The role of intracellular thyroid hormone metabolism in innate immune cells

(1)

UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl)

van der Spek, A.H.

Publication date

2018

Document Version

Other version

License

Other

Link to publication

Citation for published version (APA):

van der Spek, A. H. (2018). The role of intracellular thyroid hormone metabolism in innate

immune cells.

General rights

It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s)

and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open

content license (like Creative Commons).

Disclaimer/Complaints regulations

If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please

let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material

inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter

to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You

will be contacted as soon as possible.

(2)

516644-L-bw-spek 516644-L-bw-spek 516644-L-bw-spek 516644-L-bw-spek Processed on: 16-5-2018 Processed on: 16-5-2018 Processed on: 16-5-2018

Processed on: 16-5-2018 PDF page: 58PDF page: 58PDF page: 58PDF page: 58

ATRA-DIFFERENTIATED NB4 CELLS: AN

IN VITRO MODEL FOR THE STUDY OF D3

IN HUMAN NEUTROPHILS

Anne H. van der Spek, Winnie G. Vos, Eric Fliers and Anita Boelen

ATRA-DIFFERENTIATED NB4 CELLS: AN

IN VITRO MODEL FOR THE STUDY OF D3

IN HUMAN NEUTROPHILS

(3)

60

Abstract

Recent research from our lab has shown that the thyroid hormone (TH) inactivating enzyme type 3 deiodinase (D3) plays an important role in neutrophil function. To further study the mechanistic pathways behind the role of D3 in these cells, an adequate in vitro model is required. Primary human neutrophils are highly suitable for functional assays but present methodological difficulties when trying to manipulate intracellular pathways. To overcome these methodological difficulties we established an in vitro model for the study of D3 in human neutrophils. To this end a human promyelocytic leukemia cell line, NB4, was used. This cell line can be differentiated into neutrophil-like cells using all-trans retinoic acid. Differentiated NB4 cells contain significant amounts of D3 in the cytosol and in intracellular granules involved in bacterial killing. This subcellular distribution pattern of D3 is highly similar to that found in primary human neutrophils. In addition, differentiated NB4 cells express various other essential elements of intracellular TH metabolism including TH transporters and TH receptors, representing the intracellular machinery required to function as TH target cells. In conclusion, differentiated NB4 cells are an excellent in vitro model for the study of D3 in human neutrophils. This model will allow us to study the functional role of D3 in these cells in more detail, partially overcoming the methodological limitations of working with primary neutrophils.

61

4 Introduction

The thyroid hormone inactivating enzyme type 3 deiodinase (D3) plays an important role in neutrophil function. D3 is part of the deiodinase family, an ensemble of enzymes that regulate intracellular thyroid hormone (TH) bioavailability by converting circulating TH either to its active or inactive form within the cell (Bianco and Kim, 2006). Large amounts of D3 are observed in infiltrating neutrophils during both bacterial infection and sterile inflammation in vivo (Boelen et al., 2008, Boelen et al., 2005). In addition, mice that lack D3 have impaired bacterial clearance compared to wildtype mice upon pulmonary infection with Streptococcus pneumoniae (Boelen et al., 2009). Together, these studies suggest that adequate modulation of intracellular TH levels is essential for neutrophil function.

Although studies in primary cells robustly indicate an important role for D3 in neutrophils, these models are not ideally suited to unravelling the molecular pathways involved and can mainly be used for functional studies. This is partly due to the fact that primary neutrophils are challenging to manipulate

ex vivo. Large amounts of primary neutrophils can be derived from human venous blood or from murine

bone marrow. However, primary neutrophils are only viable for a very short time ex vivo (hours) and do not proliferate in culture. In addition, these cells are very easily activated by a range of stimuli and environmental challenges. Therefore experiments with for example chemical inhibitors can result in inadvertent activation of the cells, thus significantly influencing results. In addition, using siRNA in order to knock down gene expression is not possible due to the short life span of these cells in culture. In murine neutrophils, this can be overcome by using primary cells derived from a genetically modified mouse. For human neutrophils however, this is more challenging. An excellent human model in which to study the role of a certain gene or protein in neutrophil function is neutrophils derived from patients with a documented mutation of the gene of interest. In the case of D3, several polymorphisms have been described, however the functional consequences of these mutations remain unclear as there is no clear clinical phenotype associated with these polymorphisms (Verloop et al., 2014). This is in contrast to the phenotype of D3KO mice that have severely impaired fertility and high perinatal mortality (Hernandez et al., 2006). Therefore it is plausible that an inactivating mutation of D3 in humans would be lethal. It is important to generate a valid in vitro model for the study of D3 in human neutrophils. This would allow for more mechanistic studies and partially overcome the methodological limitations of working with primary neutrophils. In this study we demonstrate the use of the neutrophil-like NB4 cell line, differentiated using all-trans retinoic acid (ATRA), as a model for the study of D3 in human neutrophils.

Materials and Methods

Cell culture and stimulation

NB4 cells, a human promyelocytic leukemia cell line (Lanotte et al., 1991), were a kind gift from prof. T.K. van den Berg, Sanquin Research and Landsteiner Laboratory, Amsterdam, The Netherlands. Cells were cultured at 37⁰C with 5% CO₂ in DMEM high glucose medium (Lonza) with 10% fetal calf serum (FCS), 4 mM L-glutamine, 100 IU/ml penicillin and 100 µg/ml streptomycin.

