UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl)
Microparticles: mediators of cellular and environmental homeostasis
Böing, A.N.
Publication date
2011
Link to publication
Citation for published version (APA):
Böing, A. N. (2011). Microparticles: mediators of cellular and environmental homeostasis.
General rights
It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons).
Disclaimer/Complaints regulations
If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible.
Chapter 3
Active caspase-3 is removed from cells by
sorting into microparticles
Anita N. Böing, Jan Stap, Chi M. Hau, Gijs B. Afink, Carrie Ris-Stalpers, Eric A. Reits, Cornelis J.F. van Noorden, Auguste Sturk and Rienk Nieuwland
Abstract
Introduction. Caspase-3, one of the main cytosolic executioner enzymes of apoptosis, is
present in microparticles released from cultured cells and in microparticles isolated from human plasma. We investigated whether caspase-3 is required for the release of microparticles, and whether active caspase-3 is sorted into these microparticles.
Methods. MCF-7 cells, a human breast cancer cell line deficient of caspase-3 and
membrane blebbing, were transfected with cDNA constructs encoding the 29 kDa form of caspase-3 untagged or tagged with EGFP at the C-terminus. The release of microparticles, and the presence of caspase-3 antigen and activity in microparticles were studied.
Results. Expression of caspase-3 resulted in a 5 - 15-fold increase in the release of
microparticles, compared to EGFP transfected- and untransfected- cells, respectively. Furthermore, active caspase-3 was present in the released microparticles, and active caspase-3 was about 10-fold enriched in microparticles compared to the caspase-3-transfected cells. When caspase-3-enriched microparticles were added to non-caspase-3-transfected MCF-7 cells, the microparticles were taken up, but the cells did not become apoptotic.
Conclusion. Caspase-3 triggers the release of active caspase-3-enriched microparticles,
3
Introduction
Caspase-3 is one of the major executioner enzymes of the apoptotic cascade. In human cells, it is present as a proenzyme, 32 kDa procaspase-3. Upon activation of the apoptotic cascade, procaspase-3 is cleaved by either active caspase-8 or caspase-9. This cleavage results in formation of 20 kDa and 12 kDa fragments. Subsequently, the prodomain is removed from the 20 kDa fragment by autocleavage, resulting in 3 kDa and 17 kDa fragments. The active form of caspase-3 consists of two 17 kDa and two 12 kDa subunits (Figure 1A)1.
In 1998, caspase-3 was shown to be required for morphological changes associated with apoptosis, such as membrane blebbing2. Thereafter, the association between caspase-3 and membrane blebbing was partially elucidated by the finding that caspase-3 cleaves various kinases, including Rho-associated coiled coil kinase 1 (ROCK1), which becomes constitutively active after cleavage, resulting in a net increase of myosin light chain phosphorylation and membrane blebbing3;4. Although the relationship between caspase-3 activity and membrane blebbing has been well established, the association of caspase-3 with the actual shedding (release) of membrane vesicles is unclear.
Microparticles are membrane vesicles with a diameter of 100 nm - 1 µm which are present in culture media of a diversity of cells, but also in body fluids like blood, saliva, liquor and synovial fluid. Microparticles are present in physiological circumstances as well as pathological circumstances. The numbers of microparticles, their cellular origin, composition and function, however, are disease and disease state dependent. Microparticles are best known for their procoagulant properties5-10, but can also affect inflammation11-16 and angiogenesis17-19.The reason why cells release microparticles, has been less studied.
Previously, we reported that caspase-3 is present in microparticles from viable cultured endothelial cells20 and that these cells do not become apoptotic in the presence of the cholesterol-lowering compound simvastatin whereas the release of caspase-3-containing microparticles increased 2 - 3-fold21. Furthermore, caspase-3 accumulated in endothelial cells when microparticle release of the cells was inhibited, and resulted in increased cell death22. These findings indicate that the release of caspase-3-containing microparticles may counteract cellular stress and may contribute to cellular homeostasis. Finally, we
demonstrated that caspase-3 was also present in microparticles in plasma from healthy individuals20, suggesting a common mechanism.
Although these studies show that caspase-3 is present in microparticles, it is not clear whether caspase-3 induces the release of microparticles and whether these microparticles are enriched in caspase-3 activity compared to cells. Therefore, we investigated in the present study whether the presence of intracellular caspase-3 induces the release of microparticles, whether active caspase-3 is specifically sorted into microparticles, and whether these caspase-3-containing microparticles are harmful for other cells.
Materials and Methods
Human caspase-3 expression vectors
The caspase-3 open reading frame was amplified from the preprocaspase-3 clone IOH11204 (Invitrogen, Carlsbad, CA) using a 5’primer GGGGACAAGTTTGTACAAA AAAGCAGGCTCCACCATGTCTGGAATATCCCTGGACAAC, and either a 3’primer GGGGACCACTTTGTACAAGAAAGCTGGGTTCTAGTGATAAAAATAGAGTTCTTT TGT (with stop codon) or GGGGACCACTTTGTACAAGAAAGCTGGGTTGTAGTG ATAAAAATAGAGTTCTTTTGT (without stop codon). Using Gateway technology (Invitrogen)23;24, the resulting PCR fragments were shuttled via pDON/Zeo (Invitrogen), into pEGFP-N3 (Clontech, Mountain View, CA). The resulting transfection vectors express the 29 kDa caspase-3 protein, or the 29 kDa caspase-3-protein tagged with EGFP at the C-terminus (29EGFP) under control of the CMV promoter (Figure 1B).
Transfection of MCF-7 cells
MCF-7 cells were a gift from the Hubrecht Laboratory (Utrecht, The Netherlands). MCF-7 cells were selected since they lack the procaspase-3 protein due to a 125 bp deletion in exon 3 of the caspase-3 gene. This deletion leads to a frameshift starting at codon 18 which results in a stopcodon at codon 412. Cells were cultured in DMEM F12 (Invitrogen) supplemented with 7.5% fetal calf serum (FCS; PAA, Pasching, Austria), non-essential amino acids (Invitrogen), penicillin (10 units/mL; Invitrogen) and streptomycin (10 µg/mL; Invitrogen) for two days before transfection. Transfection was performed with 1 µg DNA,
3
using Fugene-6 (3 µL; Roche, Mannheim, Germany) according to the manufacturer’sinstructions.
Figure 1. Schematic representation of procaspase-3 and the used constructs.
