Characteristics of effectors that are involved in plant infestation expressed by the whitefly Bemisia tabaci and nematode Meloidogyne graminicola

Characteristics of effectors that are involved in

plant investation expressed by the

whitefly Bemisia tabaci and

nematode Meloidogyne graminicola

Research proposal by Yemi Cole (11931159)

14/07/2020

Bachelor Biomedical sciences University of Amsterdam

Faculty of science Science Park 904 1098 XH Amsterdam

Abstract:

Infestations of pests organisms across the world is a great problem for the production of crops in agriculture and horticulture. Infestations of pests continue to exist partly because of the secretion of effectors. Effector proteins are able to regulate the biochemical activities of other biomolecules. Pest organisms use these effector proteins to negate or alter defensive biomolecules which are being activated by their host plant after infestation. Nematodes and whiteflies are among one of the most important pests and information about the effectors they use to alter plant defense systems is lacking. In this study, putative effectors secreted by whiteflies Bemisia tabaci and putative effectors secreted by nematodes Meloidogyne graminicola were analyzed. Sequence specific characteristics which were analyzed with online tools predicted that all effectors of whiteflies contained a signal peptide. Agroinfiltration of nematode effectors in tobacco plants also showed the importance of the presence of a signal peptide. All effectors analyzed in this study have also showed a diverse

translocation to different cell compartments of the plant. The methods used to analyze these effectors have shown to be effective and can be used in future research to study a wider range of putative effectors. Also, the information of different sequence specific effector characteristics provided in this study, and information about these characteristics provided in other studies or subsequent research can be combined. This could result in novel solutions to the control of pest organisms to be achieved in the future.

Introduction:

As the world population continues to increase, the efficient and sustainable production of food becomes more important. Therefore, we become more reliant on increased production of crops from agriculture and horticulture. Unfortunately, production of crops is reduced due to the infestation of pest organisms (EC Oerke, 2006). These losses indirectly occur partly due to the transmission of effectors and viruses. Some of the invasive organisms that are responsible for these losses are in fact the product of a very successful evolutionary process. They have evolved a special mechanism which comprises the use of effectors to invade their plant host. As plants harbor different kinds of physical and chemical defense systems, parasitic intruders make use of effectors which can alter the plants defense system for their own benefit (Kaloshian & Walling, 2016). Salivary glands of these organisms contain a great variety of different biomolecules that can overcome chemical plant defense systems (Will et al, 2013). Phloem feeding insects such as whiteflies or pea aphids are among the most important pest insects which make use of effectors to negate the host plant defense system (Rodriguez et al, 2017; Xu et al, 2019). They use their stylet to puncture through plant cells for feeding and the secretion of effectors.

Relatively more research has been performed on effectors from pea aphids compared to effectors from whiteflies. For whitefly effectors, only a few studies can be found compared to effectors from pea aphids. Most of these whitefly effector studies focus on different aspects of one single effector protein (Xu et al, 2019; Wang et al, 2019). Which unfortunately results in a small field of knowledge on the different range of whitefly effectors that excist. The research that will be described in this paper focuses on a number of new effectors and will provide information about their sequence specific characteristics.

It is also interesting to see that another organism, nematodes, invade their plant host by moving into the plant tissue. These organisms also make use of effectors to negate the plant defense system. Thereby, nematodes are also responsible for the damage of crops in agriculture and the subsequent economic losses that come along (Bauters et al, 2014). One particular study performed a research on the infestation of the nematode Meloidogyne graminicola. Padgham and his colleagues (2004) described the negative impact that these plant parasitic nematodes had on rice yields in Bangladesh and the damage that they can inflict. A good amount of research has been done on effectors deriving

from nematodes. Different genome, transcriptome and proteome studies of nematodes have shown a large number of effectors involved in host plant alterations. Unfortunately, the function of the majority of these effectors are yet to be determined (Haegeman et al, 2012).

Because this study sets out to enhance the understanding of certain effectors in plant pest organisms, the focus of this research will be pointed towards the whitefly Bemisia tabaci and the root-knot nematode M. graminicola. In this way, the overall structure of this paper takes the form of a research which is based on two basic research themes. One of which will be focused on B. tabaci and the other on M. graminicola. For both, several putative effectors were selected for analysis and research. The following two paragraphs of this introduction will give more information on the two basic research samples in this paper.

Whiteflies use their stylet to feed on the phloem of plant leaves and excrete saliva which contains effectors. The few effectors that have been studied in previous research can have a range of different biochemical activities (Wang et al, 2017). These effectors can detoxify the biomolecules deriving from the host plant and subsequently provide the whitefly with an advantage (Yang et al, 2017). Whiteflies in particular are interesting to study because of the nymph stage through which they develop. These nymphs are flat and oval shaped and lack both legs and antennae. This makes the nymphs morphologically immobile and are therefore closely attached to the host plant (Cuthbertson et al, 2007). The characteristics of prolonged attachment to the plant surface during the prescribed life stage, and their use of effector proteins make whiteflies very interesting for research. In this paper, a number of different whitefly effectors will be analyzed. With the use of several online sequence analysis algorithms, the domains in these effector sequences will reveal several

characteristics. Nuclear localization domains, subcellular localization patterns and the presence of a signal peptide will be key characteristics to identify. This signal peptide is present in the majority of effectors and is an important element of the protein. It functions as a signal for secretion from the whitefly to the target host plant. The purpose of this part of the research is to explore the

aforementioned sequence elements. Which will be used to investigate what effector characteristics are important for the infestation of the host plant. The presence of a signal peptide is often stated to be important for the secretion of effectors (Whisson et al, 2007; Carola et al, 2011). Therefor, it is hypothesized that a majority of the effectors will have a signal peptide. As effectors can accumulate in different parts of the cell. It is also expected that a majority of the effectors analyzed will

translocate to a wide range of different cell compartments.

