Visualization of channel protein SpoVAEa in Bacillus cereus dormant spores

(1)

1

Visualization of channel protein SpoVAEa in

Bacillus cereus

dormant spores

Bachelor Thesis Final version

Student: Demi Wekking 12169463

Daily supervisor: Y. Wang

Senior supervisor: Prof. dr. S. Brul 18-2-2020

(2)

2 Abstract

The inner membrane SpoVA channel in Bacillus spores consists of SpoVA proteins including SpoVAEa and allows the release of calcium dipicolinic acid (CaDPA) from the spore core during germination. The SpoVA channel responds to signals from germinant receptors (GRs) and these are possible targets of wet heat treatments. Current food sterilisation procedures by wet heat can be very harsh, or else spores survive such a decontamination strategy. This is a major problem in the food industry, therefore it is important to get more insight into the mechanisms of sporulation and germination to find milder decontamination strategies to inactivate Bacillus cereus spores. However, unlike Bacillus subtilis spores, less is known about signal transduction between SpoVA proteins and GRs in B. cereus spores. To determine the interaction between SpoVA proteins and GRs in B. cereus spores, we chose to first examine the SpoVAEa protein. In this study, the location of the channel protein SpoVAEa in B. cereus dormant spores is examined. Previous research has shown that SpoVAEa fused by its C-terminus to strongly enhanced green fluorescent protein (SGFP2) clustered as a single spot in B. subtilis spores. The results of the new study showed that fluorescence microscopy found that 7.1% of B. cereus spores contained SpoVAEa-SGFP2 protein clusters and confirming the presence of clustered SpoVAEa in B. cereus spores.

(3)

3

1. Introduction

One of the members of the “Bacillus cereus group” is Bacillus cereus. This bacterium is relevant to humans because it is a threat for human health (Ehling-Schulz et al., 2019). B. cereus are aerobic or facultatively anaerobic, Gram-positive, and rod-shaped bacteria. This bacterium can alter between growth, sporulation, spores and spore germination (Sinai et al., 2015). During sporulation, these bacteria can form dormant endospores, which are resistant to extreme conditions such as heat, UV irradiation, and acidity (Setlow, 2001). Because of these characteristics, the spores remain viable for years in environments where no growth is possible due to nutrient starvation (Christie & Setlow, 2020). These spores consist of a core with DNA, the inner membrane (IM), cell wall, cortex, the outer membrane, coat layers, and the exosporium (Wang et al., 2020) (Figure 1).

Figure 1. Schematic structure of a dormant B. cereus spore. The GRs and CaDPA channel are located in the IM. The CaDPA channel consists of the SpoVA proteins. The dots in the core represent CaDPA.

These spores are commonly found in the soil and on plants, which enables dissemination into the food chain (Gopal et al., 2015). When endospores of B. cereus germinate, toxins are produced. For instance, some B. cereus strains are responsible for food poisoning due to secretion of enzymes and/or toxins or can cause systemic disease in humans due to

production of entero-toxins (Bottone, 2010; Ehling-Schulz et al., 2019). Thus, germination of the spores plays a crucial role in these infections and so on human health. Another problem

(5)

5 for the food industry is spore resistance because the spores survive many food

decontamination strategies (Jessberger et al., 2020). There are possible strategies to inactivate the spores, namely gamma irradiation or extremely high temperature (Dauphin et al., 2008; Setlow, 2006). However, these are harsh sterilisation procedures and are not acceptable because they can have negative effects on food product quality (De Lara et al., 2002). Thus, it is important to investigate if there are milder decontamination strategies that can contribute to the inactivation of spores. Therefore, more insight in the mechanism of spore germination is needed to find a suitable strategy to inactivate these spores. The possible targets of heat based strategies are germinant receptors (GRs) and their surrounding IM (Wen, 2020). Furthermore, Luu et al. (2015) found that heat activation only affects GR-dependent germination. Thus, with decontamination strategies using heat, the focus is on the GRs. In Bacillus, the GRs consist of A, B, and C subunits and some also contain a D subunit (Christie et al., 2020; Setlow, 2006) (Figure 1). The GRs are present in the IM in large complexes called the germinosomes (Griffiths et al., 2011). In B. cereus ATCC 14579 spores there are seven GRs – GerR, GerK, GerG, GerL, GerQ, GerI, and GerS - present in the IM (Warda et al., 2017). The spores can germinate when the GRs are

activated by germinants, which signal the presence of components necessary for growth (Setlow et al., 2017; Sinai et al., 2015).

Previous research suggested that SpoVAEa plays a role in communication with GRs in B. subtilis spores (Perez-Valdespino et al., 2014). SpoVAEa is one of the seven subunits of the SpoVA channel and is a soluble protein. The SpoVA channel responds to signals from GRs and ensures release of CaDPA from the spore core during germination (Perez-Valdespino et al., 2014). During sporulation, this channel imports CaDPA into developing spore’s core from the mother cell compartment of the cell, and CaDPA replaces core water thus decreasing the core water content (Setlow et al., 2001). This dehydration and mineralization are necessary to maintain the spores’ heat resistance and thus resistance against decontamination strategies (Beaman & Gerhardt, 1986).

