurium metF gene by the MetR protein. J. Bacteriol. 175:5862–5866.

22. Darwin, K. H., and V. L. Miller. 1999. InvF is required for expression of genes encoding proteins secreted by the SPI1 type III secretion apparatus in Salmonella typhimurium. J. Bacteriol. 181:4949–4954.

23. Darwin, K. H., and V. L. Miller. 1999. Molecular basis of the interaction of

Salmonella with the intestinal mucosa. Clin. Microbiol. Rev. 12:405–428.

24. Darwin, K. H., and V. L. Miller. 2000. The putative invasion protein chap-erone SicA acts together with InvF to activate the expression of Salmonella

typhimurium virulence genes. Mol. Microbiol. 35:949–959.

25. Darwin, K. H., and V. L. Miller. 2001. Type III secretion chaperone-dependent regulation: activation of virulence genes by SicA and InvF in

Salmonella typhimurium. EMBO J. 20:1850–1862.

26. Day, J. B., and C. A. Lee. 2003. Secretion of the orgC gene product by

Salmonella enterica serovar Typhimurium. Infect. Immun. 71:6680–6685.

27. De Man, J. C., M. Rogosa, and M. E. Sharpe. 1960. A medium for the cultivation of lactobacilli. J. Appl. Bacteriol. 23:130–135.

28. De Smet, F., J. Mathys, K. Marchal, G. Thijs, B. De Moor, and Y. Moreau. 2002. Adaptive quality-based clustering of gene expression profiles. Bioin-formatics 18:735–746.

29. Detweiler, C. S., D. M. Monack, I. E. Brodsky, H. Mathew, and S. Falkow. 2003. virK, somA and rcsC are important for systemic Salmonella enterica serovar Typhimurium infection and cationic peptide resistance. Mol. Mi-crobiol. 48:385–400.

30. Durant, J. A., D. E. Corrier, L. H. Stanker, and S. C. Ricke. 2000. Expres-sion of the hilA Salmonella typhimurium gene in a poultry Salmonella

enteritidis isolate in response to lactate and nutrients. J. Appl. Microbiol.

89:63–69.

31. Durant, J. A., D. E. Corrier, L. H. Stanker, and S. C. Ricke. 2000.

Salmo-nella enteritidis hilA gene fusion response after incubation in spent media

from either S. enteritidis or a poultry Lactobacillus strain. J. Environ. Sci. Health B. 35:599–610.

32. Eichelberg, K., and J. E. Galan. 1999. Differential regulation of Salmonella

typhimurium type III secreted proteins by pathogenicity island 1

(SPI-1)-encoded transcriptional activators InvF and HilA. Infect. Immun. 67:4099– 4105.

33. Eichelberg, K., W. D. Hardt, and J. E. Galan. 1999. Characterization of SprA, an AraC-like transcriptional regulator encoded within the Salmonella

typhimurium pathogenicity island 1. Mol. Microbiol. 33:139–152.

34. Eisen, M. B., and P. O. Brown. 1999. DNA arrays for analysis of gene expression. Methods Enzymol. 303:179–205.

35. Ellermeier, C. D., and J. M. Slauch. 2003. RtsA and RtsB coordinately regulate expression of the invasion and flagellar genes in Salmonella

en-terica serovar Typhimurium. J. Bacteriol. 185:5096–5108.

36. Engelen, K., B. Coessens, K. Marchal, and B. De Moor. 2003. MARAN: normalizing micro-array data. Bioinformatics 19:893–894.

37. Fahlen, T. F., N. Mathur, and B. D. Jones. 2000. Identification and char-acterization of mutants with increased expression of hilA, the invasion gene transcriptional activator of Salmonella typhimurium. FEMS Immunol. Med. Microbiol. 28:25–35.

38. Fahlen, T. F., R. L. Wilson, J. D. Boddicker, and B. D. Jones. 2001. Hha is a negative modulator of transcription of hilA, the Salmonella enterica sero-var Typhimurium invasion gene transcriptional activator. J. Bacteriol. 183: 6620–6629.