(4)

Chapter 4

60

Abstract

Recent research from our lab has shown that the thyroid hormone (TH) inactivating enzyme type 3 deiodinase (D3) plays an important role in neutrophil function. To further study the mechanistic pathways behind the role of D3 in these cells, an adequate in vitro model is required. Primary human neutrophils are highly suitable for functional assays but present methodological difficulties when trying to manipulate intracellular pathways. To overcome these methodological difficulties we established an in vitro model for the study of D3 in human neutrophils. To this end a human promyelocytic leukemia cell line, NB4, was used. This cell line can be differentiated into neutrophil-like cells using all-trans retinoic acid. Differentiated NB4 cells contain significant amounts of D3 in the cytosol and in intracellular granules involved in bacterial killing. This subcellular distribution pattern of D3 is highly similar to that found in primary human neutrophils. In addition, differentiated NB4 cells express various other essential elements of intracellular TH metabolism including TH transporters and TH receptors, representing the intracellular machinery required to function as TH target cells. In conclusion, differentiated NB4 cells are an excellent in vitro model for the study of D3 in human neutrophils. This model will allow us to study the functional role of D3 in these cells in more detail, partially overcoming the methodological limitations of working with primary neutrophils.

NB4 cells; an in vitro model for D3 in neutrophils

61

4 Introduction

The thyroid hormone inactivating enzyme type 3 deiodinase (D3) plays an important role in neutrophil function. D3 is part of the deiodinase family, an ensemble of enzymes that regulate intracellular thyroid hormone (TH) bioavailability by converting circulating TH either to its active or inactive form within the cell (Bianco and Kim, 2006). Large amounts of D3 are observed in infiltrating neutrophils during both bacterial infection and sterile inflammation in vivo (Boelen et al., 2008, Boelen et al., 2005). In addition, mice that lack D3 have impaired bacterial clearance compared to wildtype mice upon pulmonary infection with Streptococcus pneumoniae (Boelen et al., 2009). Together, these studies suggest that adequate modulation of intracellular TH levels is essential for neutrophil function.

Although studies in primary cells robustly indicate an important role for D3 in neutrophils, these models are not ideally suited to unravelling the molecular pathways involved and can mainly be used for functional studies. This is partly due to the fact that primary neutrophils are challenging to manipulate

ex vivo. Large amounts of primary neutrophils can be derived from human venous blood or from murine

bone marrow. However, primary neutrophils are only viable for a very short time ex vivo (hours) and do not proliferate in culture. In addition, these cells are very easily activated by a range of stimuli and environmental challenges. Therefore experiments with for example chemical inhibitors can result in inadvertent activation of the cells, thus significantly influencing results. In addition, using siRNA in order to knock down gene expression is not possible due to the short life span of these cells in culture. In murine neutrophils, this can be overcome by using primary cells derived from a genetically modified mouse. For human neutrophils however, this is more challenging. An excellent human model in which to study the role of a certain gene or protein in neutrophil function is neutrophils derived from patients with a documented mutation of the gene of interest. In the case of D3, several polymorphisms have been described, however the functional consequences of these mutations remain unclear as there is no clear clinical phenotype associated with these polymorphisms (Verloop et al., 2014). This is in contrast to the phenotype of D3KO mice that have severely impaired fertility and high perinatal mortality (Hernandez et al., 2006). Therefore it is plausible that an inactivating mutation of D3 in humans would be lethal. It is important to generate a valid in vitro model for the study of D3 in human neutrophils. This would allow for more mechanistic studies and partially overcome the methodological limitations of working with primary neutrophils. In this study we demonstrate the use of the neutrophil-like NB4 cell line, differentiated using all-trans retinoic acid (ATRA), as a model for the study of D3 in human neutrophils.

Materials and Methods

Cell culture and stimulation

NB4 cells, a human promyelocytic leukemia cell line (Lanotte et al., 1991), were a kind gift from prof. T.K. van den Berg, Sanquin Research and Landsteiner Laboratory, Amsterdam, The Netherlands. Cells were cultured at 37⁰C with 5% CO₂ in DMEM high glucose medium (Lonza) with 10% fetal calf serum (FCS), 4 mM L-glutamine, 100 IU/ml penicillin and 100 µg/ml streptomycin.

(5)

62

NB4 cells were cultured for 7 days in the presence of 5 nM all-trans retinoic acid (ATRA; Sigma-Aldrich), a compound which is known to induce differentiation of NB4 into neutrophil-like cells (Idres et al., 2001). Differentiation of these cells is characterized by growth arrest, increased NAPDH oxidase activity and upregulation of differentiation-related cell surface markers such as CD11b (Launay et al., 2003, Gahmberg, 1997, Idres et al., 2001). After differentiation, cells were transferred to medium without ATRA. Differentiation was checked by analyzing CD11b expression using flow cytometry. High CD11b expression indicating successful differentiation was always observed in at least 90% of the cells. Differentiated NB4 cells were stimulated with serum-opsonized zymosan, a yeast particle and phagocytic stimulus, fluorescently labelled with Alexa Fluor 488 (Life Technologies). Cells were incubated with serum-opsonized zymosan (multiplicity of infection 20) for 15-60 minutes before being fixed and processed for confocal miscroscopy as described below.