Besides SpoVAEa, the SpoVA channel also contains SpoVAA, -B, -C, -D, -Eb, and-F and the spoVA operon encode these proteins. (Errington, 1993; Perez-Valdespino et al., 2014). Like B. subtilis, the spoVA operon of B. cereus also contains spoVAA, -B, -C, -D, -Eb, -Ea, -F (Wang, personal communication). SpoVAEa and SpoVAD are located on the outer surface of the inner spore membrane (Figure 1) (Perez-Valdespino et al., 2014). Due to this

(6)

6 location of SpoVAEa, this subunit is suitable for fusion with reporter proteins such as the C-terminal strongly enhanced green fluorescent protein (SGFP2), and allows for GFP folding in the well hydrated environment outside the spore core.

As mentioned above, research by Perez-Valdespino et al. (2014) suggested communication between SpoVAEa and GRs in B. subtilis. This is supported by research of Vepachedu & Setlow (2007), who found evidence that some GR protein(s) physically interact with several SpoVA proteins in B. subtilis spores, with one being SpoVAEa. Thus, this research

suggested that there was signal transduction between GRs and SpoVA proteins in spore germination. Perez-Valdespino et al. (2014) also found that spores lacking SpoVAEa

germinate slowly in GR-dependent germination. This suggests that SpoVAEa is essential for normal rapid DPA release during GR-dependent germination, even though SpoVAEa is not essential for the import of CaDPA in sporulation. Thus, SpoVAEa may play a role in linking GR activation to the opening of the SpoVA Channel. It seems likely that lateral mobility in the IM is needed for this communication. However, there are no studies confirming the mobility of either lipids or proteins in the IM.

Earlier research by Wen (2020) showed that SpoVAEa-SGFP2 protein clusters were present in single spots in B. subtilis spores’ IM. This work also indicated that GRs remain in one location while SpoVAEa-SGFP2 spots move in the IM, and perhaps SpoVAEa movement alone is necessary for signal transduction with GRs. However, less is known about signal transduction in B. cereus spores. Research by Wang et al. (2020) showed that in

approximately a third of B. cereus spores, germinosomes can be visualized due to the fluorescence of GerRB-SGFP2 (Wang et al., 2020). Though, when the complete gerR operon was expressed approximately 85% of the spores contained a fluorescent spot. This apparent higher germinosome level can be explained due improved stability of one GR subunit when all GR subunits are present, as had been found in B. subtilis spores (UConn Health department of Molecular Biology and Biophysics, 2021; Krebs Institute department of Molecular Biology & Biotechnology, 2021). However, how GRs interact with SpoVA channel proteins and what role SpoVAEa plays in this interaction in B. cereus is unclear.

To ascertain how the SpoVA channel interacts with GRs, the mechanism of SpoVAEa spot formation in B. cereus spores must first be determined. Therefore, this thesis ascertains whether the channel protein SpoVAEa can be visualized and localized in B. cereus dormant spores.

(7)

7 Based on the results of Wang et al. 2020 that germinosomes can be visualized with the Nikon Eclipse Ti fluorescence microscope in B. cereus spores and the results of Wen (2020) that SpoVEa-SGFP2 protein spots are also visible with the Nikon Eclipse Ti fluorescence microscope in B. subtilis, it is likely that SpoVEa-SGFP2 protein clusters will be visible with the Nikon Eclipse Ti fluorescence microscope in B. cereus as well, especially since the characteristics of spore germination and sporulation appear very similar in all Bacillales species studied thus far.

This research focuses first on designing a B. cereus ATCC 14579 mutant strain expressing the SpoVAEa protein. Subsequently, this protein was fused with SGFP2. This fusion protein is constructed as a derivative of the low-copy-number pHT315 episomal plasmid and is expressed under the control of the native spoVA operon promoter (Arantes & Lereclus, 1991). Thereafter, this study aims to visualize the SpoVAEa protein in B. cereus dormant spores by using phase-contrast microscopy and the Nikon Eclipse Ti fluorescence

microscope. It is expected that the SpoVAEa-SGFP2 fusion protein clusters will be present in a single spot in B. cereus spores.

2. Materials and Methods

2.1 Bacterial Strains

The research of this thesis used E. coli DH5α competent cells and the E. coli (pSGFP2-C1) and the B. cereus ATCC 14579 strains. The growth of the E. coli DH5α strain was in

Lysogeny broth (LB) medium (5 g Yeast extract, 10 g Tryptone, 10 g NaCl, and 1000 mL MilliQ water) at an optimal temperature of 37 °C to an OD600 of 0.3-0.5. The E. coli

(pSGFP2-C1) strain was also grown in LB medium at 37°C. When necessary kanamycin was added at a concentration of 50 μg/mL. The B. cereus ATCC 14579 strain was grown in trypticase soy broth (TSB) medium (30 g tryptic soy broth and 1000 mL MilliQ water) at an optimal

temperature of 30 °C. When necessary, 100 μg/mL ampicillin and 10 μg/mL erythromycin were added.

