• No results found

The diagnosis and prognosis of venous thromboembolism : variations on a theme - Summary

N/A
N/A
Protected

Academic year: 2021

Share "The diagnosis and prognosis of venous thromboembolism : variations on a theme - Summary"

Copied!
7
0
0

Bezig met laden.... (Bekijk nu de volledige tekst)

Hele tekst

(1)

UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl)

UvA-DARE (Digital Academic Repository)

The diagnosis and prognosis of venous thromboembolism : variations on a

theme

Gibson, N.S.

Publication date

2008

Link to publication

Citation for published version (APA):

Gibson, N. S. (2008). The diagnosis and prognosis of venous thromboembolism : variations

on a theme.

General rights

It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons).

Disclaimer/Complaints regulations

If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible.

(2)

Summary

Summary

Summary

Summary

Summary

Summary

Summary

Summary

Summary

Summary

Summary















Summary

         

(3)



160

S

UMMARY



In this thesis new variations on the themes diagnosis, prognosis and treatment of venousthromboembolismarediscussed.InpartIaspectsofthediagnosticprocessof venousthromboembolismareevaluated,andinpartIIsomeaspectsoftheprognosis, aswellasthetreatmentofpulmonaryembolismaredescribed.

P

ARTI

DIAGNOSISOFVENOUSTHROMBOEMBOLISM



Chapter2givesanoverviewoftheepidemiology,etiology,diagnosis,treatmentand prognosisofpulmonaryembolism. InChapter3avalidationoftheWellsclinicaldecisionruleindicates,thatalthoughthe odds ratios of the 7 items of the rule did decrease, the prevalence of pulmonary embolism in the three clinical probability groups are fully comparable to the prevalence distribution originally obtained. Therefore, seven years after the introduction of the Wells rule the diagnostic power of this simple tool remains adequate.However,duetotheregressionoftheoddsratiosoftheindividualitems,a simplificationoftheWellsclinicaldecisionrule,byassigningonepointtoeachitemof theruleseemedattractive.Ourfindingsshowthatbydoingso,usingacutoffvalue of 1 or less, the diagnostic power remains comparable to this slightly more complicatedcomputationoftheoriginalrule.

AvalidationofthissimplifiedWellsruleispresentedinChapter4inanindependent large cohort of patients with suspected pulmonary embolism. It is shown that the proportion of patients categorized as pulmonary embolism unlikely is similar using the original Wells rule and the simplified version (78% and 70%, respectively). The prevalenceofpulmonaryembolismis13%and12%,respectively,inpatientswithan unlikelyclinicalprobability assessment.Therefore,thesimplifiedWellsrule appears tohavethesamepredictiveaccuracyastheoriginalruleandasimilarclinicalutility intermsoftheproportionofpatientsinwhomthediseasecanbesafelyexcluded. Chapter 5 evaluates by questionnaire based survey the implementation of clinical decision rules and Ddimer assays in clinical practice of internists and pulmonologists. Our findings indicate that although physicians are aware of the guidelinesforthesetestsforthediagnosisofpulmonaryembolism,theydonotuseit consistently. Furthermore, the knowledge of an abnormal Ddimer test result before seeingthepatient,leadstoahigherclinicaldecisionrulescore.Therefore,physicians

(4)



161

S

UMMARY

should be cautious in requesting Ddimer assays, and they should first examine the patientbeforetakingnoticeoftheDdimertestresult.

ThisisfurthersupportedbythefindingsinChapter6thatshowthatinpatientswith anormalDdimerindependentoftheclinicalprobabilitythethreemonthVTEriskis 2.3% with an upper level of the 95% confidence interval of approximately 4%, whereas in patients with a likely clinical probability despite a normal Ddimer approximately 1 in 10 will still have pulmonary embolism. These patients with a likely clinical probability should undergo further testing, regardless the Ddimer outcome.

The findings of the measurement of the prothrombin fragment 1+2 (F1+2) concentration,reportedinChapter7revealalowerareaundertheROCcurveforthe fragment,relativetoDdimer(0.69and0.82,respectively;p<0.05).Furthermoreusing the information from F1+2 levels in patients with an abnormal Ddimer does not resultinaclinicallyusefulimprovementofexcludingthedisease.