A. Schematic representation of procaspase-3 before cleavage, after cleavage by caspase-8 or caspase-9, and after autocleavage. B. Schematic representation of proteins expressed by the constructs used: 29 kDa caspase-3 (29 kDa) and a fusion product of 29 kDa caspase-3 with EGFP (29EGFP). caspase-8 / 9 autocleavage 3 17 12 3 17 12 active caspase-3 17 17 12 12 3 17 12 N C
Wild type procaspase-3
large subunit small subunit
A
29 kDa + EGFP (29EGFP)
17 12
17 12 EGFP
29 kDa pEGFP-N3 cDNA expression constructs
B caspase-8 / 9 autocleavage 3 17 12 3 3 17 12 active caspase-3 17 17 12 12 3 17 12 N 3 17 12 C N C
Wild type procaspase-3
large subunit small subunit
A
29 kDa + EGFP (29EGFP)
17 12
17 12 EGFP
29 kDa pEGFP-N3 cDNA expression constructs
29 kDa + EGFP (29EGFP)
17 12
17 12
17 12 EGFP
29 kDa pEGFP-N3 cDNA expression constructs
Live cell imaging
Visualization of microparticle release
To visualize the release of microparticles, live cell imaging was performed as described previously25. MCF-7 cells (15,000) were plated in glass-bottom dishes (Lab-Tek II chambered cover glass; Nunc, Roskilde, Denmark). Cells were incubated for 2 days at 37 ºC in an atmosphere containing 5 % CO2, and subsequently transfected with the expression vector encoding the 29EGFP protein. After transfection for 24 h, the culture medium above the cells was layered with mineral oil (M3516; Sigma, St. Louis, MO) to prevent evaporation of the medium. The glass-bottom dish was placed under an inverted fluorescence DM IRBE microscope (Leica Microsystems, Wetzlar, Germany), equipped with a Plan Apo 63x/1.40 oil objective and a cooled CCD camera (type 2000s; PCO AG, Kelheim, Germany). Cells were imaged for 5 h at 37 ºC in an atmosphere containing 5% CO2. A phase contrast image was made every 5 or 20 seconds, depending on the experiment. Fluorescence images were made only at the start of the experiment to monitor expression of 29EGFP, since repeated use of excitation light results in phototoxity, which may induce cellular apoptosis. Furthermore, the presence of EGFP reflects only expression of 29EGFP, but not the cleavage into active caspase-3. Time lapse movies were analyzed using custom-made software and microparticles were visible as moving little black dots. Quantification of microparticles released from 29EGFP-expressing cells
Live cell imaging was also used to quantify the numbers of released microparticles. MCF-7 cells were cultured in glass-bottom dishes and transfected with the expression construct encoding the 29EGFP protein. In parallel experiments, cells were either mock transfected (only EGFP) or not transfected. After transfection (4 h), cells were layered with mineral oil and imaged for 48 h. Phase contrast images were acquired at time intervals of 5 min and fluorescence images at time intervals of 60 min to monitor expression of 29EGFP. Time lapse movies were analyzed using custom-made software and the released microparticles were counted during the entire experiment. In the time-lapse movies, microparticles were transiently visible as little black dots near the cell membrane.
3
MCF-7 cells and isolation of microparticles from cell-conditioned culture supernatant
MCF-7 cells (45,000) were cultured in 6-wells plates and transfected as described above with expression constructs encoding either the 29 kDa caspase-3 protein, 29EGFP protein or EGFP protein. Untransfected cells were used as control. After 48 h, cells were harvested after trypsinization and washed (10 min and 180xg) using PBS containing 1% FCS. At 48 h after transfection, culture supernatants were harvested and centrifuged for 10 min at 180xg to remove detached cells. Microparticles were isolated from cell-free supernatant by centrifugation at 18,890xg. Microparticles were washed once and used for the various assays.
Flow cytometry of microparticles
To estimate the number of microparticles, they were isolated from cell-free culture supernatant (250 µL) by centrifugation (30 min at 18,890xg). After centrifugation, microparticle-free supernatant was removed (225 µL) and microparticles were resuspended in PBS-containing citrate 0.32% (225 µL) to avoid clumping. After washing at 18,890xg for 30 min, microparticle-free supernatant was removed (225 µL) and microparticles were resuspended in the remaining fluid. Thereafter, microparticles (5 µL) were added to a mixture of PBS-containing 2.5 mmol/L calcium chloride (35 µL) and allophycocyanin (APC)-labelled annexin V (5 µL; Caltag Medsystems, Buckingham, UK) and were incubated for 15 min at room temp. Thereafter, PBS-containing calcium chloride (300 µL) was added and microparticles were counted on a FACSCalibur (Becton Dickinson; San Jose, CA) for one minute and analyzed with CellQuestTM pro software (version 4.02, Becton Dickinson). To estimate the number of released microparticles, we measured the flow rate in µL/min for each experiment and used the following formula: numbers of microparticles/well = counted numbers annexin V-positive microparticles x (350 µl/ flow rate in µL per min) x (25 µL/5µL) x (2000 µL culture medium per well/ 250 µL).
For detection of intravesicular caspase-3, microparticles were isolated from cell-free culture supernatant (250 µL) by centrifugation (30 min 18,890xg). After centrifugation, microparticle-free supernatant was removed (225 µL) and microparticles were washed in 0.1% permwash (225 µL; Becton Dickinson) by centrifugation at 18,890xg for 30 min. Then, the microparticle-free supernatant was removed and microparticles were resuspended
in the remaining fluid. Microparticles (5 µL) were added to a mixture of permwash-containing 2.5 mmol/L calcium chloride (35 µL), APC-labelled annexin V (5 µL) and phycoerythrin (PE)-labelled anti-caspase-3 (Becton Dickinson), and incubated for 30 min at room temp. After incubation, permwash (300 µL)-containing 2.5 mmol/L calcium chloride was added and samples were analyzed on a FACSCalibur for one minute.