2.2 Isolation of B. cereus ATCC 14579 genomic DNA to prepare a template

First, a single B. cereus ATCC 14579 colony was transferred into TSB medium and

incubated overnight at 30 °C and 200 rpm. Subsequently, the medium was centrifuged for 5 min at 12,000 rpm. For isolation of pure genomic DNA, the pellet was resuspended in

(8)

8 Resuspension Solution containing RNase A (ThermoFisher). Thereafter, lysozyme (Sigma Chemical Co.) was added to a concentration of 0.2 mg/ml and the mix incubated at 37 °C for 1 hour. The mix was heated at 60°C for 5 min and then 0.05 volume of 20% (wt/vol) of sodium dodecyl sulfate (SDS) solution was added (pre-warmed at 60°C). Afterward, an equal volume of phenol / chloroform / isoamyl alcohol (25:24:1) was added. After

centrifuging for 5 min at 12,000 rpm, the supernatant was transferred to a new tube. The last two steps were repeated once, and all supernatants pooled. Thereafter three volumes of absolute ethanol were added to the pooled supernatant and centrifuged for 10 min at 12,000 rpm. The pelleted genomic DNA was washed with 70%(v/v) ethanol. The solution was centrifuged for 5 min at 12,000 rpm and the genomic DNA was dried at room temperature for 10 min and dissolved in sterile Milli-Q water. To confirm the identity of the B. cereus ATCC 14579 genomic DNA template, a PCR was carried out using primers for the groEL gene (Chang et al., 2003).

2.3 Construction of plasmids pHT315-AEa-SGFP2 and pHT315-P_AEa-AEa-SGFP2 To extract the plasmid pSGFP2-C1 from the E. coli (pSGFP2-C1) strain, the MiniPrep Plasmid Kit (Thermo Scientific: #K0503) was used. The 549 bp long spoVAEa gene was PCR amplified from B. cereus ATCC 14579 genomic DNA using the primers AEa-Xba-Fw and AEa-fuFP-Rv (Table 1). Then, the 720 bp long SGFP2 region was amplified from plasmid pSGFP2-C1 using primers AEa-fuFP-Fw and FP-Rv. After gel purification, the DNA fragments of spoVAEa and SGFP2 were fused using fusion PCR and this fusion product was taken as a template for whole PCR amplification of the AEa-SGFP2 fusion fragment. In this step, the AEa-Xba-Fw and FP-Rv primers were used (Table 1).

Figure 2. Schematic overview of the constructed plasmids. Displayed are the plasmids pHT315 (A), pHT315-AEa-SGFP2 (B), and pHT315-P_AEa-pHT315-AEa-SGFP2 (C).

(9)

9 The purified DNA fusion fragment was sub-cloned resulting in plasmid pHT315-AEa-SGFP2 (Figure 2B) due to double digestion of plasmid pHT315 (Figure 2A) and fragment AEa-SGFP2 by fastdigest restriction enzymes Xba I (Thermo scientific: #FD0684) and Hind III (Thermo scientific: #FD0505). As a negative control for the ligation step, only the digested pHT315 vector was used. (Figure 2A).

Table 1. Primers with corresponding sequence and restriction sites for the construction of mutant strains. Gene Primer Sequence (5’-> 3’)

Promoter SpoVAEa P_AEa-Fw GGGGTACCGTTCTTATATGTTGGCGACTb Promoter SpoVAEa P_AEa-Rv CTCTAGACTTTCATTCACCCCTTCACc

SpoVAEa AEa-Xba-Fw GCTCTAGATTGGTCACAGATGGAGATc

SpoVAEa AEa-fuFP-Rv TCCTCGCCCTTGCTCACCATGCTGCCGCTGCCGCTGCCGGCTTCGTCA TAAAAACCA SGFP2 AEa-fuFP-Fw TGGTTTTTATGACGAAGCCGGCAGCGGCAGCGGCAGCATGGTGAGCA AGGGCGAGGA SGFP2 FP-Rv CCCAAGCTTTTACTTGTACAGCTCGTCCa 315seq-Fw ATGTTGTGTGGAATTGTGAG 315seq-Rv AAGGCGATTAAGTTGGGT

a. The underlined parts of the sequences are the restriction site of HindIII. b. The underlined parts of the sequences are the restriction site of Kpn I. c. The underlined parts of the sequences are the restriction site of Xba I.\

The 610 bp long promoter region (P_AEa) of the whole spoVA operon was PCR amplified from B. cereus ATCC 14579 genomic DNA using the primers P_AEa-Fw and P_AEa-Rv (Table 1). Subsequently, the plasmid pHT315-AEa-SGFP2 and PCR product P-AEa were double digested by restriction enzymes Kpn I (Thermo scientific: #FD0524) and Xba I. Thereafter, the purified P_AEa fragment was ligated into the digested pHT315-P_AEa-AEa-SGFP2 using T4 DNA ligase (Figure 2C). The transformation of DNA of the constructed plasmids into E. coli DH5α competent cells were confirmed by colony PCR and DNA

sequencing (Macrogen Europa). The primers 315-seq-Fw and 315-seq-Rv were used during colony PCR (Table 1).

(10)

10 2.4 Preparation of Electro-Competent cells

To prepare electro-competent cells, a culture of B. cereus ATCC 14579 was grown in TSB medium at 37

°

C and 200 rpm overnight. Then, the culture was diluted 1:100 in TSB medium and was grown at 37

°

C and 200 rpm to an OD600 of 0.2-0.3. To potentially improve the

transformation rate, 5% glycine was added, and growth was continued for additional 1 hour. To determine if glycine improved the transformation rate, it was only added to one culture. However, there was no difference in transformation rate between the two cultures.