As described earlier, nematodes also play a major role in the invasion and subsequent devastation of crops. As plant-parasitic nematodes rely on their plant host for feeding and reproduction, effectors are secreted which mediate these processes. M. graminicola is among one of the most damaging types of nematodes. These species invade the root tips of rice plants and migrate between the plant cells until they find a feeding site (Kyndt et al, 2014). The release of effectors from their esophageal glands helps the nematode induce these special feeding sites and negate plant defenses (Hewesi & Baum, 2013). This part of the research will focus on visualization of effectors that are secreted by these nematodes. And tries to look at the importance of a signal peptide, by analyzing whether they will have the same effect in plants as in nematodes. Transient expression and fusion to a GFP

molecule, by means of agroinfiltration, in Nicothiana benthamiana leaves will visualize the delivery of effectors to plant cells. The focus of the agroinfiltration will be centered towards the presence of a signal peptide. In situ hybridization will locate and help confirm the expression of these effector proteins in nematodes.

Effectors can be specifically excreted to the apoplast (Asai & Shirasu, 2015). The effectors from M.

graminicola analyzed in this experiment are known to be excreted to the apoplast and as the

function of a signal peptide is important for secretion. It is hypothesized that the effectors with a signal peptide will be secreted to the apoplast by the plant itself as well. For the effectors without a signal peptide, it is expected that they can be visualized in a range of different cell compartments, likewise previously described for the effectors in whiteflies. As the pharyngeal glands are known to

be important secretory organs for the secretion of effectors through the stylet (Haegeman et al, 2012). It is thought that both effectors observed in this research will show visualization around the medial area of the nematode, because this is the location where these pharyngeal glands are situated.

Material & methods:

Background information of the obtained sequences

Effector sequences used in this research were provided by colleagues based at the Swammerdam institute of life sciences (plant-insect research line). The putative whitefly effector sequences (B8, B9, B11, P1 and G1) used for analysis in this research have been identified with different methods. B8, B9 and B11 were identified with RNAseq performed on the glands of adult whiteflies. P1 was identified by proteomic analysis of plant phloem containing whitefly effectors. G1 is a protein that was identified by whitefly saliva analysis. Raw data (nucleotide sequences of B8, B9, B11 and amino acid sequences of P1, G1) was Blasted to a whitefly genome database, and alignment sequences with the highest scores were used for further analysis (table 1). Putative nematode effector sequences UK8, UK42 and UK50 were provides as sequences in fasta format and used for agroinfiltration analysis. UK8 and UK50 were also used for analysis of the in-situ hybridization experiment.

Sequence analysis

For the identification and analysis of the sequences used in this research, a number of computational programs / web server algorithms were used. The whitefly genome database

(http://www.whiteflygenomics.org/cgi-bin/bta/index.cgi) was used for identification of the whitefly effector sequences derived from the raw data provided (Chen et al, 2016). Raw data of whitefly effectors consisted of contig sequences which were blast searched with the aforementioned websites. Nematode effectors were provided in fasta format.

Signal peptide presence in the sequences was predicted with SignalP 5.0 server

(http://www.cbs.dtu.dk/services/SignalP/). Sequence alignments were performed with Multalin (http://multalin.toulouse.inra.fr/multalin/multalin.html), (F Corpet, 1988). For the identification of possible nuclear localization domains in the sequences, a web server with SeqNLS algorithm was used (http://mleg.cse.sc.edu/seqNLS/), (Lin & Hu, 2013). Subcellular localization patterns were identified with the PSORT computational prediction tool for subcellular localization

(https://www.genscript.com/psort.html?src=leftbar).

Agroinfiltration

Transformation of Agrobacterium GV3101

For the subcellular visualization and localization of UK8, UK42 and UK50 , transient expression in the epidermal cells of Nicothiana benthamiana leaves was mediated by the Agrobacterium tumefaciens strain GV3101. To make them heat shock competent, cells were grown in 5 ml LB overnight at 28°C. 2 ml of this overnight culture was then shaked at the same temperature until OD600 reached 0.6. Cells were centrifuged multiple times and 100 µl was dispensed into prechilled Eppendorf tubes. GFp fused effectors with 1µg of pk7FWG2 and pk7GW2 were then added to the bacteria cells, freezed together in liquid hydrogen and thawed in a 37°C water bath. The cells were then spread onto LB plates and incubated at 28°C for 3 days.

Infiltration of the tobacco plants

A pellet of Agrobacterium cells was dissolved with 10 ml infiltration buffer taken from a total of 100

ml containing 1 ml 1 M MgCl2, 2 ml 0.5 M MES and 200 µl 0.1 M acetosyringone for 3 h, to make

them ready for DNA transfer to the plant cells. The suspension was centrifuged again followed by a second dissolvement with 5 ml infiltration buffer. OD600 was measured from a 1:10 dilution of different Agrobacterium cultures followed by dilution with infiltration buffer until concentration was 0.01 with OD600 . The cultures were left 3 h in the dark. The tobacco plant leaves were punctured with a needle in-between two veins and cells infiltrated with a syringe from the backside (abaxial) of the leaf. After 2 days the appearance of GFP fused effector sequences were investigated with a confocal microscope. GFP was detected at an emission between 515/525 nm respectively.