Caspase-3 activity assay
To measure intracellular caspase-3 activity, MCF-7 cells (600,000) were washed once with PBS and lysed in cell lysis buffer (Calbiochem, San Diego, CA; 60 µL) for 5 min at 4 °C before 3 freeze/thaw cycles in liquid nitrogen and at 37 °C, respectively. Then, lysates were centrifuged for 10 min at 10,000xg and supernatants were used to measure caspase-3 activity. Caspase-3 activity was determined by using the chromogenic substrate Ac-DEVD-pNA (Calbiochem) in the presence and absence of the caspase-3 inhibitor Ac-DEVD-CHO (Calbiochem). The absorbance at 405 nm was measured for 90 min with time intervals of 5 min, as developed by Barrett et al26 and Du et al27, and as described by the manufacturer. To calculate the caspase-3 activity in the samples, a conversion factor of the plate reader was used. The conversion factor was determined by measuring the absorbance of 50 µM ρ-nitroaniline at 405 nm, and calculated as ratio of the concentration of ρ-ρ-nitroaniline and absorbance. To calculate the caspase-3 activity in samples in pmol/min, first the absorbance generated in time in the presence of Ac-DEVD-CHO was subtracted from the absorbance generated in its absence. Second, the net increase in absorbance was divided by the measuring time (90 min). Thereafter, the formula described by the manufacturer was used: net increase in absorbance/min x conversion factor x assay volume (µL). The caspase-3 activity in pmol/min was expressed per µg protein as determined by the Coomassie brilliant blue assay (Pierce, Rockford, IL).
To measure intravesicular caspase-3 activity, 2 x 1 mL cell-free culture supernatant was centrifuged for 1 h at 18,890xg. Microparticles were pooled and washed once in 1 mL PBS. Thereafter, 990 µL supernatant was removed and microparticles were resuspended in 50 µL cell lysis buffer followed by measurement of caspase-3 activity using the same procedure as described for cells.
3
Western blot
Human umbilical vein endothelial cells (HUVEC) were used as positive control. HUVEC were cultured and prepared for Western blot as described previously22. MCF-7 cells were washed once in PBS and resuspended in sample buffer (125 mM TRIS-Base, 8 M ureum, 4 % SDS, and 6% β-mercapthoethanol (reducing sample buffer; 4,000 cells/µL)). Microparticles were isolated from 2 x 1 mL cell-free culture supernatant by centrifugation at 18,890xg for 1 h, pooled and washed once in PBS. Then microparticles were resuspended in 25 µL reducing sample buffer. All samples were boiled for 5 min. Samples (15 µL) were loaded on an 8-16% gradient gel (Biorad, Hercules, CA) and blotted to Polyvinylidene Difluoride (PVDF) membrane (Millipore, Billerica, MA). Membranes were incubated with 5% protifar (Nutricia, Vienna, Austria) in TRIS buffered saline with 0.005% Tween (Merck, Darmstadt, Germany) for 1 h to reduce non-specific staining, followed by incubation with a mouse anti-human caspase-3 antibody (clone 31A1067; Alexis Biochemicals, San Diego, CA; recognizing 29 kDa- and 17 kDa caspase-3) or a mouse anti-human-GFP-horseradish peroxidise-labelled antibody (Miltenyi Biotec, Bergisch Gladbach, Germany). For blots incubated with caspase-3 antibody, a secondary antibody goat-anti-mouse-horseradish peroxidase (1:30,000; Dako, Glostrup, Denmark) was used. To visualize the bands, membranes were incubated with a 5-fold diluted peroxidase substrate (LumiLight; Roche Diagnostics, Almere, The Netherlands) for 5 min, followed by analysis of luminescence using a LAS3000 luminescent image analyzer (Fuji, Valhalla, NY).
Addition of caspase-3-containing microparticles to MCF-7 cells
MCF-7 cells were cultured and transfected with expression constructs encoding EGFP, 29 kDa caspase-3 or 29EGFP as described above except for the removal of the transfection medium after 5 h of transfection and washing the cells once with PBS before addition of fresh culture medium to ensure that the fugene/DNA mixture was completely removed. Untransfected cells were used as control. After 42 h, the conditioned culture supernatant was harvested and detached cells were removed by centrifugation (10 min 180xg). Microparticles (5 aliquots of 1 ml) were isolated from cell-free culture supernatant by centrifugation (18.890xg, 1 h, 4 °C). Microparticle-free supernatant (975 µL) was removed and used as control. Microparticle pellets were resuspended in the remaining 25 µL.
Microparticles of one pellet were used directly and the other microparticle-pellets (4 x 25 µL) were pooled and concentrated to 25 µL by centrifugation (30 min, 18,890xg, 4 °C).
Two days before addition of microparticles, MCF-7 cells were cultured in a 12-wells plate. Before addition of microparticles, culture medium was replaced by fresh culture medium and thereafter, the indicated microparticle-free supernatants (25 µL), or microparticles (25 µL) were added. After 48 h, adherent cells and detached cells were harvested. Cell numbers were counted and EGFP fluorescence was measured using a FACSCalibur (Becton Dickinson). Cells were labelled with annexin V-APC (Becton Dickinson) and propidium iodide (Invitrogen) as described before22. Cells were also labelled with anti-caspase-3-PE (Becton Dickinson)22.
Statistical analysis
All data were analyzed with GraphPad Prism for Windows, release 5 (Prism, San Diego, CA). Data from all experiments were analyzed with unpaired t tests (one tailed) and values are expressed as mean ± SD.
Results
Expression of caspase-3 by MCF-7 cells
The nucleotide sequence of the 29 kDa caspase-3 cDNA constructs, either untagged (29 kDa caspase-3) or tagged with the EGFP sequence at the 3’end (29EGFP), was identical to procaspase-3 mRNA (NM_004346.3; National Center for Biotechnology Information) without the prodomain (nucleotides 1-85). Twenty nine kDa caspase-3 activates itself by autocleavage, resulting in 17 kDa and 12 kDa caspase-3 fragments28.
After transfection of the cells, we first determined the transfection efficiency by measuring the percentage of EGFP-positive cells by flow cytometry. The transfection efficiency ranged between 50% and 60% (data not shown). Thereafter, we studied the expression of 29 kDa caspase-3 or 29EGFP by Western blotting using antibodies against caspase-3 and GFP. Figure 2A provides a schematic overview of the various products detectable by the antibodies used. Anti-caspase-3 can identify 29EGFP (57 kDa), 29 kDa caspase-3 (29 kDa), and 17 kDa caspase-3 (17 kDa), whereas anti-GFP can identify 29EGFP (57 kDa), 12EGFP (40 kDa) and EGFP (28 kDa).