Thereafter, the pellets were washed five times in electroporation buffer and the cells were suspended in electroporation buffer containing 250 mM sucrose, 10% glycerol, 1mM Hepes buffer (pH 7.0) and 1 mM MgCl2 (Turgeon et al., 2006)..

2.5 Electroporation

Via electroporation, the plasmid pHT315-P_AEa-AEa-SGFP2 was introduced into B. cereus ATCC 14579. First, 100 ng of the plasmid was added to the competent cells and incubated on ice for 5 minutes. Subsequently, the electroporation was carried out for 4 ms at 2 kV/ cm using the BioRAD micropulser. Then, TSB medium was immediately added and incubated at 37°C and 200 rpm for two hours. This mixture was plated on tryptic soy agar (peptone (15 g/L), soytone (5 g/L), sodium chloride (5 g/L) and, agar (15 g/L)) with 10 μg/mL erythromycin and incubated overnight at 30 °C. The transformation of DNA of plasmid pHT315-P_AEa-AEa-SGFP2 into B. cereus ATCC 14579 competent cells was confirmed by colony PCR using primers 315-seq-Fw and 315-seq-Rv (Table 1).

2.6 B. cereus sporulation

First, a single colony of B. cereus ATCC 14579 was incubated in 5 ml TSB medium and a single colony of the B. cereus strain with pHT315-P_AEa-AEa-SGFP2 was incubated in 5 ml TSB medium with 10 μg/mL erythromycin at 30 °C at 200 rpm overnight. Thereafter, 80 μl of the overnight culture was added to 8 ml TSB medium or TSB medium with 10 μg/mL

erythromycin and incubated at 30 °C and 200 rpm to an OD600 of 0.5-1. Subsequently, the

cells were centrifuged at 5000 rpm for 15 minutes at room temperature and the harvested cells were suspended in 10 ml CDGS medium (see below). The CDGS medium with 10 μg/mL erythromycin was used for the mutant B. cereus strain. The CDGS medium provided the B. cereus strains with an environment to sporulate.

The CDGS medium contained: 1 mM Ca(NO3)2·4H2O, 2.5 μM CoCl2·6H2O, 2.5 μM

(11)

11 2.5 μM CuCl2·2H2O, 50 μM FeCl3·6H2O, 1 mM acetic acid, 5 mM DL-lactate sodium (5.6M),

0.32 mM histidine, 0.47 mM methionine, 1.4 mM threonine, 2.6 mM valine, 6 mM L-Leucine, 20 mM L-glutamic acid, 10 mM D-glucose. Potassium phosphate buffer (100 mM) containing 100 mM K2HPO4 and 100 mM KH2PO4 was used to get the CDGS medium to a

pH of 7.2. The bacterial cells were transferred into 90 ml CDGS medium and simultaneously incubated and shaken at 30 °C and 200 rpm for 5 days.

Finally, the sporulation medium was centrifuged at 4 °C and 5000 rpm for 15 min and the harvested cells were suspended in 40 ml sterile phosphate buffered saline (PBS) pH7.4 (137 mM NaCl, 2.7 mM KCl, 0.01 M Na2HPO4 and 1.8 mM KH2PO4 ; AAT Bioquest Inc, 2020).

Thereafter, the spores were washed three times with PBS pH7.4 at 4 °C and 5000 rpm for 15 min. Finally, 5ml PBS pH7.4 was used to suspend the spores which stored at 4 °C. To determine the purity of the spores, they were viewed under phase contrast microscopy, the spores presented as phase bright spores.

2.7 Microscopy and image analysis

When preparing the microscope slides, 65 μl (1.5 cm * 1.6 cm) gene frames were used. The Nikon Eclipse Ti fluorescence microscope was used to visualize the dormant spores and to examine the expression of the fusion protein AEa-SGFP2. B. cereus ATCC 14579 was used as a control. The NIS elements software 4.51 was used and the images were captured with a PH3 channel exposure time of 300 ms and GFP channel exposure time of 2 seconds with 10% laser power. The microscope images were analyzed with ImageJ. ImageJ

SporeAnalyzer and ImageJ plugin ObjectJ were used to calculate the percentages of spores expressing SpoVAEa. GraphPad was used for the statistical analysis and a Mann-Whitney test was performed to measure the difference in integrated intensity.

(12)

12

3. Results

3.1 Confirmation of the transformation of DNA of plasmid pHT315-P_AEa-AEa-SGFP2 into E. coli DH5α competent cells and B. cereus ATCC 14579 by colony PCR

To confirm the transformation of DNA of plasmid pHT315-P_AEa-AEa-SGFP2 into E. coli DH5α competent cells and B. cereus ATCC 14579, colony PCR was performed. The length of fragment P_AEa-AEa-SGFP2 is 1915 bp. If the cells contained plasmid pHT315-P_AEa-AEa-SGFP2 then a PCR fragment was expected around 2045 bp, when using the primers 315-seq-Fw and 315-seq-Rv. These primers were also used to amplify SpoVAEA-SGFP2 (1269 bp), and if the cells contained plasmid pHT315-AEa-SpoVAEA-SGFP2 a PCR fragment of 1400 bp was expected.