Western Blotting

Cell lysates of differentiated NB4 cells were produced as previously described (Roos et al., 2014). Lysates were run on a 10% SDS-PAGE gel. Gels were blotted on to PVDF membrane and processed as described previously (de Vries et al., 2014b). Band density was calculated using Image J (version 1.50i).

Primary antibodies used were polyclonal rabbit anti human D3 #676 (dilution 1:500, (Kuiper et al., 2003), kindly provided by prof. T.J. Visser, Erasmus Medical Center, Rotterdam, the Netherlands) and polyclonal goat anti-actin I-19 (dilution 1:5000; Santa Cruz Biotechnology). Secondary antibodies were horseradish peroxidase-conjugated goat-anti-rabbit (1:10,000) and rabbit-anti-goat (1:20,000) antibodies (Dako).

Confocal microscopy

Stainings of differentiated NB4 cells for confocal microscopy were performed as described previously (van der Spek et al., 2016). Stained cells were mounted with Prolong Gold antifade reagent with DAPI (Life Technologies) and imaged by a confocal laser-scanning system (Leica TCS SP8 X) using the Leica DMI6000 inverted microscope and the 63x/1.40 Oil CS2 objective. Images were analyzed using the Leica LAS X software (version 1.1).

Primary antibodies used were anti-D3 #718 (dilution 1:500; (Huang et al., 2003)), anti-early endosome associated antigen-1 (EEA1, 1:300, BD Biosciences), anti-CD63 (1:100, clone H5C6, BD Biosciences), lysosome-associated membrane protein-1 (LAMP-1, 1:100, BD Biosciences), FITC-conjugated anti-myeloperoxidase (dilution 1:50, clone CLB-MPO-1/1, Novus Biologicals), anti-Lactoferrin (1:50, clone 2B8, Abcam), anti-matrix metallopeptidase 9 (1:50, clone 56-2A4, Abcam) and anti-human albumin (1:500, clone HSA-9, Sigma-Aldrich). Secondary antibodies used were Alexa Fluor 568-conjugated goat-anti-rabbit and/or Alexa Fluor 647-conjugated goat-anti-mouse IgG1 (1:500; both Life Technologies). All stainings included a control without primary antibody to assess background staining.

Flow cytometry

Flow cytometry stainings were performed as described previously (van der Spek et al., 2016). Briefly,

63

4

cells were either stained directly or fixed and permeabilized prior to staining using the eBioscience Intracellular Fixation & Permeabilization Buffer Set. Primary antibodies used were APC-Cy7-conjugated anti-CD11b (BD Biosciences), anti-D3 (#718; 1:250) with Alexa Fluor 647-conjugated donkey anti rabbit (1:250, Biolegend). All stainings included a control without primary antibody or with relevant isotype control antibody to assess background staining. A total of 100,000 events was acquired using a BD FACS Canto II flow cytometer and data was analyzed using FlowJo software (v.10).

RNA isolation and qPCR

Differentiated NB4 cells were lysed in Tri-Reagent (Life Technologies) at 6x106_{cells/ml. RNA was isolated}

using the Nucleospin RNA extraction kit (Machery Nagel). RNA yield was determined using the DS-11 spectrophotometer (Denovix), and cDNA was synthesized with equal RNA input with the AMV Reverse Transcriptase enzyme with oligo d(T) primers (Roche). As a control for genomic DNA contamination, a cDNA synthesis reaction without reverse transcriptase was included, which showed no amplification of a non-intron spanning primer. Qualitative PCR was performed using the LightCycler 480 (Roche) and SensiFAST SYBR No-ROX (Bioline). Following amplification, PCR products were analyzed on DNA agarose gel and visualized on the ImageQuant LAS4000 (GE Healthcare). Primer sequences are listed in Table

4.1.

Gene Protein Forward primer Reverse primer Amplicon length _(bp)

DIO1 D1 AGCCACGACAACTGGATACC ACTCCCAAATGTTGCACCTC 160

DIO2 D2 CCTCCTCGATGCCTACAAAC TCCTTCTGTACTGGAGACATGC

82 (trans.var. 1&2) 190 (trans. var. 3) 324 (trans.var. 4) 216 (trans.var. 5)

DIO3 D3 AACTCCGAGGTGGTTCTGC TTGCGCGTAGTCGAGGAT 60

SLC16A2 MCT8 CAACGCACTTACCGCATCTG GTAGCCCCAATACACACCAAGAG 146

SLC16A10 MCT10 ATGCTGGAAACCTTCGGCTC TGAAGACGCTGACTATTGGGC 115

THRA1 TRα1 CATCTTTGAACTGGGCAAGT CTGAGGCTTTAGACTTCCTGATC 348

THRB1 TRβ1 AAGTGCCCAGACCTTCCAAA AAAGAAACCCTTGCAGCCTTC 151

EEF1A1 EF1α1 TTTTCGCAACGGGTTTGCC TTGCCCGAATCTACGTGTCC 120

HPRT HPRT CCTGCTGGATTACATCAAAGCACTG TCCAACACTTCGTGGGGTCCT 289 Trans.var. = transcript variant.