3
Lysates from untransfected and EGFP-transfected cells contained no caspase-3,whereas after transfection with 29 kDa caspase-3, a distinct 29 kDa band was visible, indicating expression of the construct (Figure 2B). In the experiment shown, the 17 kDa band was below the detection limit, but in some experiments there was a faint 17 kDa band visible indicating autocleavage of 29 kDa caspase-3 within the cell (data not shown). Furthermore, two non-specific bands of approximately 45 kDa and 55-60 kDa where present in all MCF-7 cell lysates. The 45 kDa band may represent caspase-9, since there is homology in amino acid sequence between caspase-3 and caspase-9. The 55-60 kDa band may represent IgG.
After transfection with 29EGFP, bands of 57 kDa, ~31 kDa and 17 kDa were stained with the anti-caspase-3 antibody (Figure 2B). The major band at 57 kDa was the expected fusion product of 29 kDa caspase-3 and EGFP, which was confirmed when the blot was incubated with an antibody against GFP. The band at ~31 kDa represents most likely an unexpected cleavage product of 29 kDa caspase-3-EGFP. Since this band was absent when the blot was incubated with an antibody against GFP, the EGFP was probably partially cleaved from the 29EGFP after translation. The presence of the 17 kDa caspase-3 fragment indicates that autocleavage occurs within the cells. We also studied the cleavage of 29EGFP with an antibody against GFP, since cleavage of 29EGFP results in a fusion protein of the 12 kDa caspase-3 fragment and EGFP with an expected size of 40 kDa. Indeed, after incubation with anti-GFP, a band of approximately 40 kDa was present. These data indicate that the 29EGFP was cleaved into 17 kDa and 12 kDa-EGFP fragments (40 kDa).
As positive control, HUVEC were used. This cell lysate showed an expected procaspase-3 band of approximately 32 kDa.
Figure 2. Expression of caspase-3 by MCF-7 cells.
A. Schematic representation of the expression and cleavage products recognized by anti-caspase-3 or anti-GFP. B. Western blot incubated with anti-caspase-3 antibody or anti-GFP antibody showing the expression of caspase-3 and EGFP in untransfected and transfected MCF-7 cells. Cells were transfected with EGFP, or transfected with either cDNA encoding 29 kDa caspase-3 (29 kDa) or 29EGFP. Procaspase-3 (32 kDa) from human umbilical vein endothelial cells was used as positive control. Western blot incubated with anti-GFP antibody shows the full length 29EGFP (57 kDa) and a cleavage product of 29EGFP, the 40 kDa 12 kDa-EGFP fragment.
A
Anti-caspase-3
Anti-GFP
17 12 EGFP 57 kDa,
Small subunit of caspase-3 + EGFP 40 kDa, 12 EGFP 28 kDa, EGFP 57 kDa, 17 12 EGFP 29EGFP 29 kDa, 17 12 29 kDa caspase-3
17 17 kDa, Large subunit of caspase-3
29EGFP EGFP 17 A Anti-caspase-3 Anti-GFP 17 12 EGFP 57 kDa,
Small subunit of caspase-3 + EGFP 40 kDa, 12 EGFP 28 kDa, EGFP 57 kDa, 17 12 EGFP 57 kDa, 17 12 EGFP 29EGFP 29 kDa, 17 12 29 kDa caspase-3
17 17 kDa, Large subunit of caspase-3
29EGFP EGFP 17 P roc a s pas e 3 ( H U V E C ) 40 kDa 57 kDa 29 kDa 17 kDa Anti-GFP U n tr a n sf e c te d EG F P 29 k D a 29E G F P Anti-caspase-3 29 E G F P 10 15 20 25 37 50 75 Ma rk e r B P roc a s pas e 3 ( H U V E C ) 40 kDa 57 kDa 29 kDa 17 kDa Anti-GFP U n tr a n sf e c te d EG F P 29 k D a 29E G F P Anti-caspase-3 29 E G F P 10 15 20 25 37 50 75 Ma rk e r B Anti-GFP U n tr a n sf e c te d EG F P 29 k D a 29E G F P Anti-caspase-3 29 E G F P 10 15 20 25 37 50 75 Ma rk e r B
3
Release of microparticles from caspase-3-transfected cells
One of the well-established features of MCF-7 cells is the absence of membrane blebbing2, but whether or not these cells release microparticles is unknown. Therefore, we first studied and visualized microparticle release from 29EGFP-expressing MCF-7 cells using live cell imaging. Figure 3A-D and 3E-G show the release of a microparticle from two different 29EGFP-expressing cells. In Figure 3A-D, a phase contrast image was made every 20 seconds, showing the formation of a microparticle within a membrane ruffle (A), just before release of the microparticle (B), the release of the microparticle (C) and the released microparticle (D). In Figures 3E-G, a phase contrast image was made every 5 seconds, showing a microparticle at the cell membrane (E), the release of the microparticle (F) and the released microparticle (G). Subsequently, we quantified microparticle release (Figure 3H). Numbers of released microparticles were determined using live cell imaging during a 48 h experiment in which every 5 min a phase contrast image was made. Untransfected cells and EGFP-transfected cells hardly released microparticles. When the cells expressed 29EGFP, the number of released microparticles increased 4 - 8-fold, compared to EGFP-expressing cells or untransfected cells, respectively. These data indicate that expression of caspase-3 resulted in the actual release of microparticles.
Figure 3. Release of microparticles from caspase-3-transfected cells.
A-G. Microparticle release (arrows) from 29EGFP-expressing cells (A-D and E-G) was visualized and studied with live cell imaging. A phase contrast image was made every 20 s (A-D) or every 5 s (E-G). A. A microparticle is formed in a membrane ruffle. B. The microparticle is almost released from the membrane. C. Release of the microparticle. D. The released microparticle has moved out of focus. E. A microparticle is formed at the cell membrane. F. Release of the microparticle. G. The microparticle is released.
A B C D
E F G
A B C D
E F G
3
Figure 3. Release of microparticles from caspase-3-transfected cells, continued.
H. Quantification of the number of microparticles released from 29EGFP-expressing MCF-7 cells (n=22). Untransfected and EGFP-transfected MCF-7 cells (n= 9 and n=6, respectively) were used as controls. Error bars represent SDs. I. The number of microparticles released from 29 kDa expressing- and 29EGFP-expressing MCF-7 cells (n=5 and n=6, respectively) was determined by annexin V fluorescence using flow cytometry. Untransfected (n=4) and EGFP-transfected cells (n=8) were used as controls. Error bars represent SD. P-values shown represent statistical differences between EGFP and 29 kDa, and EGFP and 29EGFP, respectively.
