Minimal genome project: Streamlining B.
subtillis genome to maintain low generation
time and viability
Student: Ruben van Swieten 11149604
Supervisor: prof. Hamoen, L.W. Daily supervisor: Siersma, T.
Table of contents:
Abstract
3
Introduction
4
Methods/Materials
6
Bacterial strains, Media and growth conditions
6
Transformation of PJOE7361.1.3 in B. subtilis 168
6
Growth rate measurements
7
Improving growth rate protocol
7
Lag variation analysis
7
Cell viability analysis
8
Cell morphology analysis
8
Knock-back of wild type genes
8
Results
Transformation of PJOE7361.1.3
9
Growth rate measurements
11
Decrease growth rate
11
Lag variation
12
Cell viability
13
Knock-back of wild type genes
16
Discussion
17
References
19
Abstract
The creation of a bacterial strain with only the necessities needed to sustain autonomous growth and viability has been a long-term goal as this will teach us much about the fundamental principles of life. Furthermore, it might provide optimized workhorses in biopharmaceutical industries providing valued compounds otherwise hard to come by (Komatsu et al. 2010; Y. Liu., 2016). Multiple strategies have been pursued such as Reuß et al. (2017) who used the mannose
phosphoenolpyruvate-dependent phosphotransferase system developed by Wenzel & Altenbuchner (2015) to induce precise deletions in the Bascillus subtilis genome with the added benefit of easy selection. These deletions were based on a minibacillus blueprint put forward by Reuß et al. (2016). This effort yielded a minimal strain after 94 consecutive deletions with a minimal loss in growth rate and viability comparable to the wild type under specified conditions. Although the loss in growth rate and viability was minimal, the ultimate goal is to construct a minimal strain with no impaired growth rate nor viability. Earlier findings of A.C.H van den Berg van Saparoea (2018) indicated a decrease in growth rate in deletion strain IIG-Bs27-27 by overexpression of certain genes due to previous deletions of regulatory genes, it was also noted that sometimes the lag phase duration was significantly increased when overnight deletion strains reached to high of an optical density. In this study we set out to replicate the previously acquired data while also further analyzing the phenomenon of increased lag phase duration seen at high optical densities of overnight cultures. On top of that, a fixed version of the PmtlA-comKS cassette (Rahmer et al., 2015), which previously caused the partial deletion of the yvcA gene was integrated in the Bascillus subtilis 168 wild type genome to increase the competence which was decreased in later deletion strains. For these reasons growth curves were obtained and doubling times were calculated based on the logarithmic phase. Incubation of overnight cultures with different optical densities resulted in highly dispersed lag phase durations for the same deletion strain. Cell morphological analysis indicated a high incidence of cell lysis in deletion strains incubated overnight with a high optical density, suggesting a lack of viability for deletion strains in a nutrient deprived environment. To identify the genes responsible for this decreased viability in nutrient deprived environments, IIG-Bs27-7 was transformed with wild type DNA and subsequently subjected to this nutrient deprived environment to induce the knock back of genes responsible for this
decreased viability. This resulted in multiple transformants with no increased lag phase duration compared to the wild type. Genes taken up by the successful transformants should be checked to narrow down the genes responsible for this reduced viability.
Introduction
Cells lie at the basis of all life on earth, understanding the mechanisms of how living cells operates is important in life sciences. For this reason, it has been a long time goal within the scientific community of synthetic biology to produce a bacterial strain with the least amount of genes necessary for autonomous growth. A genome-minimized organism is a bacterial strain where all non-essential genes and non-coding gene regions are taken out of the genome ending up with only the genes necessary for viability and growth such as genes involved in metabolism, proliferation, information processing, cell wall synthesis and integrity of the minimal cell (Reuß et al., 2016). This effort will undoubtedly increase our understanding of the essential cellular functions, proteins and genes involved and their interactions as minimalizing genomes suffices as a great tool to answer these questions. In addition this bacterial strain will suffice as an excellent working horse in the
biopharmaceutical industry, efficiently producing biological compounds otherwise hard to come by (Komatsu et al. 2010; Y. Liu., 2016).
Two main methods are used to produce bacterial strains with reduced genomes: the bottom-up and top-down approaches (Lam et al. 2012; Juhas et al. 2014). The bottom-up approach uses the existing knowledge of essential genes and their functions to construct and synthesize a genomic design from scratch, whereas the top-down approach reduces existing genomes by deleting non essential genes and non coding gene regions to end up with only the genes necessary for growth under specified conditions.