In-situ hybridization

For the whole mount in-situ hybridization performed on Meloidogyne graminicola, UK8, UK42 and UK50 effector sequences were analyzed. These sequences were amplified from cDNA using PCR on the primers listed in table 2. The protocol for the preparation of the digoxigenin-labeled probes of the sequences was performed as described by Haegeman et al (2013) . In-situ hybridization was performed according to the protocol of De Boer and his colleagues (1998) using a hybridization temperature of 47°C instead of 55°C

Table 1. Nucleotide sequences of effectors used The different nucleotide sequences of whitefly and nematode effectors

used in this research are listed. P1 > Bta09986 ATGAAGTGGGCTTTGCTGGGCTTAGCGCTTCTGGCTGTGGGCGCCTACGGGTACCCGATCAACGAGAAGAAGCAGGACGTCGTCATCGGGGCTACTCCA AGGTGAGCGACGCGAGTGCCCCGGTCGTCCCGGTGGCCGCTGACGCCCCCAAGAGCGAGCCGAAGCCGGTGGCCGACGAGCCGAAACCCACGCCCGCT GCCGCCCCGGCCACCGAGTCCAACGCCATCAAGAGCGAGGAGAAACCAGAACCCACCGCCGCCGCCCCAGCTGCCCCAGCTGCGGCCGAGGCCCCTAAG AAGGAGGAACCCGCCGTCGTGTCCCCAAGCGAGCCCGCCAAGGACGCAGTTGCAGTTCCTCCTCCCGCCGCCGTCGTCGACGAAGCCAAAAAGGCCGAG GACGCCAAACCCGTAGCCGAAGAGAAGAAGGAAGAACCCAAGAAGGAGGAACCCAAGAAGGAGGAAGAGAAGAAGGAAGAGAAGAAGGAGGAAAA GAAAGAGGAGCCAAAGAAGGAAGAGCCCCTCAAGGAAGACAAGAAAGAAGAGATCAAGCCTGCAGCCAGCGAAATCTCCGAGCAGAAGGTTATGGAC CCAGAGACCCCGAAAGGCGAACCCGTCAAACCCGAGGACGCCCCCAGGAAGGAAGAAACCAAAACCGCTGAGGTCCCCGCGGTAGTCGCCTCTTCGGAG TCCAAACCGGAGAAACCAGCCGCCGACGCCCCTGAGTCCAAACCAGTCGTCCCACCCGTAGTCTCCGAAGTCGCCCCCACCCCGAAGGTCGACTCCCCCGT CGTAGCCGCCACCGAAGAGAGGAAGGAGACTGTCGCCGCCGCCGAAGTCACCCCCGCCCCCGAAGAGCCCAAGAAAGAGGAAGTCAAGAAAGAAGAAG CCAAAGAAGAGAAGAAACCCGAGATGGACTCCAAGCCCGTAGAAGAGAAGAAGGAGGAGAAGAAGGAAGAAAAGAAGGAAGAGAAGAAGGAAGAG AAGAAGGACGAGCCGAAGAAGGAAGAGAAGAAGGAAGAGAAGAAAGAGAAGAAAGAAGAGAAAGAAGACAAGAAAGACAAGAAGAAGGAGGAGTT CAAAGAGAAGGAGATGAAGAAAGAAGAGATGAAAGAAGAGAAGAAGAAGGCCTCCGACGCCGACGCCGCGCCCTCCCACTCGAGCTAA B8 > Bta05737 ATGGCCGCTTTCGTGAAAGCGACTCTTTGCCTTATCGTGCCATTGCTTCTTCTGCAGCTGCAGACTGTTCGTTGCGATGAAGATGACGAGGGAGGCGTAGA GGGAGCGGGGGAGGATGATGAGGCGGGGGAAAAGCATGAATCGGATGGACCGAGTAGATCCGAGCCGTTGAGTTGGGACGATCTCCAGTACACCAGA CTCCAGGAGATAAACACCGTTGCCAAGAAGATCACCGAAACTTTCAACCCCGATTCGTGCCCCCTCGCAGCCGCCGAAGCCAAAATCAAACCGCTCAGAA GTGCCGCCCAAGTGGACAATGTCGTGAACAAAGCTCTGGAAGAGGTGAGCGGCGGTTGCTTGAAGAAGAAGACGAAGGAGGTGGACGAGTTGCTATGC TCCGTGGGTCAGCGCTTCAAGCGACACCTCAAATCCGTCGTTTCACTCGCCGAACTCCTCGCCGAACACGAACGCCCCGAATTTCTTGAAATCACCAAAACT GCGCCTGTCGTCGACGATGAGAAGTTCAAAGAGGCCATCGAGAACCTGAACCCGAACAACGAGCAGAAAAACCTGCAGGTGGACCTAAAAGCCATCGCC GAACAAGTGAACGCTAAGTTCGGTTCAAACCCTCTCGGACGAAAGGAACAGGCCTACACGAAACTGGCAGCGGCCCGTGAACAGGTTGGGGGCGCCGTT AAAAACGTCATGGATGGCGCCAACGTGGCGTTGAACTCCTTCTTTGACGCCATGATCGGAGTCAAGAACGTCCAGCGAGAACTCAAGAGCACCCAAGAAT ACCCCAAGGACATCGCCGAAGAAGAGGCTCGCATCAAGAAAGCCCTCGCCGTCTACAAGGCTCTCGGTTGCTCCAAGGTTAACGACGCCAAGGATGACG ACGATGATGATGCTAGTGCTCGCCGCTGA B9 > Bta06886 ATGCACTGCAGTCTGAGTTTCAAGTTTTCAGACATGGGTTTCAGGCGTAAACCATTTCTCCTCCTATTTGTAGCCGCCATACTTCAGGTGCAGTTTCCTCCAT GTGCCTCCGATTCAACTCAAAATGACGGTCTGGATCTCAAAGATGTCCAGCTAGCCGGACCATTGGCGAATCAACTACCAACGCAGGCGGCTCCCGACAA GAAAGCAGAGATTTCAGCAAAGATAAAAGCCAAACTCGCAGAGATGGAATCCTTGAGGAAAGAGAAGGAAGAGCTTCAGAGAGCGCAGCACGAGGAG ATCCGCGCTAAAGCAGACGAGCTGAACACAGAATTCCAGGCTGAATTGAAGCTACAAAACGAGGAGAGAGTCAAGATCAGTGAAATCCAGAAAAAAGCC CAGGAGGGTTACAGAAAAATCGATCGTGAAATTCGAGAGCTTATCAGGGAAGTGAGACGAAACAGACGTGATGCGGAAAAGAAGGCAGACCTGGAAAA ACAGCTGGCACAAAAGAGGGAGGAACGTACGGCGCTGGAAAACGAGACTAAAAAGAGTAGGAACGCTATTGCGGATCAGAGGAAAGTCCGAGTTGAT GCTCTGCAAAAGAAGTCTGATGAGATGATGGCCGAGAAAAGGAAGTTGGAGGAGGACACGCGCAAGGAAGTCCGTGAGATTGAGAGAGAGCTAAAATC CGTGCTGGAGGAATTATCGCAACTGCGAAGAGATTTCAGGAGAGCGAATTGGGGATTCTGA