To confirm the live cell image data, we also determined the number of released microparticles after 48 h from untransfected cells and cells transfected with cDNA encoding EGFP, 29 kDa caspase-3 or 29EGFP using flow cytometry. As shown in Figure 3I, untransfected cells and EGFP-expressing cells hardly released microparticles. In contrast, when cells expressed either 29 kDa caspase-3 or 29EGFP, the numbers of released microparticles increased approximately 5-fold in comparison to EGFP-transfected cells.
Taken together, expression of caspase-3 by MCF-7 cells is associated with the release of microparticles.
Presence of active caspase-3 in microparticles
To investigate the presence of the active form of caspase-3 in microparticles, we performed Western blotting (Figure 4A). Microparticles from both 29 kDa caspase-3- and 29EGFP-expressing cells contained 17 kDa caspase-3, whereas the uncleaved 29EGFP fusion
P=0.0021 H Unt rans fe c ted EG FP 29E GFP 0 2 4 6 N u m ber o f m icro p a rti cl es /cel l/ ho u r I P= 0.0053 Unt rans fe c ted EG FP 29 k D a 29E GFP 0 500000 1000000 N u mb e r of mi c rop ar ti c le s P=0.0034 P=0.0021 H Unt rans fe c ted EG FP 29E GFP 0 2 4 6 N u m ber o f m icro p a rti cl es /cel l/ ho u r I P= 0.0053 Unt rans fe c ted EG FP 29 k D a 29E GFP 0 500000 1000000 N u mb e r of mi c rop ar ti c le s P=0.0034
product (57 kDa) was also present in low amounts in microparticles from 29EGFP-expressing cells. In contrast, caspase-3 was absent or below the detection limit in microparticles from untransfected- or EGFP-transfected cells. Furthermore, microparticles from 29EGFP-expressing cells also contained the caspase-3 cleavage product 12 kDa-EGFP (40 kDa), as was shown by incubation with anti-GFP.
Since Western blots only show that caspase-3 is present in microparticles but do not provide information on the presence of caspase-3 in individual microparticles, we studied caspase-3 in individual microparticles with flow cytometry by using a PE-labelled antibody directed against active caspase-3. Of the microparticles from cells expressing 29 kDa caspase-3 or 29EGFP 55% and 51% contained active caspase-3, respectively, as compared to a “background” of 3% and 11% of microparticles from untransfected cells or EGFP-transfected cells, respectively (Figure 4B).
Since microparticles from 29 kDa caspase-3- and 29EGFP-expressing cells contained the active form of caspase-3, we compared the caspase-3 activity in cells and their corresponding microparticles. In untransfected cells or EGFP-transfected cells and their microparticles, caspase-3 activity was low or absent. In contrast, the caspase-3 activity/µg total protein in microparticles from 29 kDa caspase-3 or 29EGFP was 6 - 11-fold higher than in the corresponding cells (Figure 5). Thus, microparticles are enriched in caspase-3 activity compared to cells, indicating sorting of active caspase-3 into microparticles.
3
Figure 4. Active caspase-3 in microparticles.
A. The presence of active caspase-3 in microparticles released from untransfected cells, EGFP-expressing cells, 29 kDa-EGFP-expressing cells (29 kDa) or 29EGFP-EGFP-expressing cells was determined using Western blots. Blots were incubated with anti-caspase-3 or anti-GFP. B. Active caspase-3 in individual microparticles released from untransfected cells (n=5), EGFP- (n=5), 29 kDa- (n=5) and 29EGFP-expressing cells (n=5) was analyzed by flow cytometry using anti-active-caspase-3 antibody, and expressed as percentage positive microparticles (%). Error bars represent SD. P-values represent statistical differences between EGFP and 29 kDa, and EGFP and 29EGFP, respectively. B P=0.0003 P=0.0001 U n tr a n sfe c te d EGFP 29 kDa 29 E G F P 0 20 40 60 80 Ca s p as e-3 p o s it v e m ic ro par ti c le s (% ) A 40 kDa 57 kDa 17 kDa 29 E G F P 29 E G F P Anti-caspase-3 Anti-GFP U n tr a n sf e c te d EGFP 29 k D a Ma rk e r 10 15 20 25 37 50 75 B P=0.0003 P=0.0001 U n tr a n sfe c te d EGFP 29 kDa 29 E G F P 0 20 40 60 80 Ca s p as e-3 p o s it v e m ic ro par ti c le s (% ) A B P=0.0003 P=0.0001 U n tr a n sfe c te d EGFP 29 kDa 29 E G F P 0 20 40 60 80 Ca s p as e-3 p o s it v e m ic ro par ti c le s (% ) B P=0.0003 P=0.0001 U n tr a n sfe c te d EGFP 29 kDa 29 E G F P 0 20 40 60 80 Ca s p as e-3 p o s it v e m ic ro par ti c le s (% ) P=0.0003 P=0.0001 U n tr a n sfe c te d EGFP 29 kDa 29 E G F P 0 20 40 60 80 Ca s p as e-3 p o s it v e m ic ro par ti c le s (% ) A 40 kDa 57 kDa 17 kDa 29 E G F P 29 E G F P Anti-caspase-3 Anti-GFP U n tr a n sf e c te d EGFP 29 k D a Ma rk e r 10 15 20 25 37 50 75 40 kDa 57 kDa 17 kDa 29 E G F P 29 E G F P Anti-caspase-3 Anti-GFP U n tr a n sf e c te d EGFP 29 k D a Ma rk e r 10 15 20 25 37 50 75 29 E G F P 29 E G F P Anti-caspase-3 Anti-GFP U n tr a n sf e c te d EGFP 29 k D a Ma rk e r 10 15 20 25 37 50 75
Figure 5. Enrichment of active caspase-3 in microparticles.
Caspase-3 activity was determined in untransfected cells (Untransf. n=3), EGFP- (n=5), 29 kDa- (n=4) and 29EGFP-expressing cells (n=5) and their microparticles (MP) and was expressed as pmol/min/µg protein. Error bars represent SDs. P-values represent statistical differences between cells and microparticles.