(6)

Chapter 4

62

NB4 cells were cultured for 7 days in the presence of 5 nM all-trans retinoic acid (ATRA; Sigma-Aldrich), a compound which is known to induce differentiation of NB4 into neutrophil-like cells (Idres et al., 2001). Differentiation of these cells is characterized by growth arrest, increased NAPDH oxidase activity and upregulation of differentiation-related cell surface markers such as CD11b (Launay et al., 2003, Gahmberg, 1997, Idres et al., 2001). After differentiation, cells were transferred to medium without ATRA. Differentiation was checked by analyzing CD11b expression using flow cytometry. High CD11b expression indicating successful differentiation was always observed in at least 90% of the cells. Differentiated NB4 cells were stimulated with serum-opsonized zymosan, a yeast particle and phagocytic stimulus, fluorescently labelled with Alexa Fluor 488 (Life Technologies). Cells were incubated with serum-opsonized zymosan (multiplicity of infection 20) for 15-60 minutes before being fixed and processed for confocal miscroscopy as described below.

Western Blotting

Cell lysates of differentiated NB4 cells were produced as previously described (Roos et al., 2014). Lysates were run on a 10% SDS-PAGE gel. Gels were blotted on to PVDF membrane and processed as described previously (de Vries et al., 2014b). Band density was calculated using Image J (version 1.50i).

Primary antibodies used were polyclonal rabbit anti human D3 #676 (dilution 1:500, (Kuiper et al., 2003), kindly provided by prof. T.J. Visser, Erasmus Medical Center, Rotterdam, the Netherlands) and polyclonal goat anti-actin I-19 (dilution 1:5000; Santa Cruz Biotechnology). Secondary antibodies were horseradish peroxidase-conjugated goat-anti-rabbit (1:10,000) and rabbit-anti-goat (1:20,000) antibodies (Dako).

Confocal microscopy

Stainings of differentiated NB4 cells for confocal microscopy were performed as described previously (van der Spek et al., 2016). Stained cells were mounted with Prolong Gold antifade reagent with DAPI (Life Technologies) and imaged by a confocal laser-scanning system (Leica TCS SP8 X) using the Leica DMI6000 inverted microscope and the 63x/1.40 Oil CS2 objective. Images were analyzed using the Leica LAS X software (version 1.1).

Primary antibodies used were anti-D3 #718 (dilution 1:500; (Huang et al., 2003)), anti-early endosome associated antigen-1 (EEA1, 1:300, BD Biosciences), anti-CD63 (1:100, clone H5C6, BD Biosciences), lysosome-associated membrane protein-1 (LAMP-1, 1:100, BD Biosciences), FITC-conjugated anti-myeloperoxidase (dilution 1:50, clone CLB-MPO-1/1, Novus Biologicals), anti-Lactoferrin (1:50, clone 2B8, Abcam), anti-matrix metallopeptidase 9 (1:50, clone 56-2A4, Abcam) and anti-human albumin (1:500, clone HSA-9, Sigma-Aldrich). Secondary antibodies used were Alexa Fluor 568-conjugated goat-anti-rabbit and/or Alexa Fluor 647-conjugated goat-anti-mouse IgG1 (1:500; both Life Technologies). All stainings included a control without primary antibody to assess background staining.

Flow cytometry

Flow cytometry stainings were performed as described previously (van der Spek et al., 2016). Briefly,

63

4

cells were either stained directly or fixed and permeabilized prior to staining using the eBioscience Intracellular Fixation & Permeabilization Buffer Set. Primary antibodies used were APC-Cy7-conjugated anti-CD11b (BD Biosciences), anti-D3 (#718; 1:250) with Alexa Fluor 647-conjugated donkey anti rabbit (1:250, Biolegend). All stainings included a control without primary antibody or with relevant isotype control antibody to assess background staining. A total of 100,000 events was acquired using a BD FACS Canto II flow cytometer and data was analyzed using FlowJo software (v.10).

RNA isolation and qPCR

Differentiated NB4 cells were lysed in Tri-Reagent (Life Technologies) at 6x106_{cells/ml. RNA was isolated}

using the Nucleospin RNA extraction kit (Machery Nagel). RNA yield was determined using the DS-11 spectrophotometer (Denovix), and cDNA was synthesized with equal RNA input with the AMV Reverse Transcriptase enzyme with oligo d(T) primers (Roche). As a control for genomic DNA contamination, a cDNA synthesis reaction without reverse transcriptase was included, which showed no amplification of a non-intron spanning primer. Qualitative PCR was performed using the LightCycler 480 (Roche) and SensiFAST SYBR No-ROX (Bioline). Following amplification, PCR products were analyzed on DNA agarose gel and visualized on the ImageQuant LAS4000 (GE Healthcare). Primer sequences are listed in Table

4.1.