B11 > Bta09064 ATGAACTCGAGAGGAGGATGCATCGTGATTCTGTCACTCCTTGTAGGGAGTGCGCTCACAGAAGAGACAGGAGAAAAGTTTGGCATGACAGTCGTCGAA TCTCCAAACCCCATGAATTTTCCACATCCCTTTGATGAGTACGAGAATTTAGGACATTATCACTATGCGTCCGCGATTCCATATCAGGACCAAAATTCTGGA AAAAATAATCAAGGGAACACGCTCCATGCCGCACAGCCTCGTAGGAATTCCGGTCCAGCGGACTCGACCATACAAATGAAAGGGCAAGAGATGTCAAAG CAACCCTTGGACACCGTCAGGGATGATCTCGAGGTTAAGAGCCGAGAACACGCTTCAGACAGCCTCAAAAGTGGTCAAGAGAAAATCGTGGACATACCA ATAGAGGGCGCTGATGAAACCCTTGACACTTTCGTGGTCGACGAAGAAAATCCCTCGACCAATCACGTTGCCACTCCGAACGTGAGACCAAATGATGTTTC TCCCAGCAACACAGCGTCACTCTCAACGCTCCTACAAGGAATCAGGGATTTGCGTCTGACCGTCGGAGAAATGGACGAGAAGTTGGATAGATTAATAGAA AAGCTAATTCCAAATAACACCAAGGGCAATCCAATGATCAGGAAAGGTGTCGCTTGGTTCAATAAATTACTACATCGTGACAGCGTGCAGGGTCCAGCCA AGGTGCAACAACACCAAACAGACTCAGCAGAAGGAAAGAACCATCAAACAATGAGATGGATGAACTACTTCCGCAGCCCGTCTTCTTAA G1 >Bta14287 ATGCACGTGTACTTACTCTCAGCGGTCGCTATCAGTATCTTTTTAAACTTTCAGGAAGCGGTTGGTTGGAAGGCGACAATTTATGATGATGTACAACATGG CAAGACTTTGCAAACTTTGTCGGGAGGCCCTTGCCAGGAGGTGAAAGACGCCAATAATGACAGAGCTTCCTCAATCAACACTTGGGGTGGGTGCGTGGTT ATTTATAGTGATTTTCAGTGCAAAGGCACCAACAAAACGATGAGACCCGGGAGTCCTCATCATAAAGATTTCAAACTGCTACACTTCGATAATGTGGTATC TTCCATCGGTCCTTGCCCTTAG UK8 >UK8 ATGAATTTTTCTATTTATACTGTTTTTCTATTCTTTCTGGCTATTTTAGGTCTTTTTTCTTCTGAAAGTAAAGCTCAACAACCACCACCTAAACCAGCAACAGTT ACTGCTGTAAAACCAGGAGTACCATCACCACAACAAAAGACTGGGGGAAATAAAGACTCTTCTGAGTCAGATGAAGACGACAAAATTTCCCATCAAAAAA CAAATTCTACAACTGGGGCTGCTCCTCCACCTATCCCAGCATTTTGCCAACAAAATGCTGCTGATCCGGCCGTTCAAAAATGTTGTACAGCACTAAAAACAG CAGCTGCTGCGCATAAAGTGGTACAAGGCGCTGTTAAATTGCCAGAATGTGTTCAGTGTGGGCAAAAATGTAATAATGCACCTACAGTAAATGGTGCTGC ACATACTCAGGTTGCAGCAAATGCTCCAAAACCACATTAA UK42 >UK42 ATGAATTTTCTCGCTAATTTAATTTTATTAACTCTGCTTTCTTCACTTAATATTTCTTTTATTCGTGGTGACTGTTCAGATGATTGGTCCTTGTTTTCAGACGAA AATGGCAATAATTTTGGTTATCAAGTAGTCAAAAGAGATTATCTTATCAACTTTTATACAGCCCGAGTAATCTGCAAAGAAATTGGCGGAAACGTTGTCAG TATTCACAGCCAAGATGAAAACGATTTTGTCGCGCAATTGCCCGGGACAGCCAGTTCAGCACTGTGGATTGGATACCATGTTTTACAGAACAATGACAGCT CCCTTACCTGCCTATGGACTGATAAAAGTAATTCTGCTTACGGTAACTATACTTCGGTAGATGATCCAAATAGACAAAACAATCCATGGTTGGCATTGGACC CAGTTTTGACTGACCCATACGGAGATCCCAATCAATGTGTTGAAATTGTCGACACATCTTTTGATACCTTTGACAGCGCAAATGTTTTATGGCTCGAAACCC CTTGCTATTCTCGCATTAATGGAGTAGTGTGCAAAATGGACTGTTCAGCATAA UK50 >UK50 ATGGCTAAAATCAATTTTATAAAATTTATTCTAATTGTACAACTTTTGTTTTTGGTCATTTACCAAGTTCAACTTGTTGTTGCTGGTTCAGATGAAGTTGAGCC ACAAACAGCTAAAAATGAAAGTGAATTTAAAGAACGTTCTTCCTTCAAGCTATATTCTGATACCTTTAGGCCAATGAAAAACGCTGTAATATCGCCTACAAA CCCACATAAGGAAAGACGTGAAGGAAGAAAACTCCCTCTCAGTCGATTGGGACTCCAAGTAAATTAA