Untransf.
cells MP cells MP cells MP cells MP
0 5 10 15 C a s p a se -3 ac tiv it y (p m o l/ m in/µ g p rote in)
EGFP 29 kDa 29EGFP
P=0.220 P=0.0479
P=0. 009
P=0. 0004
Untransf.
cells MP cells MP cells MP cells MP
0 5 10 15 C a s p a se -3 ac tiv it y (p m o l/ m in/µ g p rote in)
EGFP 29 kDa 29EGFP
P=0.220
P=0.220 P=0.0479
P=0. 009
3
The effect of caspase-3-containing miroparticles on MCF-7 cells
To study the effect of caspase-3-enriched microparticles on their environment, we first investigated whether microparticles from untransfected cells, EGFP-, 29 kDa- or 29EGFP-expressing cells can bind to, or fuse with, MCF-7 cells. Within 48 h, approximately 60% of the microparticles added to the cells had disappeared from the culture medium, indicating binding of or fusion with the cells (data not shown). Despite disappearance of microparticles, however, low numbers of (adherent) cells became EGFP positive after addition of microparticles from EGFP- or 29EGFP-expressing cells (4.7% and 1.9%, respectively; Figure 6A). Similarly, only low numbers of (adherent) cells became caspase-3 positive upon addition of microparticles from either 29 kDa- or 29EGFP- expressing cells (Figure 6B). It should be noticed that a low percentage of MCF-7 cells stained not only for EGFP after addition of microparticles from EGFP-expressing cells, but also for caspase-3, suggesting that the antibody directed against the active form of caspase-3 may also bind to EGFP due to a resemblance of a (neo) epitope present in both active caspase-3 and EGFP.
Since caspase-3-containing microparticles can bind to, or fuse with cells, we further investigated the apoptotic state of cells after binding or fusion with microparticles by studying the binding of annexin V. The addition of microparticles from 29 kDa- or 29EGFP-expressing cells did not result in increased numbers of cells binding annexin V or increased cell detachment compared to the addition of microparticles from untransfected cells or EGFP-expressing-cells (Figures 6C and 6D, respectively). Thus, although caspase-3-containing microparticles bind to or fuse with cells, this does not lead to a marked increase of numbers of cells undergoing apoptosis.
Figure 6. The effect of caspase-3-containing microparticles on MCF-7 cells.
The effect of caspase-3-enriched microparticles on MCF-7 cells was studied by addition of microparticles released from untransfected- (Untransf.), EGFP-, 29 kDa-, and 29EGFP-expressing cells to MCF-7 cells. Two concentrations of microparticles, isolated from 1 mL and 4 mL culture supernatant, respectively, were used. In all figures shown, microparticle-free supernatant was used as negative control and subtracted from the signal obtained by microparticles isolated from 1 mL or 4 mL. A. EGFP positivity in adherent cells was studied and expressed as percentage of total adherent cells. B. Caspase-3 positivity in cells was studied and expressed as percentage of total adherent cells. C. Annexin V positivity in cells was studied and expressed as percentage of total adherent cells. D. The numbers of detached cells were studied and expressed as percentage of total cells.
Un tr a n s f. 1 mL U n tr ans f. 4 m L EGF P 1 m L EGF P 4 m L 29 k Da 1 m L 2 9 k Da 4 m L 29 E G F P 1 m L 29 E G F P 4 m L 0 5 10 15 20 25 EG FP-p o s it iv e ce lls (% ) A Adherent Un tr a n s f. 1 mL Un tr a n s f. 4 mL EG F P 1 m L EG F P 4 m L 2 9 k Da 1 m L 2 9 k Da 4 m L 29 E G F P 1 m L 29 E G F P 4 m L 0 5 10 15 20 25 C a sp a s e -3 p o sitiv e ce lls (% ) Adherent B C Untr ans f. 1 m L Untr ans f. 4 m L EG F P 1 m L EG F P 4 m L 29 k D a 1 m L 29 k D a 4 m L 29E GF P 1 m L 2 9 EG F P 4 mL 0 5 10 15 20 25 An n e x in V-p o sit iv e ce lls ( % ) Adherent Untr a ns f. 1 m L Un tr a n s f. 4 mL EG F P 1 m L EG F P 4 m L 29 k D a 1 m L 29 k D a 4 m L 29E GF P 1 m L 29E GF P 4 m L 0 5 10 15 20 25 D e ta ch e d ce lls ( % o f to ta l c e lls) Detached D Un tr a n s f. 1 mL U n tr ans f. 4 m L EGF P 1 m L EGF P 4 m L 29 k Da 1 m L 2 9 k Da 4 m L 29 E G F P 1 m L 29 E G F P 4 m L 0 5 10 15 20 25 EG FP-p o s it iv e ce lls (% ) A Adherent Un tr a n s f. 1 mL Un tr a n s f. 4 mL EG F P 1 m L EG F P 4 m L 2 9 k Da 1 m L 2 9 k Da 4 m L 29 E G F P 1 m L 29 E G F P 4 m L 0 5 10 15 20 25 C a sp a s e -3 p o sitiv e ce lls (% ) Adherent B C Untr ans f. 1 m L Untr ans f. 4 m L EG F P 1 m L EG F P 4 m L 29 k D a 1 m L 29 k D a 4 m L 29E GF P 1 m L 2 9 EG F P 4 mL 0 5 10 15 20 25 An n e x in V-p o sit iv e ce lls ( % ) Adherent Untr a ns f. 1 m L Un tr a n s f. 4 mL EG F P 1 m L EG F P 4 m L 29 k D a 1 m L 29 k D a 4 m L 29E GF P 1 m L 29E GF P 4 m L 0 5 10 15 20 25 D e ta ch e d ce lls ( % o f to ta l c e lls) Detached D C Untr ans f. 1 m L Untr ans f. 4 m L EG F P 1 m L EG F P 4 m L 29 k D a 1 m L 29 k D a 4 m L 29E GF P 1 m L 2 9 EG F P 4 mL 0 5 10 15 20 25 An n e x in V-p o sit iv e ce lls ( % ) Adherent Untr a ns f. 1 m L Un tr a n s f. 4 mL EG F P 1 m L EG F P 4 m L 29 k D a 1 m L 29 k D a 4 m L 29E GF P 1 m L 29E GF P 4 m L 0 5 10 15 20 25 D e ta ch e d ce lls ( % o f to ta l c e lls) Detached D
3
Discussion
Our present study shows that MCF-7 cells, which do not express caspase-3, hardly release any microparticles. When these cells are transfected with caspase-3-encoding cDNA, caspase-3 is expressed and microparticles are released. These microparticles are enriched in caspase-3 activity as compared to their parent cells, indicating that active caspase-3 is sorted into microparticles. Furthermore, when these caspase-3-enriched microparticles are added to MCF-7 cells, the cells at least in part take up the microparticles but the cells do not become apoptotic thereafter. This finding indicates that once caspase-3 is sorted into microparticles, it is not harmful for other cells. This makes sorting of caspase-3 into microparticles an elegant mechanism to counteract cellular apoptosis, without an effect on other cells.