Gene Protein Forward primer Reverse primer Amplicon length _(bp)

DIO1 D1 AGCCACGACAACTGGATACC ACTCCCAAATGTTGCACCTC 160

DIO2 D2 CCTCCTCGATGCCTACAAAC TCCTTCTGTACTGGAGACATGC

82 (trans.var. 1&2) 190 (trans. var. 3) 324 (trans.var. 4) 216 (trans.var. 5)

DIO3 D3 AACTCCGAGGTGGTTCTGC TTGCGCGTAGTCGAGGAT 60

SLC16A2 MCT8 CAACGCACTTACCGCATCTG GTAGCCCCAATACACACCAAGAG 146

SLC16A10 MCT10 ATGCTGGAAACCTTCGGCTC TGAAGACGCTGACTATTGGGC 115

THRA1 TRα1 CATCTTTGAACTGGGCAAGT CTGAGGCTTTAGACTTCCTGATC 348

THRB1 TRβ1 AAGTGCCCAGACCTTCCAAA AAAGAAACCCTTGCAGCCTTC 151

EEF1A1 EF1α1 TTTTCGCAACGGGTTTGCC TTGCCCGAATCTACGTGTCC 120

HPRT HPRT CCTGCTGGATTACATCAAAGCACTG TCCAACACTTCGTGGGGTCCT 289 Trans.var. = transcript variant.

(7)

64

Results

D3 is upregulated during differentiation of NB4 cells

To determine whether D3 protein was present in NB4 cells, we performed western blot analysis of whole cell lysates from differentiated and undifferentiated NB4 cells. D3 protein was strongly induced during differentiation with ATRA (Figure 4.1). A clear band was observed at 37kD (the expected molecular mass of D3 (Kuiper et al., 2003)) in differentiated NB4 cells, whilst a much lighter band was found in undifferentiated cells (Figure 4.1A). This difference is also reflected in the ratio of D3 to loading control (beta actin) band density (Figure 4.1B).

37kD 50kD 75kD 42 kD D3 ATRA Beta Actin

+

-A B D3/Beta Actin ratio ATRA + -1.5 1.0 0.5 0.0

**

Figure 4.1: D3 is upregulated during differentiation of NB4 cells. (A) Western blot for D3 (37kD) and Beta

actin (42 kD) in whole cell lysates of differentiated (ATRA+) and undifferentiated (ATRA-) NB4 cells. (B) Western blot band density was quantified for D3 and beta actin. The ratio for D3/Beta actin band density is shown. Data represent mean ± SD. **p<0.01

Figure 4.2: D3 is located intracellularly in differentiated NB4 cells.

(A) ATRA-differentiated NB4 cells were permeabilized or left unpermeabilized and then stained for D3 using an Alexa Fluor 647-labelled corresponding secondary antibody. Samples were analyzed using flow cytometry and representative histograms of D3-Alexa Fluor 647 fluorescence are shown. Cells stained with both primary and secondary antibody are indicated by the grey filled histograms. Cells stained only with secondary antibody have been included as a control (open histogram). (B) Median fluorescence intensity (MFI) D3 staining in unpermeabilized (unperm) and permeabilized (perm) cells as measured by flow cytometry.

65

4

D3 is located intracellularly in differentiated NB4 cells.

To determine the subcellular location of D3, we used flow cytometry to assess whether D3 was present on the cell surface or within the cell. Differentiated NB4 cells were either permeablized or not prior to D3 staining. D3 was not observed on unpermeabilized cells (Figure 4.2A-B), indicating that it is not present on the extracellular side of plasma membrane. Permeabilized differentiated NB4 cells showed strong D3 staining, confirming the intracellular location of D3 (Figure 4.2A-B).

A

Zoom

CD63 Lamp1 EEA1 DAPI D3 DAPI D3

DAPID3

CD63 Lamp1

EEA1

B

_LF _MMP9 _HSA

LF

DAPI D3 DAPI D3MMP9 DAPI D3HSA

DAPI D3LF

MPO

Zoom

Figure 4.3: Colocalization of D3 with granule markers; Confocal microscopy images of differentiated NB4 cells show

double immunostaining for D3 (shown in red) with (A) markers for the endosomal-lysosomal pathway (shown in green) and (B) markers for neutrophil granule subsets (shown in green). Enlarged images of areas indicated with a white box are shown directly below. Colocalization between D3 and other markers is visible as yellow and indicated with white arrows in the enlarged images. Red arrows indicate granules without colocalization. Scale bars are 3 µm in length. Abbreviations: EEA1: early endosome antigen-1; LAMP1: lysosome-associated membrane protein-1; MPO: myeloperoxidase; LF: lactoferrin; MMP9: matrix metallopeptidase 9; HAS: human serum albumin.

(8)

Chapter 4

64

Results

D3 is upregulated during differentiation of NB4 cells

To determine whether D3 protein was present in NB4 cells, we performed western blot analysis of whole cell lysates from differentiated and undifferentiated NB4 cells. D3 protein was strongly induced during differentiation with ATRA (Figure 4.1). A clear band was observed at 37kD (the expected molecular mass of D3 (Kuiper et al., 2003)) in differentiated NB4 cells, whilst a much lighter band was found in undifferentiated cells (Figure 4.1A). This difference is also reflected in the ratio of D3 to loading control (beta actin) band density (Figure 4.1B).