Table 2. Listed are the primer sequences used for the amplification of the nematode genes UK8, UK42 and UK50.

Gene F/R Primer Primer sequence

UK8 Forward 5’ ATGAATTTTTCTATTTATACTG 3’

Reverse 5’ TTAATGTGGTTTTGGAGCAT 3’

UK42 Forward 5’ TGGTCCTTGTTTTCAGACGA 3’

Reverse 5’ GGGTTTCGAGCCATAAAACA 3’

UK50 Forward 5’ GATCGCAGAAATTTATTTTTCTTTT 3’

Results:

Sequence analysis of Bemisia tabaci effector proteins

Table 3. Whitefly effector sequence characteristics. Different elements found after analysis with online computational

predictor programs are listed

Gene ID Size nt Size aa Signal P NLS SBL

P1 Bta09986 1176 387 Yes. Probability: 0.95

(Cleavage site aa20-21) Yes. Probability: 0.87 (start aa45 – stop aa73) 56.5% nuclear

B8 Bta05737 924 307 Yes. Probability: 0.98

(Cleavage site aa25-26) No 33.3% extracellular

B9 Bta06886 753 250 Yes. Probability: 0.61

(Cleavage site aa37-38) Yes. Probability: 0.86 (start aa41 – stop aa50) 43.5% nuclear

B11 Bta09064 789 262 Yes. Probability: 0.80

(Cleavage site aa17-18) Yes. Probability: 0.5-0.7 (start aa38 – stop aa46) 55.6% extracellular

G1 Bta14287 324 107 Yes. Probability: 0.77

(Cleavage site aa22-23) No 30.4% cytoplasmic

Size nt - Size nucleotides Size aa – Size aminoacids SignalP – Presence of signal peptide NLS – Nuclear localization signal SBL – Subcellular localization

Sequences obtained from proteomics and transcriptomics data from whiteflies B. tabaci were analyzed with different online sequence algorithms. As expected, the presence of a signal peptide was found in all of the whitefly effectors. Which is in line with the aforementioned hypothesis. The probability of the found signal peptide signals in all five sequences are relatively high. The program for subcellular localization (SBL) prediction listed a couple of possible cellular compartments to which the different effector sequences could be translocated. K-nearest neighbor algorithm (k-NN) is the non-parametric method used for the classification and regression. The cell compartment with the highest percentage score, or ‘k closest neighbor’, was used as the predicted SBL. P1 had a relatively high SBL for the nucleus, which is also in line with the nuclear localization signal (NLS) found with the other online sequence predictor. B8 has an extracellular SBL of 33.3% and no NLS. Likewise, G1 does not have a NLS but has a cytoplasmic SBL of 30.4%.B9 also shows a correlation between de SBL and NLS. Interestingly, B11 shows the presence of an NLS but is having an extracellular SBL of 55.6%. But it is important to note that the presence of this NLS can be questioned because the probability is relatively low.