Caspase-3 is not the only protein that is selectively sorted into microparticles. Well-known examples of sorting of proteins and other molecules into microparticles or exosomes are e.g. the complement C5b-9 complex29, cytostatics30;31, mRNA32, microRNAs33, and various membrane surface receptors34. The question then comes in mind, why do cells sort such molecules into vesicles? We and others hypothesize that cells use vesicles as carrier vehicles for intercellular trafficking of information (mRNA, microRNAs), and surface receptors14;32-34. In addition, the cells may use vesicles to remove dangerous or potentially dangerous molecules, like complement C5b-9 complex, cytostatics or caspase-3, that threaten the cells’ viability and survival. By efficient packaging of such molecules into vesicles, the cells can remain healthy and viable22;29-31;35. In this manner, microparticles and other types of vesicles contribute to cellular homeostasis by functioning as garbage bags which can then be phagocytosed and degraded by other cells.
At present, the underlying mechanism(s) of protein sorting into microparticles is not clear. We can only speculate about the mechanism of sorting of active caspase-3 into microparticles. First, active caspase-3 can be ubiquitinated by members of the inhibitors-of-apoptosis protein family, such as X-linked inhibitor of inhibitors-of-apoptosis (XIAP)36. Ubiquitinated proteins are recognized and sorted by the cytosolic endosomal sorting complex required for transport (ESCRT) complexes into multivesicular bodies, intraluminal vesicles and finally exosomes37-39. It is feasible that a similar mechanism also plays a role in the sorting of active caspase-3 into microparticles. Second, active caspase-3 and procaspase-3 are
copurified with caveolin-enriched domains40. Caveolin-enriched domains are particularly present in lipid rafts, which are involved in the sorting of GPI-anchored proteins, such as CD55, CD58 and CD59, into exosomes41. Such lipid rafts may also play a role in the sorting of proteins into microparticles, since the sorting of tissue factor into microparticles seems to be lipid raft-dependent42. Third, enrichment of active caspase-3 in microparticles may be associated with the role of active 3 in membrane blebbing because caspase-3 cleaves several kinases involved in membrane blebbing, including ROCK1 and P-21 activated kinase (PAK), which in turn increase myosin light chain phosphorylation3;4;43;44. Since these enzymes are predominantly located near or at the plasma membrane and require the immediate presence of active caspase-3, we propose that active caspase-3 may be relatively enriched in the proximity of the plasma membrane. Cleavage of ROCK1 and PAK by active caspase-3 may facilitate membrane blebbing and subsequent removal of active caspase-3 by the release of active caspase-3-containing microparticles. The enrichment of active caspase-3 would then be a result of enclosure of active caspase-3-enriched cytosol into the microparticle during their formation and not be due to a specific sorting process.
In the present study, we demonstrate for the first time that active caspase-3 is enriched in microparticles. We propose that the sorting of active caspase-3 into microparticles contributes to cellular defence against apoptosis.
References
1. Fernandes-Alnemri T, Armstrong RC, Krebs J et al. In vitro activation of CPP32 and Mch3 by Mch4, a novel human apoptotic cysteine protease containing two FADD-like domains. Proc.Natl.Acad.Sci.U.S.A 1996;93:7464-7469.
2. Janicke RU, Sprengart ML, Wati MR, Porter AG. Caspase-3 is required for DNA fragmentation and morphological changes associated with apoptosis. J.Biol.Chem. 1998;273:9357-9360.
3. Coleman ML, Sahai EA, Yeo M et al. Membrane blebbing during apoptosis results from caspase-mediated activation of ROCK I. Nat.Cell Biol. 2001;3:339-345.
4. Sebbagh M, Renvoize C, Hamelin J et al. Caspase-3-mediated cleavage of ROCK I induces MLC phosphorylation and apoptotic membrane blebbing. Nat.Cell Biol. 2001;3:346-352. 5. Falati S, Liu Q, Gross P et al. Accumulation of tissue factor into developing thrombi in vivo is
dependent upon microparticle P-selectin glycoprotein ligand 1 and platelet P-selectin. J.Exp.Med. 2003;197:1585-1598.
6. Muller I, Klocke A, Alex M et al. Intravascular tissue factor initiates coagulation via circulating microvesicles and platelets. FASEB J. 2003;17:476-478.
3
7. Nieuwland R, Berckmans RJ, Rotteveel-Eijkman RC et al. Cell-derived microparticlesgenerated in patients during cardiopulmonary bypass are highly procoagulant. Circulation 1997;96:3534-3541.
8. Nieuwland R, Berckmans RJ, McGregor S et al. Cellular origin and procoagulant properties of microparticles in meningococcal sepsis. Blood 2000;95:930-935.
9. Tesselaar ME, Romijn FP, Van DL, I et al. Microparticle-associated tissue factor activity: a link between cancer and thrombosis? J.Thromb.Haemost. 2007;5:520-527.
10. Zwicker JI, Liebman HA, Neuberg D et al. Tumor-derived tissue factor-bearing microparticles are associated with venous thromboembolic events in malignancy. Clin.Cancer Res. 2009;15:6830-6840.
11. Barry OP, Pratico D, Lawson JA, FitzGerald GA. Transcellular activation of platelets and endothelial cells by bioactive lipids in platelet microparticles. J.Clin.Invest 1997;99:2118-2127. 12. Barry OP, Pratico D, Savani RC, FitzGerald GA. Modulation of monocyte-endothelial cell
interactions by platelet microparticles. J.Clin.Invest 1998;102:136-144.
13. Barry OP, Kazanietz MG, Pratico D, FitzGerald GA. Arachidonic acid in platelet microparticles up-regulates cyclooxygenase-2-dependent prostaglandin formation via a protein kinase C/mitogen-activated protein kinase-dependent pathway. J.Biol.Chem. 1999;274:7545-7556.
14. Berckmans RJ, Nieuwland R, Kraan MC et al. Synovial microparticles from arthritic patients modulate chemokine and cytokine release by synoviocytes. Arthritis Res.Ther. 2005;7:R536-R544.