The 1079-kilobase pair synthetic genome of Mycoplasma mycoides JCVI-syn1.0 has been used as an initial template to design and synthesize JCVI-sync3.0 through the bottom-up approach, which resulted in a reduced genome of 531 kilobase pairs and only 473 genes, including 147 genes with unknown function, smaller than any known natural genome. Although genome reduction was achieved, generation time was negatively affected as seen in the change of ~60 min for syn1.0 to ~180 min for sync3.0 (C.A. Hutchison III., 2016). This reduction in generation time might be due to changes in protein abundances caused by unknown regulatory proteins on the post transcriptional level, antisense ncRNA’s (non-coding RNA) for instance have shown to be responsible for a decrease in mRNA and protein abundance of their targets coding gene in M. mycoides as well as other factors such as acetylation sites per protein and protein half-life (W.H. Chen. Et al., 2016). Such regulatory proteins and mechanisms may be overlooked during the designing phase.
The top down approach is better suited for genome reduction without loss of growth capabilities as the development of a markerless gene deletion system for Bacillus subtilis, using the mannose phosphoenolpyruvate-dependent phosphotransferase system, allows for precise genome deletion of various lengths and counter-selection without the use of harmful reagents or toxic compounds such as 5-fluorouracil, CCdB and MazF, which will leave scars in the bacterial genome or cause random mutations (Fabret et al., 2002; Bernard et al., 1994; Zhang et al., 2006). This concept is based on the phenomenon that ManA mutants are sensitive to mannose and won’t grow in mannose rich medium, while ManP-A- cells do grow in mannose rich medium. This allows for a selection based on the absence or presence of ManP in the genome (Wenzel & Altenbuchner,2015). The construction of a vector unable to replicate in Bacillus subtilis containing the manP gene, an antibiotic resistance gene as well as restriction sites for the integration of the deletion cassettes, which consists of two
sequences of ~700 bp up and downstream of the target region, is required. This construct provides the means for selection of cells who integrated the vector into their bacterial genome using the antibiotic resistance gene on the vector to our advantage. Subsequently mannose rich medium will select for the spontaneous recombination of the vector with as result; deletion of the target region or excision of the vector whilst retaining the target region. This system has been applied to the B.
subtilis genome and was based on the Minibacillus blueprint constructed by Reuß et al. (2016) which used B. subtilis as model organism for the broad amount of information available on this bacterium. Reuß et al. (2017) achieved a 36% reduction in genome size of the B. subtilis 168 genome using 94 cumulative deletion steps (See supplementary materials) with each subsequent deletion strain having more genes deleted. The resulting strains were meant to have morphological and growth
characteristics comparable to the wild type under specified conditions, in this particular case the cells were cultured in complex medium of Lysogenic Broth (LB) and grown at 37C.
The created deletion strains were meant to have growth rates comparable to the wild type when grown in complex medium. Previous work of (A.C.H van den Berg van Saparoea) showed an increase in doubling time at deletion strain IIG-Bs27-27 when grown in both complex and minimal medium (LB and Amber medium respectively), she also mentioned an increase in lag phase duration when the optical density value of overnight cultures reached >6. Normal growth curves of bacteria include a lag phase, log phase, stationary phase and a death phase under conditions of resource limitation (Y. Himeoka & K. Kaneko. 2016). Cells in stationary phase still have active protein complexes although orders of magnitude lower then in log phase, when the synthesis of new active protein complexes in stationary phase is lower than the spontaneous degradation of active protein complexes due to lack of resources, cells will switch to the death phase.
Furthermore, A.C.H van den Berg van Saparoea also constructed a fixed version of the PmtlA-comKS cassette which was originally constructed by Rahmer et al. (2015) and integrated in deletion strain IIG-Bs27-24 in order to compensate for the lack of competence seen in deletion strains further down the line. This PmtlA-comKS cassette consists of a mannitol inducible promoter containing two competence genes (comK and comS). Overexpression of these competence genes increased the transformation efficiency of B. subtilis almost 7-fold. Integration of this cassette by Rahmer et al. (2015) in IIG-Bs27-24 resulted in a partial deletion of the yvcA gene involved in complex colony formation. Although nonessential, the yvcA gene could be semi-essential, for that reason she constructed the PJOE7361.1.3 plasmid which contained the fixed version of the PmtlA-comKS cassette.
The goal for the minimal genome project is to reduce existing genomes to only keep essential genes while retaining the same growth rate and viability as the wild type when grown in specified media, in this study we focused primarily on growth rates and viability when grown in minimal medium (Amber medium). Amber medium contains only glucose as added carbon source and contains various essential compounds such as heavy metals (see supplementary materials).
In this study we focused on replicating the previously obtained data considering the decrease in growth rate at deletion strain IIG-Bs27-27, besides that we also analyzed the phenomenon of increased lag time when overnight cultures reached to high of an OD value, furthermore, we set out to integrate the fixed PmtlA-comKS cassette in B.subtilis 168 for easier transformation in future experiments.
