The role of abca1 in atherosclerosis: lessons from in vitro and in vivo models - Chapter 3 Alternate transcripts expressed in response to diet reflect tissue specific regulation of ABCA1

s

The role of abca1 in atherosclerosis: lessons from in vitro and in vivo models

Singaraja, R.R.

Publication date

2003

Link to publication

Citation for published version (APA):

Singaraja, R. R. (2003). The role of abca1 in atherosclerosis: lessons from in vitro and in vivo

models.

General rights

It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s)

and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open

content license (like Creative Commons).

Disclaimer/Complaints regulations

If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please

let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material

inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter

to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You

will be contacted as soon as possible.

Chapter r

Alternatee transcripts expressed in response to diet

reflectt tissue specific regulation of ABCA1

Roshnii R. Singaraja

1

, Erick R. James

1

, Jennifer Crim

2

, Henk Visscher

1

,

Aluu Chatterjee

2

, and Michael R. Hayden

1

'Centree for Molecular Medicine and Therapeutics, University of British Columbia, Vancouver,, Canada

;

Pfizerr Global Research and Development, Ann Arbor, Michigan 48105, USA

Abstract t

ABCA11 is a gene essential for transport of lipids across plasma membranes and for the maintenancee of plasma lipid homeostasis, especially of HDL-C levels. The transcriptional regulation off ABCA1 appears to be extremely complex and is currently poorly understood. We had previouslyy generated ABCA1 BAC transgenic mice which showed expression of the human ABCA11 RNA and protein, and allowed us to identify three alternate transcripts, each arising fromm different exonl sequences, E l b , E1c, and E l d , that were directly spliced into exon2 whichh contains the ATG translation initiation site. Thus all three transcripts generate full length protein.. We have determined that the hExonld transcript is localized to the liver, spleen and macrophages,, and is preferentially up-regulated in the liver in response to the feeding of a diet highh in fat. The hExonlb transcript is localized to the liver, small intestine, testes, macrophage, aorta,, spleen and brain, and is significantly up-regulated in macrophages The hExonlc transcript iss ubiquitously expressed and is up-regulated in the aorta, brain, and testes. Our data indicate differentt distribution of transcripts in various tissues and show tissue specific regulation of differentt ABCA1 transcripts in response to a dietary challenge.

Introduction n

Maintenancee of cholesterol homeostasis is vital for the survival of all organisms. Many genes underr complex regulatory pathways exist to preserve this balance. One of these genes is ABCA1,, which functions in the reverse cholesterol pathway, and is vital for the translocation off phospholipids and cholesterol across the plasma membrane to ApoA-l. Mutations in ABCA1 leadd to familial hypoalphalipoproteinemia (FHA) and Tangier Disease (TD), characterized by loww to absent levels of plasma HDL-C, reduced ability to efflux cholesterol and by the accumulation off lipid filled foam cells in several tissues.

Thee ABCA1 gene is localized to chromosome 9 q 3 1 , contains 50 exons, and spans a 150 kb genomicc region. It encodes a 2261 amino acid containing protein that is expressed highly in thee liver, testis, adrenal, small intestine and brain among other tissues (1). Since ABCA1 has a keyy role in cholesterol metabolism, several studies have identified elements involved in its regulation.. ABCA1 is highly regulated by sterols and oxysterols modulate ABCA1 gene expression throughh the nuclear hormone receptor, LXR (liver X receptor) which heterodimerizes with the retinoidd X receptor (RXR) (2). LXR-a is expressed primarily in liver, intestine, kidney and macrophages,, whereas LXR-B is widely expressed (3). LXRs in turn are controlled by the transcriptionn factors PPARy/cS (4,5). ABCA1 is also regulated by PPARa in addition to PPARy agonistss (6). cAMP mediated upregulation of ABCA1 has also been described (7-9), although thee cAMP regulatory motif in the human ABCA1 promoter has not yet been identified (10). A promoterr region 100-200bp upstream of the exonl transcription start site that is responsive to freee cholesterol has also been identified (11) and it has been shown that ABCA1 expression in fibroblastss is critically dependent on cholesterol loading (12). Interferon y down-regulates ABCA1,, especially in mouse macrophages and foam cells (13), and ZNF202, a zinc finger protein,, has been shown to repress ABCA1 expression in HepG2 and RAW cells (14,15). Severall groups of transcription start sites have been identified for ABCA1. The furthest upstream startt site generates an Exonl that is 303 bp long and is 40bp downstream from a modified TATAA box (16, 17). This transcript contains binding sites for AP1, NFKB, Sp1 and SREBP, and consistingg of six G/C rich regions in close proximity. It also contains an LXR binding DR4 elementt at position +4 of exon 1 (2). The next transcription start site occurs approximately 90bpp downstream of the first start site, and generates a truncated ??1hn exonl ( i i ) , A weak TATAA box is present upstream of this transcription start site. One other transcript, lacking part off exon3 and all of exon4 has been described (18), but does not generate a full length protein. Wee have previously generated ABCA1 BAC transgenic mice, and described the presence of threee other alternate transcripts in these mice. We termed these transcripts Exonl b (X1b), Exonlcc (X1c) and Exonld (X1d), and determined that they are also similarly expressed in humans.. These alternate transcripts each contain different exon 1 sequences, but each splice intoo the same exon 2, which contains the ABCA1 translation start codon, thus generating the

samee full length ABCA1 protein. They are localized downstream of TATA and CAAT sequences, andd have been shown to have functional LXR/RXR binding sites upstream of the start sites (19). Inn our current study, we determined the tissue distribution of the ABCA1 transcripts, and gainedd insight into their regulation by elucidating their response to cholesterol loading since thee functional effect of ABCA1 depends on the tissue distribution of each of the transcripts andd its response to specific regulatory proteins such as free cholesterol or oxysterols. Our data indicatee that tissue specific expression of full length ABCA1 occurs and is accounted for by transcriptss with differing promoter sequences, thus facilitating different responses to activation byy feeding of a high fat diet.