39. Food and Agriculture Organization/World Health Organization. 2001. Evaluation of health and nutritional properties of powder milk and live lactic acid bacteria. Food and Agriculture Organization, Rome, Italy. 40. Fuller, R. 1989. Probiotics in man and animals. J. Appl. Bacteriol. 66:365–

378.

41. Galan, J. E. 1996. Molecular genetic bases of Salmonella entry into host cells. Mol. Microbiol. 20:263–271.

42. Garcia-Vescovi, E., F. C. Soncini, and E. A. Groisman. 1996. Mg2⫹_{as an} extracellular signal: environmental regulation of Salmonella virulence. Cell

84:165–174.

43. Groisman, E. A. 2001. The pleiotropic two-component regulatory system PhoP-PhoQ. J. Bacteriol. 183:1835–1842.

44. Hentschel, U., U. Dobrindt, and M. Steinert. 2003. Commensal bacteria make a difference. Trends Microbiol. 11:148–150.

45. Hoiseth, S. K., and B. A. Stocker. 1981. Aromatic-dependent Salmonella

typhimurium are non-virulent and effective as live vaccines. Nature 291:238–

239.

46. Hooper, L. V., L. Bry, P. G. Falk, and J. I. Gordon. 1998. Host-microbial symbiosis in the mammalian intestine: exploring an internal ecosystem. Bioessays 20:336–343.

47. Hudault, S., V. Lievin, M. F. Bernet-Camard, and A. L. Servin. 1997. Antagonistic activity exerted in vitro and in vivo by Lactobacillus casei (strain GG) against Salmonella typhimurium C5 infection. Appl. Environ. Microbiol. 63:513–518.

48. Iyoda, S., T. Kamidoi, K. Hirose, K. Kutsukake, and H. Watanabe. 2001. A flagellar gene fliZ regulates the expression of invasion genes and virulence phenotype in Salmonella enterica serovar Typhimurium. Microb. Pathog.

30:81–90.

49. Johnston, C., D. A. Pegues, C. J. Hueck, A. Lee, and S. I. Miller. 1996. Transcriptional activation of Salmonella typhimurium invasion genes by a member of the phosphorylated response-regulator superfamily. Mol. Mi-crobiol. 22:715–727.

50. Jones, B. D., N. Ghori, and S. Falkow. 1994. Salmonella typhimurium ini-tiates murine infection by penetrating and destroying the specialized epi-thelial M cells of the Peyer’s patches. J. Exp. Med. 180:15–23.

51. Kaniga, K., S. Tucker, D. Trollinger, and J. E. Galan. 1995. Homologs of the Shigella IpaB and IpaC invasins are required for Salmonella

typhi-murium entry into cultured epithelial cells. J. Bacteriol. 177:3965–3971.

52. Kerr, M. K., and G. A. Churchill. 2001. Bootstrapping cluster analysis: assessing the reliability of conclusions from microarray experiments. Proc. Natl. Acad. Sci. USA 98:8961–8965.

53. Kerr, M. K., and G. A. Churchill. 2001. Statistical design and the analysis of gene expression microarray data. Genet. Res. 77:123–128.

54. Kerr, M. K., M. Martin, and G. A. Churchill. 2000. Analysis of variance for gene expression microarray data. J. Comput. Biol. 7:819–837.

55. Lawrence, C. E., S. F. Altschul, M. S. Boguski, J. S. Liu, A. F. Neuwald, and

J. C. Wootton.1993. Detecting subtle sequence signals: a Gibbs sampling strategy for multiple alignment. Science 262:208–214.

56. Lee, C. A., and S. Falkow. 1990. The ability of Salmonella to enter mam-malian cells is affected by bacterial growth state. Proc. Natl. Acad. Sci. USA

87:4304–4308.

57. Lehto, E. M., and S. J. Salminen. 1997. Inhibition of Salmonella