37kD 50kD 75kD 42 kD D3 ATRA Beta Actin

+

-A B D3/Beta Actin ratio ATRA + -1.5 1.0 0.5 0.0

**

Figure 4.1: D3 is upregulated during differentiation of NB4 cells. (A) Western blot for D3 (37kD) and Beta

actin (42 kD) in whole cell lysates of differentiated (ATRA+) and undifferentiated (ATRA-) NB4 cells. (B) Western blot band density was quantified for D3 and beta actin. The ratio for D3/Beta actin band density is shown. Data represent mean ± SD. **p<0.01

Figure 4.2: D3 is located intracellularly in differentiated NB4 cells.

(A) ATRA-differentiated NB4 cells were permeabilized or left unpermeabilized and then stained for D3 using an Alexa Fluor 647-labelled corresponding secondary antibody. Samples were analyzed using flow cytometry and representative histograms of D3-Alexa Fluor 647 fluorescence are shown. Cells stained with both primary and secondary antibody are indicated by the grey filled histograms. Cells stained only with secondary antibody have been included as a control (open histogram). (B) Median fluorescence intensity (MFI) D3 staining in unpermeabilized (unperm) and permeabilized (perm) cells as measured by flow cytometry.

65

4

D3 is located intracellularly in differentiated NB4 cells.

To determine the subcellular location of D3, we used flow cytometry to assess whether D3 was present on the cell surface or within the cell. Differentiated NB4 cells were either permeablized or not prior to D3 staining. D3 was not observed on unpermeabilized cells (Figure 4.2A-B), indicating that it is not present on the extracellular side of plasma membrane. Permeabilized differentiated NB4 cells showed strong D3 staining, confirming the intracellular location of D3 (Figure 4.2A-B).

A

Zoom

CD63 Lamp1 EEA1 DAPI D3 DAPI D3

DAPI D3

CD63 Lamp1

EEA1

B

_LF _MMP9 _HSA

LF

DAPI D3 DAPI D3MMP9 DAPI D3HSA

DAPI D3LF

MPO

Zoom

Figure 4.3: Colocalization of D3 with granule markers; Confocal microscopy images of differentiated NB4 cells show

double immunostaining for D3 (shown in red) with (A) markers for the endosomal-lysosomal pathway (shown in green) and (B) markers for neutrophil granule subsets (shown in green). Enlarged images of areas indicated with a white box are shown directly below. Colocalization between D3 and other markers is visible as yellow and indicated with white arrows in the enlarged images. Red arrows indicate granules without colocalization. Scale bars are 3 µm in length. Abbreviations: EEA1: early endosome antigen-1; LAMP1: lysosome-associated membrane protein-1; MPO: myeloperoxidase; LF: lactoferrin; MMP9: matrix metallopeptidase 9; HAS: human serum albumin.

(9)

66

D3 is present in intracellular granules in differentiated NB4 cells and partially co-localizes with certain granule markers

The subcellular distribution of D3 in differentiated NB4 cells was assessed using fluorescent confocal microscopy. Abundant intracellular D3 staining was observed in granules throughout the cell. To further determine the nature of these granules we performed a series of double-stainings for D3 and various markers of intracellular granule. As D3 is known to present in early endosome in certain other cell types (Baqui et al., 2003), we first assessed whether the D3-containing granules were vesicles of the endosomal-lysosomal pathway. Differentiated NB4 cells were stained for D3 together with either early endosome-associated protein 1 (EEA1), the late endosome and exosome marker CD63 or the lysosome marker lysosome-associated membrane protein-1 (LAMP-1) (Fevrier and Raposo, 2004, van den Boorn et al., 2011, Kallquist et al., 2008). D3 did not co-localize with any of these markers (Figure 4.3A). In primary human neutrophils, D3 is known to partially co-localize with markers for intracellular granules containing bactericidal proteins that are mobilized upon activation of the cell (van der Spek et al., 2016, Borregaard and Cowland, 1997, Faurschou and Borregaard, 2003). We therefore assessed whether D3 was present in any of these granule types, which are crucial for neutrophils’ microbicidal function. Differentiated NB4 cells were double-stained for D3 and specific markers of neutrophil granule subtypes (Figure 4.3B). D3 was found to co-localize with a subset of lactoferrin-containing granules, a marker for secondary/specific granules (Cramer et al., 1985). Colocalization between D3 and myeloperoxidase (MPO), a marker for azurophilic granules (Cramer et al., 1985), was not clearly observed, in contrast to findings in primary human neutrophils (van der Spek et al., 2016). In addition, D3 did not co-localize with matrix metallopeptidase 9 (MMP9; previously known as 92 kD gelatinase B/type IV collagenase), a marker for gelatinase granules (Kjeldsen et al., 1993) or human serum albumin (HSA), a secretory vesicles marker (Borregaard et al., 1992).

The subcellular location of D3 does not change during early phagocytosis in differentiated NB4 cells

To determine whether the subcellular location of D3 changes due to phagocytosis, we incubated differentiated NB4 cells with a fluorescently labeled particulate stimulus: zymosan. After only 15 minutes the cells had readily phagocytosed large amounts of particles and D3 was still observed in intracellular granules (Figure 4.4). The granular pattern and intensity of D3 staining in differentiated NB4 cells did not appear to change following phagocytosis.

A B C

DAPI D3 ZYM

Figure 4.4: D3 location does not change during phagocytosis; Confocal microscopy images of differentiated NB4

cells incubated with fluorescently labelled zymosan (shown in green) for (A) 15 minutes, (B) 30 minutes or (C) 60 minutes. Following incubation cells were fixed, permeabilized and stained for D3 (shown in red). Scale bars are 3 µm.