Materialss and Methods

Identificationn of alternate human and mouse ABCA1 splice variants

Alternatee transcripts in the ABCA1 gene were identified as previously described (19). Briefly, ABCA11 BAC transgenic mice and control littermate wild type mice were sacrificed by CO inhalation,, and tissues dissected and frozen. RNA was isolated f r o m tissue f o l l o w i n g manufacturer'ss protocol using the Trizol RNA isolation kit (Gibco BRL, Burlington, Ontario, Canada).. Mouse and human liver marathon ready cDNA {Clontech, Palo Alto, CA, USA) was alsoo used for the identification of splice variants. 5' RACE was performed following manufacturers instructionss (Gibco BRL Burlington, Ontario, Canada). Human ABCA1 gene specific reverse primers inn exon 6 (CCCTCAGCATCTTGTCCACAGTAGAC) and exon 4 (GAAGTGTTCCTGCAGAGGGCATG) off ABCA1 (16) or reverse mouse ABCA1 specific primers in exon 2 (CGAATGTCAGATTCTTCCAC orr CTTCGAAATGTCAGATTCTTCCAC) and the adaptor primers provided were used with the Marathonn ready cDNA samples. All amplified products were TA cloned (Invitrogen, Burlington, Ontario,, Canada), and sequenced using an ABI Prism 3100 genetic analyzer (Applied Biosystems, Fosterr City, CA, USA) sequencer. Sequence was assembled using Chromas version 1.45 (Technelysiumm Pty Ltd., Qld, Australia) or Phred-Phrap (CodonCode Corp., Dedham, MA, USA), andd was compared to human ABCA1 (gi number 9247085) or mouse ABCA1 (gi number

11611824)) genomic sequences using the BLAST server at NCBI (www.ncbi.nlm.nih.gov).

Feedingg of atherogenic diet

ABCA11 BAC transgenic and wild type littermates were fed an atherogenic diet (Harlan Teklad, TD90221)) containing 15.75% cocoa butter, 1.25% cholesterol, 0.5% sodium cholate, or fed a controll chow diet containing 0.5% sodium cholate (Harlan Teklad, TD99057) for seven days. Bothh diets and water were provided ad libitum.

RT-PCRR analysis of the human ABCA1 splice variants

RNAA was isolated from snap frozen tissue following manufacturer's protocol using Trizo reagentt (Gibco BRL, Burlington, Ontario, Canada). Isolated RNA was quantified using a Pharmacia

Ultrospecc 3000 spectrophotometer, separated on a 1 % agarose/formaldehyde gel to assess quality,, and 4pg of the isolated RNA was used for reverse transcription using Superscript II reversee transcriptase (Gibco BRL, Burlington, Ontario, Canada) and following manufacturers protocol.. ABCA1 splice variants were analyzed as follows. Human transcript Exonl (hExonl) wass amplified using the forward primer GTAGGAGAAAGAGACGCAAAC and the reverse primer CATTCATGTTGTTCATAGGGTGG designed in Exon 3 of ABCA1. The PCR cycling conditions weree 95~'C for 4 minutes, followed by a hold at 78C_{C for 5 minutes during which Advantage}

polymerasee mix (Clontech, Palo Alto, CA, USA) was added as hot start. This was followed by 355 cycles of 94"C for 45 seconds, 60 C for 1 minute, C for 2.5 minutes, then a 72'C extensionn for 7 minutes. Human transcript Exonlb (hExonlb) was amplified using the forward primerr CAAGCTCTGTCCTGAGCCAC and the same reverse primer and cycling conditions as usedd for transcript Exonl. Human transcript Exonlc (hExonlc) was detected using the same conditionss and the forward primer GAGAAGGGAACTCACATTGCTTTG and human Exonld (hExonld)) was detected using the forward primer CACGGTAGAACTTT CTACTGTG, and the samee reverse primer as used for the other transcripts. The annealing temperature for the detection off Exonld was raised from C to . The 18s rRNA was detected using the Ambion classicc II 18s kit, and following manufacturers instructions (Ambion, Inc., Austin, TX, USA). The 18ss competimer to primer ratio that was used was 1:9. All amplified products were separated onn a 2 % agarose gel containing ethidium bromide, and densitometric quantification was performedd using the Biorad GelDoc 100 (BioRad Laboratories, Hercules, CA, USA) and Quantity onee software, version V.4,01 (BioRad Laboratories, Hercules, CA, USA). The relative abundance off the ABCA1 transcripts were expressed as the ratio of the quantified ABCA1:18s PCR product.

Taqmann analysis of the human ABCA1 splice variants in human and mouse tissue Humann tissue samples were run on Taqman assays using four ABCA1 markers, Exonl, Exon 1b, Exonlcc and Exonld. Tissue samples from the mice were also run using Taqman assays using 3 ABCA11 markers, hExonlb, hExonlc and hExonld. For each tissue sample, reactions were run inn triplicate. A housekeeping gene, marker rRNA, was also run in order to normalize the amountt of RNA added to each reaction. No template controls were run for each master mix to checkk for any contamination. For each reaction 40ng of total RNA was used and gene amplificationn was detected using the ABI Prism 7900 Sequence Detection System (Applied Biosystems,, Foster City, CA, USA). The ABCA1 markers were FAM labeled and the rRNA marker wass VIC labeled to allow multiplexing within the same reaction. The CT (threshold cycle) value, whichh is the cycle when amplified product is detected to be above threshold (or background) by thee PCR system was determined for each sample. ACt values were determined by subtracting the rRNAA Ct value from the ABCA1 Ct, and thus normalized for input RNA quantity. This data was usedd to calculate fold changes in gene expression by first taking an average of the repeats for

eachh sample and then using the formula: 2' Sj_{''" -}& A_{'' ^ - " ' ^ - " > ^ B - " *- ^c;., probe/Primer Sequences} usedd for the quantification of the transcripts were,

Humann ExonlF: ACAGGCTTTGACCGATAGTAACCT Humann ExonIR: TTGCCGGGACTAGTTCCTTTTAT Humann Exonl Probe: TGCGCTCGGTGCAGCCGAAT Humann Exonl bF: GCTGTGCTGCCAGTTGTCAT Humann Exonl bR: AGGACACAGGCCTCCAAAGTT

Humann Exonlb Probe: TTGAACAAACTGATGCAGTGCTGGTTTAACTC Humann ExonlcF: CTAGAGGATATTGTTGGAATGAAGAAAG

Humann ExonlcR: CGAGATAATATAAATAATTTCCCAACACAGTAC Humann ExonlcProbe: AACTCACATTGCTTTGGGACTTAAATTAAGCCA Humann ExonldF: TGTGGCTCTATGCTACTTCTTAGCA

Humann ExonldR: AGAAAAAGGTTCTGACTCCAAGGA Humann ExonldProbe: TTCTCCATGTGCTTCCTGGAGA

RT-PCRR analysis of the mouse ABCA1 splice variants

RNAA was isolated and quantitated as described above. Endogenous mouse ABCA1 splice variantss were analyzed as follows. Mouse transcript Exonld (mExonld) was amplified using t h ee f o r w a r d p r i m e r AGCAACTCTTCTCCGGCATAGG and t h e reverse p r i m e r CTTCGAAATGTCAGATTCTTCCACC designed in Exon 2 of mouse ABCA1. The PCR cycling conditionss were C for 5 minutes, followed by 33 cycles of C for 45 seconds, C for 300 seconds, C for 45 seconds, then a C extension for 7 minutes. Mouse transcript Exonlbb (mExonlb) was amplified using the forward primer ACCAGGGTGTCAGAGGTGTC and thee same reverse primer and cycling conditions as used for transcript 1. Mouse transcript E x o n l cc ( m E x o n l c ) was d e t e c t e d using the same conditions and the f o r w a r d primer GAACCATCGATTGCGTCTGACC.. The 18s rRNA was detected using the Ambion classic II 18s kitt and quantitated as described above.