Visualization of expression of UK8 and UK50 in Meloidogyne graminicola The localization of two putative effector proteins secreted by

Meloidogyne graminicola were analyzed with in situ hybridization. The

expression of UK8 (Fig 2 a-b-e) and UK50 (Fig 2 c-d)

can be observed by the dark spots visible in the body of the nematode. These results are partly in line with the hypothesis which described visualization in the medial part of the nematode for both effector

proteins. Only UK50 confirms the expression around the medial region of the nematode. Two different samples taken from M. graminicola

indicate expression of UK8 in the region were the amphids are located. Visualization of UK50 shows staining around the subventral/dorsal glands. These glands play a role in the secretion of effectors because they are one of the three distinct secretory organs of nematodes (Rosso

et al, 2011). One negative control was performed on UK8 which showed

no staining. This negative control indicates a presence of minimum background staining which could alter the results.

Figure 2

Whole mount in situ hybridization of the putative effectors UK8 and UK50. A hybridization signal can be identified as the

dark shade in the samples. In situ hybridization performed on M. graminicola showing the expression of a) UK8, b) UK8, c) UK50, d) UK50 and e) negative control of UK8. Arrows indicate staining of UK8 in the anterior amphid/stylet area of the nematode, and of UK50 in the subventral/dorsal gland area. The negative control shows no signal.

Anterior part of a plant parasitic nematode. Different parts of the nematode are shown. Clearly depicted are the amphids located in the anterior part of the nematode, surrounding the stylet. Image edited from source: (Hussey et al, 2002)

Figure 1

A B

UK8, UK42 and UK50 dataset characteristics

Table 4. Nematode effector sequence characteristics. Different elements found after analysis with online computational

predictor programs are listed

Gene Size nt Size aa Signal P SBL

UK8 447 148 Yes. Probability: 0.99

(Cleavage site aa25-26) 78.3% nuclear

UK42 564 187 Yes. Probability: 0.97

(Cleavage site aa23-24) 47.8% cytoplasmic

UK50 273 90 Yes. Probability: 0.62

(Cleavage site aa28-29) 78.3% nuclear

Size nt - Size nucleotides Size aa – Size aminoacids SignalP – Presence of signal peptide SBL – Subcellular localization

Subcellular localization of UK8, UK42 and UK50 in Nicothiana benthamiana

To determine the subcellular localization of effector proteins in a host plant, agroinfiltration was used to express these effectors in tobacco plant epidermal cells. GFP fused effector proteins, UK8, UK42 and UK50 were infiltrated with and without their native signal peptide and analyzed under a confocal microscope after 2 days of infiltration. Free GFP that was not fused to any effector sequence was found in the nucleus and cytosol due to it’s small size which makes passive diffusion possible (Fig 3 h) (Yuan et al, 2011). The intense fluorescent signal across the membrane clearly indicates passive diffusion of GFP molecules to the cytosol.

All three effectors with the presence of their native signal peptide (fig 3 b-d-g) shows a fluorescent signal across the cell membranes of the epidermal cells that indicates translocation to the apoplast, as expected. These fluorescent signals are less intense compared to the sample with free GFP, and thus suggest that they are not likely to be present in the cytoplasm. Interestingly, UK50 with its native signal peptide (fig 3 g) shows small fluorescent dots all across the sample. These could be protein bodies as described in the paper of Conley et al (2009), or artifacts which could develop due to damage caused during specimen preparation.

All three effectors without the presence of a signal peptide (fig 3 a-c-f) show translocation to the nucleus, which is not in line with the expectations. Interestingly, UK42 without its signal peptide (fig 3 c) shows multiple fluorescent signals which are similar across the image. It does not indicate

translocation to the cell compartment of these illuminated areas because it can be identified as a strong autofluorescent signal. This strong autofluorescent signal can be seen in the merged channels (fig 3 e), where these fluorescent signals overlap with the autofluorescence of chloroplasts. As chloroplasts exhibit strong light emission (Y Kodama, 2016).

Figure 3

Confocal microscopy images showing GFP fused effector proteins UK8, UK UK50 visualized in tobacco leaves.

Agroinfiltration of M. graminicola effectors visualized in N. benthamiana leaves. Shown are fluorescent subcellular localization signals of a) UK8 without SP, b) UK8 with SP, c) UK42 without SP, d) UK42 with SP, e) Merged channel of GFP fluorescence and autofluoresence for the UK42 sample, f) UK50 without SP, g) UK50 with SP and h) Free GFP. The free GFP shows a strong fluorescent signal which indicates the passive diffusion of GFP molecules to the nucleus and cytoplasm. Effectors with their native SP show translocation to the apoplast (red arrow indicating the stronger fluorescent signal of GFP around the cell membrane in the sample with SP in comparison with the no SP sample). Interestingly, UK50 with its native SP shows a highly frequent signal of fluorescent dots across the sample (indicated with the white arrows). Effectors without a signal peptide shows translocation to the nucleus. A merged channel for UK42 shows the strong fluorescent signal of the chloroplasts.

D

A

B

C

F

G

H

Discussion:

The current study focused on different aspects of putative whitefly and nematode effectors able of altering the plant defense system. The whitefly effectors were analyzed by looking at different sequence specific characteristics. Results showed that the predictive chance of the presence of a signal peptide is highly significant in all five effector sequences analyzed, P1, B8, B9, B11 and G1. All sequences had different predictions for subcellular localization, which indicate that these whitefly effectors can have a range of different destinations in the cell. Contradictory results appeared because some of the effector sequences had motifs for a different from the nucleus, whilst it also contained a NLS. The inconsistency between the presence of a NLS and a SBL which is different from the nucleus, could be due to the inaccuracy, inefficiency or robustness of online computational methods for motif finding. Nevertheless, these effector sequence characteristics revealed that the signal peptide is indeed likely to be essential for an important function they have, which is excretion to plant cells. The online prediction tools have also shown that these effectors indeed translocate to a wide range of cell compartments or organelles which is also in line with the earlier stated

expectations.