Figure 3. Results of colony PCR using primers 315-seq-Fw and 315-sew-Rv. Confirmation that E. coli DH5α competent cells (A; lane 1) and B. cereus ATCC 14579 (B; lane 3, 4, and 6) contain the plasmid pHT315-P_AEa-AEa-SGFP2 (1915 bp).

In Figure 3A, there is a band of 2045 bp visible in lane 1 of the gel, which corresponds to the number of bp of fragment P_AEa-AEa-SGFP2 (1915 bp). The bands of 1400 bp visible in lane 3, 4, and 5 correspond to the number of bp of fragment AEa-SGFP2 (1269 bp) (Figure 3A). The PCR product P_AEa was not inserted into all digested pHT315-AEa-SGFP2 plasmids. Explanations for this could be that the sticky ends were not complementary

enough or there was not sufficient P_AEa to insert into the plasmid. Thus, the chance for this fragment to insert into the plasmid was lower. The lower amount of P_AEA could be

explained due low amplification efficiency probably because the length of the promoter used in this study is too long (610 bp).

(13)

13 In figure 3B, the bands of approximately 2200 bp visible in lane 3, 4, and 6 correspond to the number of bp of fragment P_AEa-AEa-SGFP2 (Figure 3B). The higher band in lane 5 could be explained due non-specific binding of the primers 315-seq-Fw and 315-seq-Rv. The primers possibly annealed more upstream of the correct binding site, therefore creating longer fragments. Explanations for the presence of fragment AEa-SGFP2 in lane 2 could be that the plasmid was not stable enough and therefore P_AEa was not inserted anymore. In addition, perhaps the plasmid could have been digested with restriction enzymes of B. cereus during transformation.

3.2 Sequence results

Figure 4. The sequence results of fragment P_AEa-AEa-SGFP2 (1E38PAA035_E4)compared to the reference DNA (P_AEa-AEa-SGFP2). The mutation at position 165 is a substitution from A into G and at position 200 there is also a substitution from A into G. Note that these positions are not the actual locations on plasmid pHT315-P_AEa-AEa-SGFP2.

To ensure that the constructed plasmid contained the right sequence, DNA sequencing (Macrogen Europa) was performed. A hundred percent match was expected if the plasmid DNA (1E38PAA035_E4) exactly matched the reference DNA (P_AEa-AEa-SGFP2). The sequencing results are given in figure 4. Two bases in the promoter region did not match the reference DNA. The first mutation at position 165 led to a substitution from A into G and at position 200 there is also a substitution from A into G. These mutations were not near the -10 and -35 sequences of the spoVA promoter, and also not near the SpoVAEa translation start site (Figure 5).

(14)

14

Figure 5. Schematic overview of the spoVA operon and the promoter region in B. cereus. The promoter region is shown in red and the position of the mutations are also given in red.

A possible explanation for the mutations in the promoter region is the use of Taq polymerase to amplify P_AEa-AEa-SGFP2, as Taq polymerase has a higher PCR bias than Herculase II fusion DNA polymerase (#600675)(Dabney & Meyer, 2012; Fazekas et al., 2010). However, Taq polymerase was used, as use of Herculase II fusion DNA polymerase led to no

amplification results (Figure 6A), due to its lower amplification efficiency compared to Taq polymerase (Figure 6B).

Figure 6. Displayed are the results of PCR from B. cereus genomic DNA using primers Fw and P_AEa-Rv. No amplification results of P_AEa with Herculase II fusion DNA polymerase (A). In Figure 6B the amplification results of P_AEa (610 bp) with the use of Taq polymerase are shown.

Another reason why the use of Herculase II fusion DNA polymerase did not lead to any results, is the use of a wrong primer. Research by Y. Wang showed that the spoVA operon promoter can be amplified with Herculase II fusion DNA polymerase when using a new forward primer: GGGGTACCTTGGAATTATGGGAACCCT. A third reason why the use of Herculase II fusion DNA polymerase did not lead to amplification of the promoter is that the Tm value used was not optimal for amplification (Wang, personal communication).

(15)

15 3.3 Visualization of SpoVAEa in B. cereus dormant spores

To visualize SpoVAEa in B. cereus dormant spores, the B. cereus ATCC 14579 mutant strain expressing the SpoVAEa protein fused with SGFP2 were constructed. As a control, the B. cereus ATCC 14579 wild-type was used. If the spores contained the SpoVAEa-SGFP2 fusion protein, a fluorescent spot would be expected. Based on the results of Wen (2020) that SpoVAEa-SGFP2 protein clusters were present in B. subtilis spores, it was expected to detect SpoVAEa-SGFP2 protein clusters in B. cereus spores as well. In figure 7D, some mutant spores contained a fluorescence spot, while the wild-type spores did not (Figure 7C). It is important to mention that the low fluorescence seen in figure 7C was probably due autofluorescence from spore coat proteins.