Statistics s

Alll statistics were performed using the two-tailed t-test in GraphPad Prism {GraphPad Prism versionn 3 for Windows, GraphPad Software, San Diego, CA, USA).

Results s

Tissuee distribution of total human ABCA1 mRNA

Wee previously looked for the transcripts in the BAC transgenic mice that were responsible for fulll length protein expression. These studies revealed that in the BAC mice, three alternate ABCA11 transcripts were present, each containing a novel exon 1 that was spliced into exon 2 off the ABCA1 gene with its ATG translation start site (Figure 1) (19). In order to determine if

303bp p EXONN 1 2 4 1 5 6 b p p 156bp p G G EXONN 2 EXONN 50 A A A A A A 120bpp r - * A T G jj ! n 1 7 4 6 b p rJ 1

EXONN 1B EXONN 2 EXONN 50

A A A A A A 136bp p 2 2 1 0 b p p EXONN 1C

H H

ATG G EXONN 2 EXONN 50 178bp p EXONN 1D 2 5 6 6 b p p G G EXONN 2 EXONN 50 A A A A A A

Figuree 1. Schematic diagram of the previously described ABCA1 transcript (Exonl) and the three alternative transcriptss in ABCA1.

Thesee three alternative transcripts, hExonl b, hExonlc, and hExonld are generated from sequences in intron 1 off the ABCA1 gene, and each contains an alternative exon 1 that is spliced into the same exon2 of ABCA1, which containss the ATG translation initiation site. Therefore each transcript gives rise to the same ABCA1 protein.

thee total human ABCA1 mRNA from the BAC transgenic mice showed the same tissue abundance andd distribution as the endogenous mouse ABCA1 transcripts previously described (1), we performedd semi-quantitative RT-PCR using primers in exon 4 and exon 6 of the human ABCA1 gene.. Although RNA levels were not highly variable in all tissues tested, the liver, testes, and brainn showed the highest mRNA abundance, the kidney, heart, and aorta showed the next highestt levels, and the adipose, large intestine, macrophage, small intestine, spleen and stomach showedd the lowest abundance (Figure 2A). This data is relatively equivalent to previously publishedd levels for the abundance of endogenous mouse transcripts (1).

mRNAA tissue distribution patterns in humans are essentially similar to those in the BACC mice

Wee next sought to determine if the total human ABCA1 transcripts showed a similar tissue distributionn pattern in fiumans as it did when expressed in the mouse background. Total humann transcript levels were highest in the liver, testis, kidney, brain and small intestine, and lowerr in the heart, lung, skeletal muscle, spleen and stomach of the human tissues tested (Figuree 2B). This distribution pattern was essentially similar to the pattern of human transcript distributionn in the mice.

B B 1.20 0 << 0.80 O O QD D << 0.60 'S S oo 0.40 0.20 0 0.00 0

^^mww ^^mww

_{J*J* **J>}

1.40 0 11.20 0 f:1.00 0 mO.80 0 < < *-0.60 0 _{o o} 20.40 0 a:o.20 0 o.oo o vv E " 1.40l l || 1.20 5 I . O O O mm 0.80 < < *.. 0.60 o o .22 0.40 n n ccc 0.20 0.00 0 v--

/^mm§^ /^mm§^

je je

V V

Figuree 2. Distribution of the human ABCA1 transcripts in BAC transgenic mouse and human tissue.

Sincee the BAC transgenic mice were generated using a human BAC, we determined (A) the total human transcriptt distribution in these mice, and (B) in human tissues. Total ABCA1 transcript distribution was assessed byy using per primers that were generated in exon4 and exon6 of the ABCA1 gene. Both the BAC mice and humanss showed similar tissue distribution of ABCA1 mRNA, and showed the presence of ABCA1 in all the tissues tested,, with highest levels observed in the liver. (C)The distribution of hExonl b, (D) the distribution of hExonlc,

andd (E), the distribution of hExonl d in the BAC mice were then determined. hExonl b showed highest levels in

thee liver and was found in aorta, brain, gonad, liver, macrophage, small intestine, and spleen hExonlc was found inn all tissues tested, and was found at relatively similar levels. hExonl d was found only in the liver, macrophage andd spleen and showed the highest levels in the liver.

Transcriptss hExonlb and h E x o n l d show tissue specific distribution in BAC mice Wee hypothesized that different transcripts in specific tissues could account for these tissue specificc expression patterns, in order to determine the tissue distribution of the three alternative humann transcripts in the BAC mice, »vt performed semi-quantitative M - P L R and taqman assays onn various tissues isolated from the BAC transgenic mice. We found that the human transcript hExonlbb (generated from the human ABCA1 BAC) was expressed specifically in the aorta, brain,, gonad, liver, macrophage, small intestine and spleen, with the highest levels of this transcriptt being observed in the liver (Figure 2C). In contrast, transcript hExonlc was found in allall tissues tested, and was found at relatively equivalent levels in all tissues (Figure 2D). Transcript hExonldd however, was found specifically in liver, macrophage and spleen of the BAC mice, at similarr levels (Figure 2E).

Figuree 3. Localization of the various ABCA1 transcripts in human tissues.

RNAA was isolated from human tissues, and RT-PCR was performed to determine the mRNA distribution pattern off ABCA1 in various tissues (A) hExonl b was quantified in various human tissues, and was found in the liver, lung,, spleen and testis, with highest levels being observed in the liver. (B) hExonlc was found in all tissues tested andd found at relatively equivalent levels in most tissues. (C) hExonld was found solely in the liver, and (D), the upstreamm human exonl transcript was localized in all tissues tested with highest levels being observed in the liver, stomach,, testis, and brain.