In Chapter 8 the safety and efficiency of two diagnostic ultrasound strategies are compared in consecutive patients with suspected deep venous thrombosis (DVT). A total of 1002 patients were included and in 481 patients with an unlikely clinical probabilityandanormalDdimertestresultDVTwasconsideredexcluded(3month VTE rate 0.4%; 95% CI 0.051.5%). All others were randomized to undergo either a rapid CUS, repeated if necessary, or a single complete CUS examination. DVT was confirmedin59ofthe257patients(23%)thatunderwentrapidCUSandin99ofthe 264patients(38%)thatunderwentcomplete CUS.Venousthromboembolismduring followupoccurredinfourpatients(2.0%;95%CI0.65.1%)intherapidCUSarmand in2patients(1.2%;95%CI0.24.3%)inthecompleteCUSarm.Hence,itisconcluded that both the rapid and the complete ultrasound test are comparable and efficient strategieswithdifferingpro’sandcon’s.

P

ARTII

PROGNOSISANDTREATMENTOFPULMONARYEMBOLISM



InChapter9theprognosticvalueofrightventriculardysfunctionisevaluated.Seven studies that used echocardiography to diagnose right ventricular dysfunction were reviewed and they show that there is an association between right ventricular dysfunction and prognosis of pulmonary embolism in normotensive patients. Whether this is clinically useful in guiding more aggressive therapy, remains to be determined.Thusfar,theresultsofthestudiesthatusedspiralcomputedtomography

(5)



162

to measure right ventricular dysfunction are too preliminary to enable definitive conclusionstobedrawnforthenormotensivepatientgroup.

Concerning chronic thromboembolic pulmonary hypertension (CTPH), our findings in chapter 10 do not support an active and systematic search for this disease in patients with a history of recent pulmonary embolism. Only one patient out of 110 patients (0.9%; 95% CI 0.024.96%) with pulmonary embolism was known to have CTPH, and this patient was diagnosed before our investigation. However, a low threshold approach in those patients with complaints of dyspnoea on exertion is warranted.

Chapter 11 is a survey of how patients with pulmonary embolism are treated inthe Netherlandsin2006.Intotal94%ofall140patientswithpulmonaryembolismwere admittedtohospital,withameanstayof8.2days(range152days).Itwasnotclear what the considerations were of physicians to treat patients in hospital for a certain period,butitcouldbeduetoaroutinesettingofadmittingpatientswithpulmonary embolism,ratherthanclinicalconsiderations.SecondaryprophylaxiswithvitaminK antagonists usually lasted 6 to 12 months and the treatment duration was guided mainly by well known risk factors, such as the presence of malignancy or previous venousthromboembolism.

 

(6)
(7)

Referenties

GERELATEERDE DOCUMENTEN

The MAF of four of these SNPs were significantly reduced in HIV-1-positive individuals when compared to healthy controls, two of these SNPs were also associated

Most of these studies aimed to find common genetic variants associated with susceptibility to HIV-1 infection or control of HIV-1 replication and disease progression upon

The minor allele of SNP rs2304418 in PDE8A, a gene previously identified to affect HIV-1 rep- lication in genome scale RNAi studies reporting several hundred novel HIV-1 dependency

Door vervolgens genoom-breed SNPs te vergelijken tussen mensen met macrofagen waarin hiv zich zeer makkelijk dan wel zeer moeilijk vermenigvuldigde, hebben we aanwijzingen

Verder wil ik ook graag Maarten van de Klundert, Viviana Cobos-Jiménez, Judith Burger (“Huh?”), Lauren Setiawan (AH hamster), Brigitte Boeser-Nunnink, Ellen Kwak, Madeleine Bunders,

He performed internships at the Laboratory of Molecular Biology of Wageningen University on methyltransferases in Arabidopsis thaliana roots and at the Laboratory of

All authors were affiliated to the Department of Experimental Immunology, Sanquin Research, Landsteiner Laboratory, Center for Infection and Immunity Amsterdam (CIN-

TGCCCATTGTTTTCAGAATTATATCAGTAAGC ATCAGTAATCATCCTTTGATTCTATCGGAGTA TTCTGGTTTCTTTTTGATCTGCTTTCCCAGAG GAGTCTGAAGATGAGCTCTTATCATTGGTATT