15. Forlow SB, McEver RP, Nollert MU. Leukocyte-leukocyte interactions mediated by platelet microparticles under flow. Blood 2000;95:1317-1323.
16. Jy W, Mao WW, Horstman L, Tao J, Ahn YS. Platelet microparticles bind, activate and aggregate neutrophils in vitro. Blood Cells Mol.Dis. 1995;21:217-231.
17. Brill A, Dashevsky O, Rivo J, Gozal Y, Varon D. Platelet-derived microparticles induce angiogenesis and stimulate post-ischemic revascularization. Cardiovasc.Res. 2005;67:30-38. 18. Janowska-Wieczorek A, Wysoczynski M, Kijowski J et al. Microvesicles derived from
activated platelets induce metastasis and angiogenesis in lung cancer. Int.J.Cancer 2005;113:752-760.
19. Mezentsev A, Merks RM, O'Riordan E et al. Endothelial microparticles affect angiogenesis in vitro: role of oxidative stress. Am.J.Physiol Heart Circ.Physiol 2005;289:H1106-H1114. 20. Abid Hussein MN, Nieuwland R, Hau CM et al. Cell-derived microparticles contain caspase-3
in vitro and in vivo. J.Thromb.Haemost. 2005;3:888-896.
21. Diamant M, Tushuizen ME, Abid Hussein MN et al. Simvastatin-induced endothelial cell detachment and microparticle release are prenylation dependent. Thromb.Haemost. 2008;100:489-497.
22. Abid Hussein MN, Boing AN, Sturk A, Hau CM, Nieuwland R. Inhibition of microparticle release triggers endothelial cell apoptosis and detachment. Thromb.Haemost. 2007;98:1096-1107.
23. Kertbundit S, de Greve H, Deboeck F, Van MM, Hernalsteens JP. In vivo random beta-glucuronidase gene fusions in Arabidopsis thaliana. Proc.Natl.Acad.Sci.U.S.A 1991;88:5212-5216.
24. Landy A. Dynamic, structural, and regulatory aspects of lambda site-specific recombination. Annu.Rev.Biochem. 1989;58:913-949.
25. Stap J, Krawczyk PM, Van Oven CH et al. Induction of linear tracks of DNA double-strand breaks by alpha-particle irradiation of cells. Nat.Methods 2008;5:261-266.
26. Barrett AJ. Cathepsin G. Methods Enzymol. 1981;80 Pt C:561-565.
27. Du Y, Bales KR, Dodel RC et al. Activation of a caspase-3-related cysteine protease is required for glutamate-mediated apoptosis of cultured cerebellar granule neurons. Proc.Natl.Acad.Sci.U.S.A 1997;94:11657-11662.
28. Meergans T, Hildebrandt AK, Horak D, Haenisch C, Wendel A. The short prodomain influences caspase-3 activation in HeLa cells. Biochem.J. 2000;349:135-140.
29. Sims PJ, Faioni EM, Wiedmer T, Shattil SJ. Complement proteins C5b-9 cause release of membrane vesicles from the platelet surface that are enriched in the membrane receptor for coagulation factor Va and express prothrombinase activity. J.Biol.Chem. 1988;263:18205-18212.
30. Safaei R, Larson BJ, Cheng TC et al. Abnormal lysosomal trafficking and enhanced exosomal export of cisplatin in drug-resistant human ovarian carcinoma cells. Mol.Cancer Ther. 2005;4:1595-1604.
31. Shedden K, Xie XT, Chandaroy P, Chang YT, Rosania GR. Expulsion of small molecules in vesicles shed by cancer cells: association with gene expression and chemosensitivity profiles. Cancer Res. 2003;63:4331-4337.
32. Skog J, Wurdinger T, van RS et al. Glioblastoma microvesicles transport RNA and proteins that promote tumor growth and provide diagnostic biomarkers. Nat.Cell Biol. 2008;10:1470-1476.
33. Hunter MP, Ismail N, Zhang X et al. Detection of microRNA expression in human peripheral blood microvesicles. PLoS.One. 2008;3:e3694.
34. Al-Nedawi K, Meehan B, Micallef J et al. Intercellular transfer of the oncogenic receptor EGFRvIII by microvesicles derived from tumor cells. Nat.Cell Biol. 2008;10:619-624.
35. de Gassart A., Geminard C, Fevrier B, Raposo G, Vidal M. Lipid raft-associated protein sorting in exosomes. Blood 2003;102:4336-4344.
36. Wilson R, Goyal L, Ditzel M et al. The DIAP1 RING finger mediates ubiquitination of Dronc and is indispensable for regulating apoptosis. Nat.Cell Biol. 2002;4:445-450.
37. Babst M, Katzmann DJ, Estepa-Sabal EJ, Meerloo T, Emr SD. Escrt-III: an endosome-associated heterooligomeric protein complex required for mvb sorting. Dev.Cell 2002;3:271-282.
38. Babst M, Katzmann DJ, Snyder WB, Wendland B, Emr SD. Endosome-associated complex, ESCRT-II, recruits transport machinery for protein sorting at the multivesicular body. Dev.Cell 2002;3:283-289.
39. Katzmann DJ, Babst M, Emr SD. Ubiquitin-dependent sorting into the multivesicular body pathway requires the function of a conserved endosomal protein sorting complex, ESCRT-I. Cell 2001;106:145-155.
40. Oxhorn BC, Buxton IL. Caveolar compartmentation of caspase-3 in cardiac endothelial cells. Cell Signal. 2003;15:489-496.
41. Rabesandratana H, Toutant JP, Reggio H, Vidal M. Decay-accelerating factor (CD55) and membrane inhibitor of reactive lysis (CD59) are released within exosomes during In vitro maturation of reticulocytes. Blood 1998;91:2573-2580.
42. del Conde I, Shrimpton CN, Thiagarajan P, Lopez JA. Tissue-factor-bearing microvesicles arise from lipid rafts and fuse with activated platelets to initiate coagulation. Blood 2005;106:1604-1611.
43. Lee N, MacDonald H, Reinhard C et al. Activation of hPAK65 by caspase cleavage induces some of the morphological and biochemical changes of apoptosis. Proc.Natl.Acad.Sci.U.S.A 1997;94:13642-13647.
44. Rudel T, Bokoch GM. Membrane and morphological changes in apoptotic cells regulated by caspase-mediated activation of PAK2. Science 1997;276:1571-1574.