Whenn assessed by tissue, the liver, spleen and macrophages expressed all three transcripts, the smalll intestine, brain, aorta, and testis expressed both hExonlb and hExonlc, and the heart, kidney,, large intestine, and stomach only expressed hExonlc.

h E x o n l b ,, c and d transcripts show similar tissue distribution in human tissue as in BACC mice

Sincee the hExonlb, c and d transcripts were generated from the human BAC in the mouse background,, we next determined if these transcripts are also present in human tissue, with similarr tissue distribution patterns. As in the BAC mice, transcript hExonlb was found in the liver,, lung, spleen and testes of humans, with the highest levels being observed in the liver (Figuree 3A). The hExonlc transcript was expressed ubiquitously, at very similar levels identical too the BAC mice (Figure 3B). The transcript hExonld was found solely in livers of humans (Figuree 3C). In addition, we assessed the tissue distribution of the previously characterized Exonn 1 transcript in human tissue and found that it was ubiquitously expressed, and at relatively similarr levels in the tissues tested (Figure 3D), This transcript was not assessed in the BAC mice becausee the human ABCA1 BAC used for generating the mice did not contain either the regularr promoter or e x o n l . A summary of the distribution of the various transcripts in BAC micee and human tissues are presented in Table 1.

Tablee 1. Distribution of human alternative transcripts in BAC mouse and human tissues

hExonlb b

Adiposee Aorta Brain Kidney Lg Int Liver Lung Macrophage Muscle Sm. Int Spleen Stomach Testis

BACC mice + + - + nd * nd + + + Humann nd nd • - nd + + nd + +

hExonlc c

Adiposee Aorta Brain Kidney l g . Int. Liver Lung Macrophage Muscle Sm. Int Spleen Stomach Testis BACC mice + t + + + + nd + nd + + + + Humann nd nd + + nd * t nd + + <- + +

hExonld d

Adiposee Aorta Brain Kidney Lg Int Liver Lung Macrophage Muscle Sm Int Spleen Stomach Testis BACC mice - - + nd + nd - +

- >> - • 28bp p

i27b

P

y y

159bp p Transcriptt mExonld 282bpp Transcript mExonlb 460bpp Transcript mExonlc mExonlb: : TAGCCAGCAAGCCTGCCCCGGAAGCTCTGTCTGCTGGAGATTCTGGGGGTTGGCAGTCCAGGACT T CATGACCTTTTGACAAGCCACCAGGGTGTCAGAGGTGTCTGGTGAGAGGGCTGGAGCAGCAACTC C TTCTCCGGCATAGGGCTTTGAAGCAGTGATTGACAGATCTCTCTCTCTCTCTCTCTCTCTCTCTC C TCTCTCTCTCTCTCTCTCTCTCTCGTTTTATCTTTCAGTTAATGACCAGCCACAGagtcacagct t ctgtgctctggctgctccctccagggctotcgagccgcagacgcaggtcgctgtgggtgccggct t gtggtgacatggcttgttggcctcagttaaggctgctgctgtggaagaatctgacatttcgaag agacaaaca a mExonlc: : TAGCCAGCAAGCCTGCCCCGGAAGCTCTGTCTGCTGGAGATTCTGGGGGTTGGCAGTCCAGGACT T CATGACCTTTTGACAAGCCACCAGGGTGTCAGAGGTGTCTGGTGAGAGGGCTGGAGCAGCAACTC C TTCTCCGGCATAGGGCTTTGAAGCAGTGATTGACAGATCTCTCTCTCTCTCTCTCTCTCTCTCTC C TCTCTCTCTCTCTCTCTCTCTCTCGTTTTATCTTTCAGTTAATGACCAGCCACAGagtcacagct t ctgtgctctggctgctccctccagggctctcgagccgcagacgcaggtcgctgtgggtgccggct t gtggtgacatggcttgttggcctcagttaaggctgctgctgtggaagaatctgacatttcgaag-: : agacaaaca a mExonld: : TAGCCAGCAAGCCTGCCCCGGAAGCTCTGTCTGCTGGAGATTCTGGGGGTTGGCAGTCCAGGACT T CATGACCTTTTGACAAGCCACCAGGGTGTCAGAGGTGTCTGGTGAGAGGGCTGGAGCAGCAACTC C TTCTCCGGCATAGGGCTTTGAAGCAGTGATTGACAGATCTCTCTCTCTCTCTCTCTCTCTCTCTC C TCTCTCTCTCTCTCTCTCTCTCTCGTTTTATCTTTCAGTTAATGACCAGCCACAGagtcacagct t ctgtgctctggctgctccctccagggctctcgagccgcagacgcaggtcgctgtgggtgccggct t gtggtgacatggcttgttggcctcagttaaggctgctgctgtggaagaatctqacatttcgaagi i agacaaaca a

Figuree 4. Schematic and sequence of the endogenous alternative mouse transcripts.

5'' RACE was performed on RNA isolated from liver tissue from wild-type mice, and the presence of three alternativee transcripts were discovered. (A) These transcripts arise in intron 1 of the mouse ABCA1 gene. Transcript mExonll b extends the length of the previously described mouse exon2, and ESTs have been described containing thiss Exon. mExonlc also results in an extended Exon2 by approximately 300 bp. mExonld consists of an alternativee exon 1 sequence that splices into exon2 of the mouse sequence. As in humans, Exon2 in mice contains thee ATG translation initiation site. (B) The sequences of the transcripts are provided with the primers used for amplificationn indicated. Bold, lower case letters indicate the previously described Exon2 Bold, capital letters indicatee the new exonic sequences.

Thee endogenous mouse ABCA1 mRNA shows similar tissue distribution as the human mRNA A

Inn order to determine if alternative transcripts are also present and similarly distributed in the mouse,, we performed 5' RACE analysis on mouse RNA, and as in humans, discovered the presencee of three alternative transcripts in the mouse (Figure 4). These transcripts were identified inn the liver of mice. In order to determine the tissue distribution of these transcripts in mice, andd also to determine if these mouse transcripts showed similar distribution to the human ABCA11 alternative transcripts, we performed distribution analysis of the mouse transcripts in variouss tissues. When the total endogenous mouse ABCA1 transcripts were quantified, we foundd that the total mouse ABCA1 mRNA also showed a similar tissue distribution as the total

0.35 5 *]] 0.25

< <

UU 0.20 CO O

< <

ii 0.15 o o 22 0.10 (S S K 0 . 0 5 5 00 0

M l l

o"" </

x»

6

J* J* -é

< / /

\« «

:.. .