67

4

Differentiated NB4 cells express other essential elements of intracellular thyroid

hormone metabolism

Besides deiodinases, cells require TH transporters and TH receptors to function as a TH target cell. This allows the cells to transport extracellular TH into the cell, where it can be activated or inactivated by deiodinases. T3, the active form of TH can then bind to one of the nuclear TH receptors, thus regulating transcription of T3-responsive genes (Brent, 2012). We analyzed RNA expression of several genes related to intracellular TH metabolism in differentiated NB4 cells. These cells expressed the TH transporters MCT8 (SLC16A2) and MCT10 (SLC16A10), D3 (DIO3), type 1 deiodinase (DIO1) and the TH receptor TRα1 (THRA1) (Figure 4.5). The type 2 deiodinase (DIO2) and the TH receptor TRβ1 (THRB1) were not expressed (data not shown).

MCT8 MCT10 D1 D3 TRa1 EF1a1 HPRT

400 250 50

Figure 4.5 Differentiated NB4 cells express several essential elements of intracellular TH metabolism; RNA

expression of several genes related to intracellular TH metabolism was assessed using qPCR in differentiated NB4 cells. A DNA gel of representative PCR products is shown. Differentiated NB4 cells expressed the TH transporters MCT8 and MCT10, the type 1 (D1) and type 3 (D3) deiodinases and the TH receptor TRα1. The reference genes HPRT and EF1α1 were included as controls. Primers and amplicon lengths are listed in Table 4.1.

Discussion

Due to the methodological difficulties encountered when studying primary human neutrophils, we sought to develop an in vitro model to study the role of D3 in human neutrophils in more detail. Differentiated NB4 cells are extensively used as an in vitro model for primary human neutrophils. ATRA stimulation induces growth inhibition, cell cycle arrest, upregulation of cell surface differentiation markers and morphological changes in NB4 cells (Idres et al., 2001, Lanotte et al., 1991). In addition, ATRA-differentiated NB4 cells display various essential functional characteristics of neutrophils including the generation of hydrogen peroxide in response to stimuli and the ability to phagocytose and kill pathogens (Lanotte et al., 1991, Gazendam et al., 2016).

D3 was present in differentiated NB4 cells. Interestingly, D3 protein levels increased strongly upon differentiation of NB4 cells using ATRA. ATRA is known to induce D3 activity in astroglial cells in a

(10)

dose-516644-L-bw-spek 516644-L-bw-spek 516644-L-bw-spek 516644-L-bw-spek Processed on: 16-5-2018 Processed on: 16-5-2018 Processed on: 16-5-2018

Chapter 4

66

D3 is present in intracellular granules in differentiated NB4 cells and partially co-localizes with certain granule markers

The subcellular distribution of D3 in differentiated NB4 cells was assessed using fluorescent confocal microscopy. Abundant intracellular D3 staining was observed in granules throughout the cell. To further determine the nature of these granules we performed a series of double-stainings for D3 and various markers of intracellular granule. As D3 is known to present in early endosome in certain other cell types (Baqui et al., 2003), we first assessed whether the D3-containing granules were vesicles of the endosomal-lysosomal pathway. Differentiated NB4 cells were stained for D3 together with either early endosome-associated protein 1 (EEA1), the late endosome and exosome marker CD63 or the lysosome marker lysosome-associated membrane protein-1 (LAMP-1) (Fevrier and Raposo, 2004, van den Boorn et al., 2011, Kallquist et al., 2008). D3 did not co-localize with any of these markers (Figure 4.3A). In primary human neutrophils, D3 is known to partially co-localize with markers for intracellular granules containing bactericidal proteins that are mobilized upon activation of the cell (van der Spek et al., 2016, Borregaard and Cowland, 1997, Faurschou and Borregaard, 2003). We therefore assessed whether D3 was present in any of these granule types, which are crucial for neutrophils’ microbicidal function. Differentiated NB4 cells were double-stained for D3 and specific markers of neutrophil granule subtypes (Figure 4.3B). D3 was found to co-localize with a subset of lactoferrin-containing granules, a marker for secondary/specific granules (Cramer et al., 1985). Colocalization between D3 and myeloperoxidase (MPO), a marker for azurophilic granules (Cramer et al., 1985), was not clearly observed, in contrast to findings in primary human neutrophils (van der Spek et al., 2016). In addition, D3 did not co-localize with matrix metallopeptidase 9 (MMP9; previously known as 92 kD gelatinase B/type IV collagenase), a marker for gelatinase granules (Kjeldsen et al., 1993) or human serum albumin (HSA), a secretory vesicles marker (Borregaard et al., 1992).

The subcellular location of D3 does not change during early phagocytosis in differentiated NB4 cells

To determine whether the subcellular location of D3 changes due to phagocytosis, we incubated differentiated NB4 cells with a fluorescently labeled particulate stimulus: zymosan. After only 15 minutes the cells had readily phagocytosed large amounts of particles and D3 was still observed in intracellular granules (Figure 4.4). The granular pattern and intensity of D3 staining in differentiated NB4 cells did not appear to change following phagocytosis.