The other part of this study focused on the visualization of nematode effector proteins in tobacco leaves. Results of the agroinfiltration showed that the prescence of a signal peptide had an effect on all three effector sequences analyzed. All three effectors, UK8, UK42 and UK50 with their native signal peptide translocated to the apoplasm. This indicates that the signal peptide has the same affect in plant cells as in the nematodes themselves. The translocation of these nematode effectors without a signal peptide showed fluorization in the nucleus. However, a note of caution is due here since the epidermal cells of N. benthamiana have big vacuoles, which makes it difficult to exactly determine whether the effectors are located in the cytoplasm, plasma membrane or apoplast (Ma et

al, 2012). More specific detection with immunolocalization could be used in future research, for

example to test wheter the same results will appear. But immunolocalization is relatively expensive and time consuming, therefor agroinfiltration was the most suitable method for this research. As stated earlier, no extensive research has been performed in the field of effectors deriving from whiteflies. Researchers that published studies based on whitefly effectors have been focusing on single effectors. Which narrows down the knowledge about effectors involved in plant parasitic systems as an extensive research has also not been performed. More studies have been done on nematode effectors, but information about the function of a majority of these effectors is lacking (Haegeman et al, 2012). The research done in this paper tries to extend the knowedge and information of multiple effectors, identified in whiteflies and nematodes.

Findings in the experiments performed have suggested a number of effective ways of analyzing effectors. This can for example be seen by the findings suggesting that the subcellular localization tools have shown to be effective. 2 of the 3 nematodes effectors had the same SBL comparing the results of table 4 and figure 3. Also, results provided in this research could be used for a follow-up. For example, the agroinfiltration assay has shown to provide clear images and thus could be possibly used for co-localization assays with an interactor for future research. This would enhance our understanding of specific effectors capable of altering the plants defense system.

Currently, the use of insecticides is a primary control strategy to control plant invasive organisms. Not only does the use of (natural) insecticides causes adverse health effects to humans and ecosystems (Mossa et al, 2018). The movement of insecticides into the environment has also been thoroughly studied. Only a small amount of the used insecticides reaches their target pests and a vast majority is being disseminated to the environment (Ansari et al, 2014). This is not an effective way of dealing with these pest organisms, neither is it feasible to continue with. Targeting them at the molecular level might not be a solution for tomorrow, as the gap between the scientific world and agriculture is difficult to bridge. But information which is being provided by the scientific world over the next few years can be used for controlling pests.

Information about effectors, like provided in this study, will reveal paths of dissemination for these effectors. For instance, effectors secreted to the apoplast of plant cells have been identified to be involved in cell wall disruption, increased virulence and increased plant susceptibility (Jaouannet &

Rosso, 2013). These types of pathways which give information about effector-plant interactions can

contribute to novel ways of limiting the damage done by these plant invasive organisms. Altering cellular processes or creating resistant plants could be used as new ways of preventing yield losses due to the infestation of pests.

To conclude, the aim of this research was to analyze different aspects of whitefly and nematode effector characteristics, which make these proteins able to invade their plant host. The importance of a signal peptide and the diverse destination of these effectors in the plant cell give a greater

understanding of their invasive strategies. This study has specifically extended the knowledge of the effectors described but has also more broadly opened up opportunities to analyzing plant parasitic effectors and maybe even finding novel ways of controlling plant pests.

Literature:

Ansari, M. S., Moraiet, M. A., & Ahmad, S. (2014). Insecticides: impact on the environment and human health. In Environmental deterioration and human health (pp. 99-123). Springer, Dordrecht.

Asai, S., & Shirasu, K. (2015). Plant cells under siege: plant immune system versus pathogen effectors. Current

opinion in plant biology, 28, 1-8.

Bauters, L., Haegeman, A., Kyndt, T., & Gheysen, G. (2014). Analysis of the transcriptome of Hirschmanniella oryzae to explore potential survival strategies and host–nematode interactions. Molecular plant

pathology, 15(4), 352-363.

Carolan, J. C., Caragea, D., Reardon, K. T., Mutti, N. S., Dittmer, N., Pappan, K., ... & Tagu, D. (2011). Predicted effector molecules in the salivary secretome of the pea aphid (Acyrthosiphon pisum): a dual

transcriptomic/proteomic approach. Journal of proteome research, 10(4), 1505-1518.

Chen W, Hasegawa DK, Kaur N, Kliot A, Pinheiro PV, Luan J, Stensmyr MC, Zheng Y, Liu W, Sun H, Xu Y, Luo Y, Kruse A, Yang X, Kontsedalov S, Lebedev G, Fisher TW, Nelson DR, Hunter WB, Brown JK, Jander G, Cilia M, Douglas AE, Ghanim M, Simmons AM, Wintermantel WM, Ling K-S, Fei Z (2016)

De Boer, J. M., Yan, Y., Smant, G., Davis, E. L., & Baum, T. J. (1998). In-situ hybridization to messenger RNA in Heterodera glycines. Journal of nematology, 30(3), 309.