Figure 7. Displayed are the results of the fluorescence microscopy of SpoVAEa-SGFP2 in B. cereus spores. Figure 7A and 7B were taken with phase-contrast and figures 7C and 7D with the fluorescence microscopy. The spores carrying pHT315-P_AEa-AEa-SGFP2 (B and D) and wild-type spores (A and C) are shown. All images have the same magnification. Arrows in panel D denote bright fluorescent GFP spots.

A total of 8959 spores were analyzed in this study. The fluorescent spots were present in 7.1% of spores carrying the pHT315-P_AEa-AEa-SGFP2. To determine the values of fluorescence, the integrated intensity was measured (Figure 8). The integrated fluorescence

(16)

16 intensity from spores expressing SpoVAEa-SGFP2 was significantly higher than the wild-type spores (p < 0.0001) . Note the wide variation in integrated intensity in spores

expressing the SpoVAEa-SGFP2 protein, likely due to variations in the levels of the fusion protein between individual spores. The high integrated fluorescence intensity of some wild-type B. cereus spores could probably be explained due autofluorescence from spore coat proteins.

Figure 8. Statistical analysis of the integrated intensity of individual wild-type and mutant B. cereus spores. Mean integrated intensity of wild-type B. cereus spores was 43 and the median value was 26. For spores expressing SpoVAEa-SGFP2 the mean integrated intensity was 92 and the median value was 84. A Mann-Whitney test was performed to measure the significant difference (****p <0.0001).

4. Discussion

These results demonstrate that a SpoVAEa-SGFP2 fusion protein can be visualized and localized in B. cereus dormant spores. The results of cPCR of E. coli DH5α competent cells, suggest it is most likely that these cells contain pHT315-P_AEa-AEa-SGFP2, as the size of the fragment in the gel corresponds to the length of the fragment P_AEa-AEa-SGFP2. Furthermore, the results of cPCR of B. cereus ATCC 14579, suggest that colonies 3, 4, and 6 contain pHT315-P_AEa-AEa-SGFP2. The sequencing results confirm that the bacteria

(17)

17 contain the pHT315-P_AEa-AEa-SGFP2. However, the sequencing results also indicate that there are two mutations in the promoter region, and these could affect the function of the promoter. Because the mutations were in the promoter region, the function of protein AEa-SGFP2 would not be affected and thus could be localized in the IM. The visualization of AEa-SGFP2 in dormant spores using the Nikon Eclipse Ti fluorescence microscope showed that 7.1% of the spores contained a fluorescent spot.

In conclusion, the SpoVAEa protein was present as a fluorescent spot in 7.1 % of B. cereus dormant spores. This is in agreement with the results of Wen (2020) in which SpoVAEa protein foci were also present in B. subtilis spores. However, the percentage of B. cereus spores containing SpoVAEa spots might be underestimated. When analyzing the spores, it appeared that the distribution of the spores with AEa-SGFP2 protein clusters was not equal, and probably the majority of the images were taken of areas in which the spores did not contain SpoVAEa. Hence, it is suggested that the images were not representative for all spores. Second, the detection of fluorescent spots could be hampered by autofluorescence from spore coat proteins (Ghosh et al., 2008). However, for B. cereus spores the

autofluorescence seems to be less of a problem (Wang et al., 2020). Third, the spores could not make sufficient SpoVAEa. This could be due to the presence of the mutations in the promoter of the spoVA operon (Figure 4). Moreover, it could be that most of the spores contained few plasmid copies and therefore could not make sufficient SpoVAEa. This could be an explanation for the wide variation in integrated intensity in spores carrying pHT315-P_AEa-AEa-SGFP2 (Figure 8). Another explanation for the low amount of fluorescent spots is that the transcription of the whole operon was not efficient because the length of the promoter was too long (610bp) and this led to lower translation levels. Narrowing the region of the promoter of the whole spoVA operon down could possibly lead to more efficient transcription (Setlow, personal communication). Besides, the spoVAEa mRNA may be less translated than other spoVA mRNA (Perez-Valdespino et al., 2014). Lastly, it is possible that wild-type SpoVAEa competes more effectively than SpoVAEa-SGFP2 protein for binding to SpoVA channel (Setlow, personal communication).

Future research could conclude with certainty that the B. cereus dormant spores in this study contain the fusion protein AEa-SGFP2, by conducting a western blot. Furthermore, to ensure that AEa-SGFP2 is located in the membrane, the membrane should also be fluorescently labelled in future research. Another suggestion for further research is to monitor the dynamic

(18)

18 changes of SpoVAEa in sporulation and germinating B. cereus, as if this also shows that SpoVAEa-SGFP2 spots move in the IM like in B. subtilis, this will be a remarkable

observation (Wen, 2020). Namely, SpoVAEa is part of the SpoVA channel which is anchored in the IM suggesting it should show no movement (Cowan et al., 2004). If this is true then communication between immobile GRs in spores’ 1-3 germinosomes and immobile SpoVA proteins would seem difficult. Therefore, this should be analyzed in future research.

Moreover, to determine if the protein SpoVAEa-SGFP2 is functional, the release of CaDPA during germination should be detected and also a new strain of wild-type B. cereus without SpoVAEa could be grown. Lastly, to make SpoVAEa-SGFP2 compete more effectively with wild-type SpoVAEa, a stronger forespore-specific promoter has to be investigated (Setlow, personal communication).