A B C

DAPI D3 ZYM

Figure 4.4: D3 location does not change during phagocytosis; Confocal microscopy images of differentiated NB4

cells incubated with fluorescently labelled zymosan (shown in green) for (A) 15 minutes, (B) 30 minutes or (C) 60 minutes. Following incubation cells were fixed, permeabilized and stained for D3 (shown in red). Scale bars are 3 µm.

67

4

Differentiated NB4 cells express other essential elements of intracellular thyroid

hormone metabolism

Besides deiodinases, cells require TH transporters and TH receptors to function as a TH target cell. This allows the cells to transport extracellular TH into the cell, where it can be activated or inactivated by deiodinases. T3, the active form of TH can then bind to one of the nuclear TH receptors, thus regulating transcription of T3-responsive genes (Brent, 2012). We analyzed RNA expression of several genes related to intracellular TH metabolism in differentiated NB4 cells. These cells expressed the TH transporters MCT8 (SLC16A2) and MCT10 (SLC16A10), D3 (DIO3), type 1 deiodinase (DIO1) and the TH receptor TRα1 (THRA1) (Figure 4.5). The type 2 deiodinase (DIO2) and the TH receptor TRβ1 (THRB1) were not expressed (data not shown).

MCT8 MCT10 D1 D3 TRa1 EF1a1 HPRT

400 250 50

Figure 4.5 Differentiated NB4 cells express several essential elements of intracellular TH metabolism; RNA

expression of several genes related to intracellular TH metabolism was assessed using qPCR in differentiated NB4 cells. A DNA gel of representative PCR products is shown. Differentiated NB4 cells expressed the TH transporters MCT8 and MCT10, the type 1 (D1) and type 3 (D3) deiodinases and the TH receptor TRα1. The reference genes HPRT and EF1α1 were included as controls. Primers and amplicon lengths are listed in Table 4.1.

Discussion

Due to the methodological difficulties encountered when studying primary human neutrophils, we sought to develop an in vitro model to study the role of D3 in human neutrophils in more detail. Differentiated NB4 cells are extensively used as an in vitro model for primary human neutrophils. ATRA stimulation induces growth inhibition, cell cycle arrest, upregulation of cell surface differentiation markers and morphological changes in NB4 cells (Idres et al., 2001, Lanotte et al., 1991). In addition, ATRA-differentiated NB4 cells display various essential functional characteristics of neutrophils including the generation of hydrogen peroxide in response to stimuli and the ability to phagocytose and kill pathogens (Lanotte et al., 1991, Gazendam et al., 2016).

D3 was present in differentiated NB4 cells. Interestingly, D3 protein levels increased strongly upon differentiation of NB4 cells using ATRA. ATRA is known to induce D3 activity in astroglial cells in a

(11)

dose-516644-L-bw-spek 516644-L-bw-spek 516644-L-bw-spek 516644-L-bw-spek Processed on: 16-5-2018 Processed on: 16-5-2018 Processed on: 16-5-2018

68

dependent manner (Esfandiari et al., 1994). It is therefore possible that the induction of D3 in these cells is a direct effect of stimulation with ATRA. However, tight regulation of intracellular TH levels is essential for regulation of proliferation and differentiation in various cell and tissue types during development (Ng et al., 2009, Ng et al., 2010). Therefore, the increase in D3 and consequent reduction in intracellular T3 levels could be an integral part of differentiation itself.

We recently described the subcellular location and distribution of D3 in primary human neutrophils (van der Spek et al., 2016). In neutrophils, D3 was absent in the plasma membrane and located exclusively in the cytosol and in intracellular granules. A subset of these D3-positive granules colocalized with MPO, a marker for azurophilic granules, or with lactoferrin, a marker for secondary granules. Both these granule subtypes play an important role in the bacterial killing machinery of these cells. The granules harbor antimicrobial proteins which are released into the phagosome or extracellular environment upon contact with a pathogen (Faurschou and Borregaard, 2003). In differentiated NB4 cells a similar intracellular distribution of D3 was observed. Both cytoplasmic and granular D3 staining was observed with D3-positive granules also showing partial colocalization with lactoferrin containing granules. Colocalization with MPO was not consistently observed. In addition, the subcellular location of D3 did not appear to change during phagocytosis in differentiated NB4 cells which is in accordance with observations in human neutrophils (van der Spek et al., 2016).

Finally, we found that differentiated NB4 cells express several essential elements required for intracellular TH metabolism including the TH transporters MCT8 and MCT10 and the nuclear TH receptor TRα1. In conclusion, differentiated NB4 cells contain significant amounts of D3. The subcellular location is similar to that found in primary human neutrophils. Furthermore, differentiated NB4 cells express several elements of intracellular TH metabolism including TH transporters and receptors, similar to those found in primary neutrophils. This ensures that these cells have the intracellular machinery to function as TH target cells. Taken together, differentiated NB4 cells are an excellent in vitro model for the study of D3 in human neutrophils. This model will allow us to study role of D3 in these cells in more mechanistic detail, partially overcoming the methodological limitations of working with primary neutrophils.

Acknowledgments

The authors thank Paul Verkuijlen and prof.dr. Timo K. van den Berg (Sanquin Landsteiner Laboratory) for providing the NB4 cell line.