00 3r > 0.30 0 -- 0.25

< <

"" 0.20 co o < < »-- 0.15 •22 0.10 (13 3 % . 0 5 5 0.00 0 '' < * X* „v / * *?

k k

^ ^

*

^^ **"

&& j- ^

j f V ^ ^ ^ J J

<? <?

_{< / /}

\ ^ ^ 0.50 0 Q.45 5 </>> 0.40 CO O V.V. 0.35 << 0.30 CDD 0.25 0.15 5 rara 0.10 0.05 5 0.00 0 CÜ Ü

/^4^^M^ /^4^^M^

*•?</ /

Figuree 5. Distribution of endogenous mouse transcripts in wild-type mice.

Thee tissue distribution and abundance of mouse ABCA1 transcripts were quantified in order to determine differencess between the expression of the human and mouse transcripts. (A) Total mouse transcripts were quantifiedd using mouse ABCA1 primers designed in exon3 and exon5 of the mouse ABCA1 gene. Mouse ABCA1 mRNAA was most abundant in the liver, and was also found to high levels in the brain, testis, and kidney. (B) mExonlbb transcript was found in the testis, liver, macrophage and small intestine of the mice, with the highest levelss being observed in the liver and testis. (C) mExon 1 c was distributed in all tissues tested, and at relatively similarr levels in most of the tissues. (D) mExon 1d was found solely in the liver and macrophages, and was most abundantt in macrophages.

humann transcripts in the mouse background, and the endogenous human transcripts in human tissues.. Essentially, mRNA levels were the highest in the liver, brain, gonad, and kidney. Lower levelss were observed in the adipose, heart, large intestine, macrophage, small intestine, spleen andd stomach (FiyuiL J A ;

Alternatee transcripts showing similar tissue distribution as human h E x o n l b , c and d aree found in the mouse

Usingg semi-quantitative RT-PCR, we determined the distribution of the three alternative transcripts inn the mouse and discovered that mouse transcript mExonlb was found in the gonad, liver, macrophagee and small intestine of the mouse, and was found at similar levels in these tissues (Figuree 5B). This transcript shows essentially similar tissue distribution to the human hExonlb transcript.. Mouse transcript mExonlc was found in all tissues tested at similar levels (Figure 5C),, showing identical distribution to the human hExonlc transcript. The mouse transcript mExonldd was found in the liver and macrophages, with highest levels in the macrophages (Figuree 5D), showing a similar tissue distribution to the human transcript hExonld. Thus the alternatee endogenous ABCA1 transcripts Exonlb, 1c and 1d show almost identical tissue distributionn patterns between the mouse and humans.

ABCA11 transcripts in the liver and macrophages are significantly up regulated in responsee to feeding of a high fat diet

Havingg shown that mRNA expression in mice parallels that seen in human tissue, we sought to addresss the question of which transcripts are responsible for ABCA1 dependent phenotypes observedd when mice are fed a high fat diet. Since ABCA1 is known to be strongly regulated by oxysterols,, and since feeding of high fat diets have previously been shown to increase ABCA1 levels,, we determined the response of total human transcripts in the mouse background to highh fat feeding. When the mice were placed on a high fat diet for 7 days, there was a significantt upregulation of total human transcripts arising from the BAC in the liver , n=6,, p=0.002) and in macrophages (56.2 + 16.1%, n=6, p=0.003} (Figure 6A). Increases were alsoo observed in the adipose, brain, gonad and small intestine, although these values did not reachh significance.

Transcriptt hExonlb and hExonld in BAC transgenic mice are specifically upregulated inn macrophages and livers respectively in response to fat feeding

Wee next determined the relative contribution of each of the three alternative transcripts of ABCA11 to the increase in total ABCA1 expression following feeding of a high fat diet. Transcript hExonlbb was specifically up regulated (94.3 20.8%, n=6, p<0.0001) only in the macrophages off the mice (Figure 6B). Transcript hExonlc was observed to be increased significantly in the aortaa , n=6, p<0.0001) and brain , n=6, p=0.0001) of the mice, and showedd relatively little increase in all the other tissues tested (Figure 6C). Transcript hExonld

p<00001 1

Figuree 6. Response of the human ABCA1 transcripts to feeding of a high fat diet.

Transcriptss were quantitated for response to feeding of a high fat diet in mice. Overall, total human transcripts showedd (A) a significant increase in liver and macrophages of BAC transgenic mice. Small increases in levels of totall ABCA1 transcripts were observed also in the adipose, aorta, brain, testis and small intestine, although these weree non-significant. (B) hExonl b levels showed dramatic increase in macrophages of all the tissues testes. The testiss and small intestine also showed mild but insignificant increases in hExonl b transcripts. (C) hExonlc transcriptss were significantly up regulated in the aorta, brain, and testis of the BAC mice. Minor increases were alsoo observed in the stomach. (D) hExonld showed high levels of upregulation in the liver of the BAC transgenic mice.. In addition, small but significant levels of upregulation of this transcript were observed in the macrophages.

showedd a significant increase in expression specifically in the liver of fat fed mice 1 5.8%, n=6,, p=0.0001). In addition, transcript hExonld also showed a mild but significant increase in macrophagess (19.5+17.0%, n=6, p=0.009) (Figure 6D). Although upregulation of the hExonlc wass observed in the brain and aorta, in the context of the total of all the transcripts, this upregulationn was not significant, likely due to the sensitivity of the assay. All these data were confirmedd by Taqman analysis, with similar levels of expression and upregulation being observed usingg both techniques.

Whenn the data are analyzed by tissue, on a chow diet relatively equivalent levels of hExonlb, 1c andd 1d are found in the liver. However, upon high fat feeding, levels of solely the hExonld transcriptt are up regulated significantly, indicating a role for the promoter of this transcript in

lipidd sensing in the liver. In the macrophages all three transcripts were also expressed in chow fed mice.. In fat fed mice however, specifically the hExonlb transcript is significantly up regulated, indicatingg a role for this promoter in lipid loading in macrophages. In the brains of chow fed animals,, both hbxonlb and 1c are present. However, only hExonlc is up regulated in response to fatt feeding, indicating a role for this promoter in the brain. Other tissues of interest, the testes andd the small intestine both show hExonlb and 1c in chow fed animals. In the testis, hExonlb andd 1c are up regulated, with hExonlb showing greater levels of stimulation. In the intestine, hExonlbb is solely up regulated, although to a much lesser extent than it was in the macrophages.