Previous research by Wen (2020) showed that SpoVAEa can be visualized in B. subtilis. The results in this study support this for B. cereus. Research by Wang et al. (2020) also showed that GerRB-SGFP2 can be visualized in B. cereus when using the Nikon Eclipse Ti

fluorescence microscope and this study showed that the Nikon Eclipse Ti fluorescence microscope can be used to visualize SpoVAEa in B. cereus. However, the role of SpoVAEa and how GRs interact with SpoVA channel proteins in B. cereus is still not clear. Studies are now underway, including research by Y. Wang, examining possible signal transduction between GRs and SpoVAEa in B. cereus by using Fluorescence Resonance Energy Transfer (FRET). The results of this study could confirm the assumptions of Perez-Valdespino et al. (2014) and Vepachedu & Setlow (2007) that there is communication between SpoVA proteins and GRs.

In general, the results from this study can be used for further research on visualizing the communication between SpoVA proteins and GRs in B. cereus spores (Figure 1). Therefore, the results contribute to new knowledge about mechanisms of germination which may lead to new strategies to inactivate B. cereus spores. This is important to overcome food

poisoning and systemic disease in humans. However, these mechanisms have not yet been demonstrated in vivo and the exact molecular and biochemical structures are still not clear. Results of studies using FRET are promising to increase the knowledge of the relative locations of proteins in B. cereus (Wang, personal communication). As well, sporulation and germination processes can be further investigated with a new imaging technology such as annular rescan confocal microscopy (Breedijk et al., 2020).

(19)

19 To conclude, this study ascertained that SpoVA channel protein SpoVAEa can be visualized and localized in B. cereus dormant spores, and showed that 7.1% of spores contained SpoVAEa-SGFP2 protein clusters, and thus confirm the presence of clustered SpoVAEa in B. cereus spores.

(20)

20 References

AAT Bioquest, Inc. (2020, October 05). PBS (Phosphate Buffered Saline) (1X, pH 7.4).". Retrieved from https://www.aatbio.com/resources/buffer-preparations-and-recipes/pbs-phosphate-buffered-saline

Arantes, O., & Lereclus, D. (1991). Construction of cloning vectors for Bacillus

thuringiensis. Gene, 108(1), 115–119. https://doi.org/10.1016/0378-1119(91)90495-w

Beaman, T. C., & Gerhardt, P. (1986). Heat resistance of bacterial spores correlated with protoplast dehydration, mineralization, and thermal adaptation. Applied and environmental microbiology, 52(6), 1242–1246. https://doi.org/10.1128/AEM.52.6.1242-1246.1986

Bottone E. J. (2010). Bacillus cereus, a volatile human pathogen. Clinical microbiology reviews, 23(2), 382–398. https://doi.org/10.1128/CMR.00073-09

Breedijk, R., Wen, J., Krishnaswami, V., Bernas, T., Manders, E., Setlow, P., et al. (2020). A live-cell super-resolution technique demonstrated by imaging germinosomes in wild-type bacterial spores. Scientific reports, 10(1), 5312. https://doi.org/10.1038/s41598-020-62377-1

Chang, Y. H., Shangkuan, Y. H., Lin, H. C., & Liu, H. W. (2003). PCR assay of the groEL gene for detection and differentiation of Bacillus cereus group cells. Applied and

environmental microbiology, 69(8), 4502–4510. https://doi.org/10.1128/aem.69.8.4502-4510.2003

Christie, G., & Setlow, P. (2020). Bacillus spore germination: Knowns, unknowns and what we need to learn. Cellular signalling, 74, 109729.

https://doi.org/10.1016/j.cellsig.2020.109729

Cowan, A. E., Olivastro, E. M., Koppel, D. E., Loshon, C. A., Setlow, B., & Setlow, P. (2004). Lipids in the inner membrane of dormant spores of Bacillus species are largely

immobile. Proceedings of the National Academy of Sciences of the United States of America, 101(20), 7733–7738. https://doi.org/10.1073/pnas.0306859101

Dabney, J., & Meyer, M. (2012). Length and GC-biases during sequencing library

amplification: a comparison of various polymerase-buffer systems with ancient and modern DNA sequencing libraries. BioTechniques, 52(2), 87–94. https://doi.org/10.2144/000113809

(21)

21 Dauphin, L. A., Newton, B. R., Rasmussen, M. V., Meyer, R. F., & Bowen, M. D. (2008). Gamma irradiation can be used to inactivate Bacillus anthracis spores without compromising the sensitivity of diagnostic assays. Applied and environmental microbiology, 74(14), 4427– 4433. https://doi.org/10.1128/AEM.00557-08

De Lara, J., Fernández, P.S., Periago, P.M., Palop, A. (2002). Irradiation of spores of Bacillus cereus and Bacillus subtilis with electron beams. Innovative Food Science & Emerging Technologies, 3(4), 379-384. https://doi.org/10.1016/S1466-8564(02)00053-X Ehling-Schulz, M., Lereclus, D., & Koehler, T. M. (2019). The Bacillus

cereus Group: Bacillus Species with pathogenic potential. Microbiology spectrum, 7(3), 10.1128/microbiolspec.GPP3-0032-2018. https://doi.org/10.1128/microbiolspec.GPP3-0032-2018

Errington J. (1993). Bacillus subtilis sporulation: regulation of gene expression and control of morphogenesis. Microbiological reviews, 57(1), 1–33.