Corpet, F. (1988). Multiple sequence alignment with hierarchical clustering. Nucleic acids research, 16(22), 10881-10890.

Haegeman, A., Mantelin, S., Jones, J. T., & Gheysen, G. (2012). Functional roles of effectors of plant-parasitic nematodes. Gene, 492(1), 19-31.

Haegeman, A., Bauters, L., Kyndt, T., Rahman, M. M., & Gheysen, G. (2013). Identification of candidate effector genes in the transcriptome of the rice root knot nematode M eloidogyne graminicola. Molecular Plant

Pathology, 14(4), 379-390.

Hewezi, T., & Baum, T. J. (2013). Manipulation of plant cells by cyst and root-knot nematode effectors. Molecular Plant-Microbe Interactions, 26(1), 9-16.

Howe, K. L., Bolt, B. J., Cain, S., Chan, J., Chen, W. J., Davis, P., ... & Harris, T. W. (2016). WormBase 2016: expanding to enable helminth genomic research. Nucleic acids research, 44(D1), D774-D780.

Howe, K. L., Bolt, B. J., Shafie, M., Kersey, P., & Berriman, M. (2017). WormBase ParaSite− a comprehensive resource for helminth genomics. Molecular and biochemical parasitology, 215, 2-10.

Hussey, R. S., Davis, E. L., & Baum, T. J. (2002). Secrets in secretions: genes that control nematode parasitism of plants. Brazilian Journal of Plant Physiology, 14(3), 183-194.

Jaouannet, M., & Rosso, M. N. (2013). Effectors of root sedentary nematodes target diverse plant cell

compartments to manipulate plant functions and promote infection. Plant signaling & behavior, 8(9), e25507. Kaloshian, I., & Walling, L. L. (2016). Hemipteran and dipteran pests: Effectors and plant host immune

regulators. Journal of Integrative Plant Biology, 58(4), 350-361.

Kodama, Y. (2016). Time gating of chloroplast autofluorescence allows clearer fluorescence imaging in planta. PLoS One, 11(3), e0152484.

Kyndt, T., Fernandez, D., & Gheysen, G. (2014). Plant-parasitic nematode infections in rice: molecular and cellular insights. Annual Review of Phytopathology, 52, 135-153.

Lin, J. R., & Hu, J. (2013). SeqNLS: nuclear localization signal prediction based on frequent pattern mining and linear motif scoring. PloS one, 8(10).

Ma, L., Lukasik, E., Gawehns, F., & Takken, F. L. (2012). The use of agroinfiltration for transient expression of plant resistance and fungal effector proteins in Nicotiana benthamiana leaves. In Plant Fungal Pathogens (pp. 61-74). Humana Press.

Mossa, A. T. H., Mohafrash, S. M., & Chandrasekaran, N. (2018). Safety of natural insecticides: toxic effects on experimental animals. BioMed research international, 2018

Padgham, J. L., Duxbury, J. M., Mazid, A. M., Abawi, G. S., & Hossain, M. (2004). Yield loss caused by Meloidogyne graminicola on lowland rainfed rice in Bangladesh. Journal of nematology, 36(1), 42.

Rodriguez, P. A., Escudero-Martinez, C., & Bos, J. I. (2017). An aphid effector targets trafficking protein VPS52 in a host-specific manner to promote virulence. Plant physiology, 173(3), 1892-1903.

Rosso, M. N., Vieira, P., de Almeida-Engler, J., & Castagnone-Sereno, P. (2011). Proteins secreted by root-knot nematodes accumulate in the extracellular compartment during root infection. Plant signaling & behavior, 6(8), 1232-1234.

Whisson, S. C., Boevink, P. C., Moleleki, L., Avrova, A. O., Morales, J. G., Gilroy, E. M., ... & Hein, I. (2007). A translocation signal for delivery of oomycete effector proteins into host plant cells. Nature, 450(7166), 115-118.

Wang, X. W., Li, P., & Liu, S. S. (2017). Whitefly interactions with plants. Current opinion in insect science, 19, 70-75.

Wang, N., Zhao, P., Ma, Y., Yao, X., Sun, Y., Huang, X., ... & Ye, J. (2019). A whitefly effector Bsp9 targets host immunity regulator WRKY33 to promote performance. Philosophical Transactions of the Royal Society

B, 374(1767), 20180313.

Will, T., Furch, A. C., & Zimmermann, M. R. (2013). How feeding insects face the challenge of phloem-located defenses. Frontiers in Plant Science, 4, 336.

Xu, H. X., Qian, L. X., Wang, X. W., Shao, R. X., Hong, Y., Liu, S. S., & Wang, X. W. (2019). A salivary effector enables whitefly to feed on host plants by eliciting salicylic acid-signaling pathway. Proceedings of the National

Academy of Sciences, 116(2), 490-495.

Yang, C. H., Guo, J. Y., Chu, D., Ding, T. B., Wei, K. K., Cheng, D. F., & Wan, F. H. (2017). Secretory laccase 1 in Bemisia tabaci MED is involved in whitefly-plant interaction. Scientific reports, 7(1), 1-9.

Yuan, H., Meng, X., Gao, Q., Qu, W., Xu, T., Xu, Z., & Song, R. (2011). The characterization of two peroxiredoxin genes in Dunaliella viridis provides insights into antioxidative response to salt stress. Plant cell reports, 30(8), 1503-1512.