E n d o g e n o u ss mouse ABCA1 transcripts s h o w u p r e g u l a t i o n in several tissues in responsee to feeding of a fat diet

Endogenouss total mouse ABCA1 transcripts were significantly up regulated in the testis, kidney, largee intestine, liver, macrophage, small intestine, spleen and stomach of the wild-type and BAC mice.. The highest level of upregulation was observed in the liver in both the wild-type (45.1 , n=6,, p<0.0001) (Figure 7A) and in the BAC (36.4+12.1, n=6, pO.0001) (Figure 7B) mice.

Mousee transcripts m E x o n l b and m E x o n l d are specifically upregulated in t h e liver andd macrophages respectively of both w t and BAC mice in response to fat feeding Wee next addressed the response of the endogenous mouse ABCA1 transcripts in both w t and BACC transgenic mice to feeding of a high fat diet. Similar to human transcript hExonlb, the endogenouss mouse transcript mExonlb was significantly up regulated in the macrophages of bothh w t (122 1 5.8%, n=6, p=0.0002) and BAC , n=6, p<0.0001) mice (Figure 7CC and D). Mouse transcript mExonlc was significantly up regulated in the adipose, brain, heart,, kidney, liver, macrophage and stomach of both the w t and BAC transgenic mice (Figure 7EE and F). As seen with the human transcripts, the mouse mExonld was most significantly upregulatedd in the livers of both wt , n=6, p<0.0001) and BAC , n=6,, p<0.0001) mice (Figure 7G and H).

Whenn the tissues are specifically addressed, as with the human transcripts, the liver showed thee presence of all three transcripts in mice on a chow diet. In response to a fat diet, transcript mExonldd was significantly up regulated. mExonlb and 1c also were up regulated, but to a muchh reduced level !n macrophages, a!! three transcripts were also present in the chow fed mice.. However, upon fat feeding, levels of mExonlb were up regulated significantly. Minor amountss of mExonlc were also up regulated. In the brain of mice on chow, transcript mExonlc wass present and was up regulated in response to fat feeding. In the small intestine and testis, bothh the mExonlc and 1d transcripts were present in mice on chow diets. On the fat diet, transcriptt mExonlb showed significant upregulation in the testis. No changes were observed inn the intestine. These data correlate well with the human transcript distribution and upregulation inn the mice, indicating that promoters for these alternate transcripts are functionally similar.

80.0 0 6000 p<0.0001 P=0.0055 P=0.02 i BB 50.0 P=0.009 9 P=0.007 7 p<0.0001 1

J*MS/&/& J*MS/&/&

v v / /

'J 'J

<c?? * <

o ^

^ ^

Figuree 7. Response of endogenous mouse ABCA1 transcripts to a high fat diet.

Afterr 7 days of feeding of a high fat diet, endogenous mouse ABCA1 transcripts were quantified in order to determinee their response. Total endogenous mouse transcripts were quantified in wild-type (A) and BAC (B) mice, andd showed similar response in the presence and absence of the human ABCA1 gene. Significant levels of upregulationn were observed in the testis, kidney, large intestine, liver, macrophage, small intestine, spleen and stomachh of the mice. mExonlb also showed identical upregulation when wild-type mice (C) were compared to BACC (D) mice. Both models showed significant increases in the testis, liver, and macrophage, with the highest levelss of upregulation being observed in the macrophages. mExonlc was up regulated in several tissues in both thee wild-type (E) and BAC(F) mice. Brain, kidney, liver, macrophage, and stomach showed significant upregulation off mExon 1 c transcript in both the wild-type and BAC mice. The mExon 1 d transcript showed significant upregulation onlyy in the liver of both the wild-type (G) and BAC (H) mice.

Discussion n

Intracellularr cholesterol levels are under precise control, affecting lipid biosynthesis, efflux fromm cells, and influx into the cells of cholesterol associated with lipoproteins. Regulation of thesee processes are stringently controlled, and lipids d i t Lhuuyhi to play impoitant rules in cell membranee assembly and function, post-Golgi protein sorting (20), signal transduction and generatingg cell surface polarity (21), and in the activation of immune responses (22). In spite off these beneficial roles, excess cholesterol is toxic to cells, and a number of mechanisms exist too rid cells of free cholesterol. Although the complex regulation mechanisms for maintaining cholesteroll homeostasis remain largely unknown, the impairment of control mechanisms results inn diseases such as atherosclerosis.

ABCA11 has a crucial involvement in the efflux of lipids out of cells. Levels of expression of this genee are exquisitely controlled. In this study we determined the tissue distribution and abundance off each of the three alternative ABCA1 transcripts that we previously identified (19), and identifiedd mouse ABCA1 transcripts that show similar distribution and regulation patterns to thee human transcripts. We also determined the response of each of these transcripts to feeding off a high fat diet in the ABCA1 BAC transgenic mice.

Thee liver is a major source of lipids and is essential for lipid metabolism. Cholesterol biosynthesis iss controlled by the accumulation of sterols in the liver. These sterols then feedback and preventt further synthesis through SREBP transcription factor mediated pathways. Excess cholesteroll in the liver is also converted to bile and excreted. In addition, it is possible that lipid transportt across liver cell membranes to ApoA-l acceptors also occurs. ABCA1 is found abundantlyy in the liver, and has been shown to directly contribute to plasma HDL-C levels (23,24),, thus indicating a specific functional effect for ABCA1 in the liver.

ABCA11 is also found in macrophages and is significantly up regulated during conversion to foamm cells. Our previous study has shown that when ABCA1 BAC transgenic mice are crossed too the ApoE-/- mice (25), there is a significant reduction in atherosclerotic lesions, but no major effectt on plasma HDL-C levels. Foam cell formation by macrophages is one of the hallmarks of atherosclerosis,, and increased ABCA1 expression in lipid laden macrophages is thought to up regulatee efflux of lipids out of these cells, and reduce atherosclerosis. Our study suggested that thee role of ABCA1 in macrophages is independent of its role in the liver, and one hypothesis forr this finding is that different transcripts of ABCA1 are expressed in the different tissues, each respondingg to different sets of stimuli.

Ourr current study identifies transcripts that are specifically found at different levels in the liver andd macrophages implying different relative contributions of these transcripts to the function off ABCA1 in different tissues, all essential for maintenance of body sterol levels and atherosclerosis. Forr example, the liver contained all three transcripts, with hExonlb and hExonld being found mostt abundantly. All three transcripts were also found in macrophages. However, when the

micee were fed a high fat diet, hExonlb was dramatically up regulated in macrophages, but showedd no change in the liver. In contrast, transcript hExonld was significantly up regulated inn the liver, different from macrophages, in which it was up regulated to a much smaller degree.. The endogenous mouse alternative transcripts also showed identical patterns of up regulation,, indicating similar mechanisms of regulation in the mouse and humans. Thus it is likelyy that ABCAVs function in macrophages, where it is thought to increase lipid efflux and reducee foam cell formation, thereby preventing atherosclerosis, is caused by contribution from thee human or mouse hExonlb transcript. It is also likely that human or mouse Exonld transcripts aree the principal source of ABCA1 in livers responding to excess cholesterol, and therefore havee a vital function in maintenance of plasma and liver lipid levels.