Fazekas, A., Steeves, R., & Newmaster, S. (2010). Improving sequencing quality from PCR products containing long mononucleotide repeats. BioTechniques, 48(4), 277–285.

https://doi.org/10.2144/000113369

Ghosh, S., Setlow, B., Wahome, P. G., Cowan, A. E., Plomp, M., Malkin, A. J., et al. (2008). Characterization of spores of Bacillus subtilis that lack most coat layers. Journal of

bacteriology, 190(20), 6741–6748. https://doi.org/10.1128/JB.00896-08

Gopal, N., Hill, C., Ross, P. R., Beresford, T. P., Fenelon, M. A., & Cotter, P. D. (2015). The Prevalence and control of Bacillus and related spore-forming bacteria in the dairy

industry. Frontiers in microbiology, 6, 1418. https://doi.org/10.3389/fmicb.2015.01418 Griffiths, K. K., Zhang, J., Cowan, A. E., Yu, J., & Setlow, P. (2011). Germination proteins in the inner membrane of dormant Bacillus subtilis spores colocalize in a discrete

cluster. Molecular microbiology, 81(4), 1061–1077. https://doi.org/10.1111/j.1365-2958.2011.07753.x

Jessberger, N., Dietrich, R., Granum, P. E., & Märtlbauer, E. (2020). The Bacillus cereus food infection as multifactorial process. Toxins, 12(11), 701.

(22)

22 Luu, S., Cruz-Mora, J., Setlow, B., Feeherry, F. E., Doona, C. J., & Setlow, P. (2015). The effects of heat activation on Bacillus spore germination, with nutrients or under high pressure, with or without various germination proteins. Applied and environmental microbiology, 81(8), 2927–2938. https://doi.org/10.1128/AEM.00193-15

Perez-Valdespino, A., Li, Y., Setlow, B., Ghosh, S., Pan, D., Korza, G., et al. (2014). Function of the SpoVAEa and SpoVAF proteins of Bacillus subtilis spores. Journal of bacteriology, 196(11), 2077–2088. https://doi.org/10.1128/JB.01546-14

Setlow, B., Melly, E., & Setlow, P. (2001). Properties of spores of Bacillus subtilis blocked at an intermediate stage in spore germination. Journal of bacteriology, 183(16), 4894–4899. https://doi.org/10.1128/JB.183.16.4894-4899.2001

Setlow P. (2001). Resistance of spores of Bacillus species to ultraviolet light. Environmental and molecular mutagenesis, 38(2-3), 97–104. https://doi.org/10.1002/em.1058

Setlow P. (2003). Spore germination. Current opinion in microbiology, 6(6), 550–556. https://doi.org/10.1016/j.mib.2003.10.001

Setlow P. (2006). Spores of Bacillus subtilis: their resistance to and killing by radiation, heat and chemicals. Journal of applied microbiology, 101(3), 514–525.

https://doi.org/10.1111/j.1365-2672.2005.02736.x

Setlow, P., Wang, S., & Li, Y. Q. (2017). Germination of spores of the orders Bacillales and Clostridiales. Annual review of microbiology, 71, 459–477. https://doi.org/10.1146/annurev-micro-090816-093558

Sinai, L., Rosenberg, A., Smith, Y., Segev, E., & Ben-Yehuda, S. (2015). The molecular timeline of a reviving bacterial spore. Molecular cell, 57(4), 695–707.

https://doi.org/10.1016/j.molcel.2014.12.019

Turgeon, N., Laflamme, C., Ho, J., & Duchaine, C. (2006). Elaboration of an electroporation protocol for Bacillus cereus ATCC 14579. Journal of microbiological methods, 67(3), 543– 548. https://doi.org/10.1016/j.mimet.2006.05.005

Vepachedu, V.R., Setlow, P. (2007). Analysis of interactions between nutrient germinant receptors and SpoVA proteins of Bacillus subtilis spores, FEMS Microbiology Letters,

(23)

23 Volume 274, Issue 1, September 2007, Pages 42–47,

https://doi.org/10.1111/j.1574-6968.2007.00807.x

Wang, Y., de Boer, R., Vischer, N., van Haastrecht, P., Setlow, P., & Brul, S. (2020).

Visualization of germination proteins in putative Bacillus cereus germinosomes. International journal of molecular sciences, 21(15), 5198. https://doi.org/10.3390/ijms21155198

Warda, A. K., Xiao, Y., Boekhorst, J., Wells-Bennik, M., Nierop Groot, M. N., & Abee, T. (2017). Analysis of germination capacity and Germinant Receptor (Sub)clusters of genome-sequenced Bacillus cereus environmental isolates and model strains. Applied and

environmental microbiology, 83(4), e02490-16. https://doi.org/10.1128/AEM.02490-16 Wen, J., (2020). Analysing and visualizing molecular events in bacterial spore germination. (Thesis). Universiteit van Amsterdam, Amsterdam.

Visualization of channel protein SpoVAEa in Bacillus cereus dormant spores