Otherr tissue showing specific transcript upregulation in response to high fat diet feeding were thee aorta, brain, gonad and stomach, where hExonlc was specifically up regulated. hExonlb wass also up regulated in the gonad. Thus, taken together, our data suggest that specific transcriptss are up regulated in response to intracellular lipid accumulation in different tissues, leadingg to different phenotypic consequences. Interestingly, endogenous mouse transcripts alsoo show relatively identical distribution and response to diet stimulation as seen with the humann transcripts indicating similar mechanisms of regulation between the mouse and human inn most tissues.

Sincee these alternative human transcripts respond differently to stimuli, they are likely driven byy different promoter elements. We had previously identified three functional LXR elements in thee intron 1 region of ABCA1, upstream of the transcription start sites for all three transcripts. Wee and others (26,27) also identified upstream CAAT and TATA promoter sequences. In addition, althoughh not functionally confirmed, we have identified t w o putative peroxisome proliferator-activatedd receptor (PPAR) elements that occur upstream of the hExonlb and hExonld transcripts. Thesee PPREs contain direct repeats separated by a DR1 element, and are similar in sequence to thee PPRE consensus sequence AGGTCA (28,29). Three PPAR subtypes exist, PPARu, PPARv, and PPAR(S,, with each showing different tissue distribution patterns and being activated by different factors.. All three PPARs bind to the same PPAR element, and the activation of specific PPARs dependss on ligand availability, the phosphorylation status of PPARs, and the recruitment of co-activatorss and co-repressors. Thus it is conceivable that therapeutics aimed at PPAR activation mayy result in their activation specifically in one tissue over another, or in the activation of one isoformm over another, providing different functional consequences. Along with the previously identifiedd mtronic LXR elements, our study suggests that specific up regulation of individual ABCA11 transcripts could provide a basis for tissue specific regulation of ABCA1 levels Becausee high levels of ABCA1 are atheroprotective, considerable interest exists in developing therapeuticc compounds aimed at raising ABCA1 levels. Since our BAC mouse model has previouslyy shown that reductions in lesions are mediated by increased ABCA1 levels, and are

i n d e p e n d e n tt of HDL-C levels, t h e r a p e u t i c c o m p o u n d s t a r g e t i n g specific p r o m o t e r e l e m e n t s associatedd w i t h t r a n s c r i p t s specific f o r m a c r o p h a g e s c o u l d give rise t o a d v a n t a g e o u s p h e n o t y p e s suchh as a b r o g a t i o n of atherosclerosis, w h e r e a s c o m p o u n d s specifically increasing A B C A 1 levels inn the iivei wiii lesuit in beneficial effects associated w i t h raised HDL-C levels.

References s

11 Wellington, C.L., Walker, E.K., Suarez, A., Kwok, A., Bissada, N., Smgaraja, R,, Yang, Y.Z., Zhang, L.H., James, E,, Wilson, J.E., Francone, 0., McManus, B.M.,and Hayden, M.R. 2002. ABCA1 mRNA and protein distribution patternss predict multiple different roles and levels of regulation Lab Invest 82(3):273-83

2.. Costet, P., Luo, Y., Wang, N., and Tall, A.R. 2000. Sterol-dependenttransactivationof the ABC1 promoter by thee liver X receptor/retmoid X receptor J Biol Chem 275(36)28240-5.

3.. Peet, D.J., Janowski, B.A., and Mangelsdorf, D.J. 1998. TheLXRs: a new class of oxysterol receptors. Curr

OpinOpin Genet Dev 8(5):571-5

44 Chawla, A., Boisvert, W.A., Lee, C.H., Laffitte, B.A , Barak, Y., Joseph, S.B., Liao, D., Nagy, L, Edwards, P.A., Curtiss,, L.K., Evans, R.M., and Tontonoz, P. 2 0 0 1 . A PPAR gamma-LXR-ABCA1 pathway in macrophages is involvedd in cholesterol efflux and atherogenesis. Mol Cell. 7(1): 161-71.

5.. Oliver, W.R. Jr, Shenk, J.L., Snaith, M.R., Russell, C.S., Piunket, K.D., Bodkin, N.L., Lewis, M.C., Wmegar, D.A., Sznaidman,, M l . , Lambert, M.H., Xu, H.E., Sternbach, D.D., Kliewer, S.A., Hansen, B.C., and Willson, T.M. 20011 A selective peroxisome proliferator-activated receptor delta agonist promotes reverse cholesterol transport.. ProcNatlAcadSciUSA. 98(9):5306-11.

6.. Chmetti, G., Lestavel, S., Bocher, V., Remaley, A T . , Neve, B., Torra, I.P., Teissier, E., Minnich, A., Jaye, M., Duverger,, N , Brewer, H.B., Fruchart, J.C , Clavey, V., and Staels, B 2 0 0 1 . PPAR-alpha and PPAR-gamma activatorss induce cholesterol removal from human macrophage foam cells through stimulation of theABCAl pathwayy Nat Med. 7(1 ):53-8.

77 Bortnick, A.E., Rothblat, G.H , Stoudt, G„ Hoppe, K.L., Royer, L.J., McNeish, J., and Francone, O L . 2000. The correlationn of ATP-bmding cassette 1 mRNA levels with cholesterol efflux from various cell lines. J Biol Chem. 275(37)78634-40 0

8.. Abe-Dohmae, 5., Suzuki, S., Wada, Y,, Aburatani, H., Vance, D.E., and Yokoyama, S 2000 Characterization off apolipoprotein-mediated HDL generation induced by cAMP in a murine macrophage cell line. Biochemistry 39(36)) 11092-9.

99 Takahashi Y Miyata, M , Zhe^g, P , mazato.T., Horwitz, A., and Smith, j.D 2000. identification o t c A M P analoguee inducible genes in RAW264 macrophages. Biochim Biophys Acta 1492i2-3j:385-94.

100 Oram, J F., and Vaughan, A.M. 2000 ABCA1-mediated transport of cellular cholesterol and phospholipids to hDLapolipoprotems.. CurrOpinLipidol 1 1(3j:253-60

11 1 Santamarina-Fojo, S., Peterson, K , Knapper, C , Qiu, Y , Freeman,,_ , Cheng, J F , Osono, J , Remale/, A , Yang. XX P , Haudenschild, C , Prades, C, Ch;

mini, G , Blackmion, F , Francois, T , Duverger, N , Rubin, F 'A , Rosier, f." , Denefle,, P . Frednckson, D.S . and Brewer, H B. Jr 2000 Complete genomic sequenceot the r.uman ABCA"1 genee analysis of the human and mouse ATP-bind;

ng cassette A promoter. Proi Natl Acad Sci U S A 97ii 14)7987-92.

12.. Lawn, R.M., Wade, DP., Garvin, M.R., Wang, X., Schwartz, K., Porter, J.G., Seilhamer, J J., Vaughan, A.M., andd Oram, J.F. 1999. The Tangier disease gene product ABC 1 controls the cellular apolipoprotein-mediated lipidd removal pathway. J Clin Invest. 104(8) R25-31

13.. Panousis, C.G., and Zuckerman, 5.H. 2000 Interferon-gamma induces downregulation of Tangier disease genee (ATP-binding-cassette transporter 1) in macrophage-denved foam cells. Arterioscler Thromb Vase Biol. 20(6):: 1565-71,

14.. Porsch-Ozcurumez, M., Langmann, T , Heimerl, S., Borsukova, H., Kaminski, W E . , Drobnik, W., Honer, C , Schumacher,, C , and Schmitz, G. 2 0 0 1 . The zinc finger protein 202 (ZNF202) is a transcriptional repressor of ATPP binding cassette transporter A1 (ABCA1) and ABCG1 gene expression and a modulator of cellular lipid efflux.. J Biol Chem. 276(1 5): 12427-33.

11 5 Langmann, T , Schumacher, C , Morham, S.G., Honer, C , Heimerl, S., Moehle, C , and Schmitz, G. 2003. ZNF2022 is inversely regulated with its target genes ABCA1 and apoE during macrophage differentiation and foamm cell formation. J Lipid Res. 44(5):968-77.

16.. Pullmger, C.R., Hakamata, H., Duchateau, P.N., Eng, C, Aouizerat, B E , Cho, M.H., Fielding, C.J., and Kane, J.P. 20000 Analysis of hABO gene 5'end additional peptide sequence, promoter region, and four polymorphisms.

BiochemBiochem Biophys Res Commun. 271 (2):451 -5.

17.. Schwartz, K', Lawn, R.M., and Wade, D.P. 2000. ABC1 gene expression and ApoA-l-mediated cholesterol effluxx are regulated by LXR. Biochem Biophys Res Commun 274(3)794-802

18.. Bellincampi, L., Simone, M.L., Motti, C , Cortese, C , Bernardmi, S., Bertolini, S., and Calandra, S. 2 0 0 1 . Identificationn of an alternative transcript of ABCA1 gene in different human cell types. Biochem Biophys Res

Commun.Commun. 283(3):590-7.

19.. Singaraja, R.R., Bocher, V , James, E.R., Clee, S.M., Zhang, L.H., Leavitt, B.R., Tan, B., Brooks-Wilson, A., Kwok, A.,, Bissada, N., Yang, Y.Z., Liu, G., Tafun, S.R., Fievet, C , Wellington, C.L., Staels, B., and Hayden, M R 2 0 0 1 . Humann ABCA1 BAC transgenic mice show increased high density lipoprotein cholesterol and ApoAI-dependent effluxx stimulated by an internal promoter containing liver X receptor response elements in intron 1. J Biol

Chem.Chem. 276(36) 33969-79

20.. Bretscher, M.S., and Munro, S. 1993. Cholesterol and the Golgi apparatus. Science. 261 (5126): 1280-1.

2 1 .. Simons, K., and Toomre, D. 2000. Lipid rafts and signal transduction. Waf Rev Mol Cell Biol 1(1):31-9.

22.. Langlet, C , Bernard, A.M., Drevot, P., and He, H.T. 2000. Membrane rafts and signaling by the multichain immunee recognition receptors. CurrOpm Immunol. 12(3)250-5.

23.. Basso, F., Freeman, L., Knapper, CL , Remaley, A., Stonik, J., Neufeld, E.B., Tansey, T , Amar, M.J., Fruchart-Najib,, J, Duverger, N., Santamarina-Fojo, S.,and Brewer, H.B. Jr. 2003. Role of the hepatic ABCA1 transporter inn modulating intrahepatic cholesterol and plasma HDL cholesterol concentrations. J Lipid Res. 44(2):296-302.

24.. Wellington, C.L., Brunham, L.R., Zhou, S., Singaraja, R.R., Visscher, H., Gelfer, A., Ross, C , James, E., Liu, G., Huber,, M.T., Yang, Y.Z , Parks, R.J., Groen, A , Fruchart-Najib, J., and Hayden, M R . 2003. Alterations of plasmaa lipids in mice via adenovirual mediated hepatic overexpression of human ABCA1. J Lipid Res. May 1 epubb ahead of printing.

255 Singaraja, R.R., Fievet, C, Castro, G , James, E.R., Hennuyer, N , Clee, S M,, Bissada, N., Choy, J.C., Fruchart, J.C.,, McManus, B.M., Staels, B., and Hayden, M R . 2002. Increased ABCA1 activity protects against atherosclerosiss J Clin Invest Invest 110(1 ):35-42.

26.. Cavelier, L.B., Qiu.Y., Bielicki, J.K., Afzal, V , Cheng, J.F.,and Rubin, E.M.2001. Regulation and activity of the humann ABCA1 gene in transgenic mice. J Biol Chem. 276(21): 18046-51.

27.. Qiu, Y., Cavelier, L.Chiu, S., Yang, X., Rubin, E., and Cheng, J.F. 2001 Human and mouse ABCA1 comparative

seqii iPnrinn and tran^rpnp^k «-tiidipc IPVH-ÏI""J ru^ul rnq. jl^-.ry rnq!jnn,~^r- '"rr^.niicz ^ 3 i 1 ; 6 L ,'L

28.. Smith, S.A. 2002. Peroxisome proliferator-activated receptors and the regulation of mammalian lipid metabolism.

BiochemBiochem Soc Trans 30(6): 1086-90.

29.. van Bilsen, M., van der Vusse, G.J., Gilde, A.J., Lindhout, M., and van der Lee, K.A. 2002. Peroxisome proliferator-activatedd receptors: lipid binding proteins controling gene expression. Mol Cell Biochem. 239(1-2}:131-8. .