Based on previous results (A.C.H van den Berg van Saparoea, 2018) it is likely that the decrease in growth rate at deletion strain IIG-Bs27-27 is due to the genes deleted in this deletion step. The deleted genes in this step were kinD, mhqR, motA and motB. Aguilar et al. (2010) found the product of kinD to be a checkpoint protein that links spore formation to extracellular-matrix production in Bacillus subtilis biofilms. Deletion of kinD resulted in increased sporulation in wild type strains however, many genes associated with sporulation and biofilm formation were already deleted in preceding deletion steps. This suggests that the deletion of kinD is not responsible for this significant increase in doubling time. The products of motA and motB are two subunits of the flagellar anchor
complex important for motility and chemotaxis, lack of these genes could potentially result in decreased growth rate. The fact that many other flagellar subunits such as flgE, flgD and flgL had already been deleted in previous deletion strains (IIG-Bs27-4 and IIG-Bs27-8) and the fact that flgL mutants have the same phenotype as motA mutants suggests that a decrease in growth rate would have already been visible in the deletion strain where flgL was deleted (chan et al., 2014). The gene mhqR encodes a transcription regulator which negatively regulates members of the MhqR regulon (mhqA, mhqNOP and azoR2) providing regulation of oxidative and electrophilic stress resistance genes. Lack of this negative transcription regulator might cause the over expression of members of the MhqR regulon (Kawai et al., 2015). General overexpression of genes puts unnecessary stress on cells by lowering the relative amount of energy used for division. Besides that, the variance in lag phase duration is probably due to an increase in cell lysis in stationary phase caused by a lack of genes responsible for viability in this nutrient deprived state.
Materials and Methods
Bacterial strains, medium and growth conditions
Various B. subtilis deletion strains were grown in complex and minimal media, lysogeny broth (LB) (Bertani 1951) and Amber medium respectively (relevant bacterial strains are summarized in Table 1 and Table S1 in supplementary materials). LB agar was used for plating. Overnight cultures were made by inoculating single colony’s from LB agar plates and were incubated overnight in water baths at 37 C and 200rpm. Subsequently B. subtilis strains were grown in LB or Amber at both 37 C and 48C. E. coli strain DH5a was used for plasmid cloning and was grown on LB agar plates containing
100ug/ml ampicillin. Further growth of single colonies for plasmid isolation were also grown in LB containing 100ug/ml ampicillin.
Transformation of PJOE7361.1.3 in B. subtilis 168
Isolation of plasmid PJOE7361.1.3 was done by streaking out E.coli DH5a (contains PJOE7361.1.3) on LB agar and growing a single colony in LB supplemented with 100ug/ml ampicillin. Plasmid isolation from E.coli DH5a was done using Thermofisher plasmid isolation kit.
B. subtilis 168 was made competent using the competence/starvation protocol and supplemented with 10ul isolated plasmid and after 60 minutes incubation at 37 C were plated out on LB agar plates containing 5ug/ml chloramphenicol for easier selection.
Transformed B.subtilis 168 colonies were picked and grown where after the integration of the PmtlA-comKS cassette was checked by means of gel electrophoresis. First, chromosomal DNA from B.subtilis 168 PmtlA-comKS was isolated using the DNA isolation protocol (oxford, 250203). To check for the right insertion of the PJOE7361.1.3 plasmid, isolated DNA was amplified by PCR using primers RVS001 and RVS002 (sequences of used primers can be found in supplementary materials). The resulting fragments were run on gel electrophoresis and checked for the right insertion of the PJOE7361.1.3 plasmid.
Growth rate measurements
To compare the growth rates of the individual strains of B. subtilis a growth curve representing the cell density of the growth medium was needed. This was accomplished using a spectrophotometer measuring the optical density (OD) of a medium containing B. subtilis strains over a duration of time. A growth rate measurement protocol from the previous internees was used initially and consisted of the following steps: Overnight (O/N) cultures made by inoculating single colonies in 20 ml universal
container containing 4ml Amber medium at 37C stove 200rpm. Next morning, OD600/495 (for LB and Amber respectively) values were measured and cell suspensions were diluted in 15 ml fresh Amber to a startOD value of 0.05 and 0.1 (LB and Amber respectively). The optical density (OD) of these cell suspensions were measured every hour for 7 hours. Growth curves were made by plotting the natural logarithm of OD against time and these were used in calculation of the doubling time using the following equation.
The doubling time (Td), representing the growth rates was calculated using the following equation:
T
d=ln
(
2)/ln (C
2¿
C
1)
t
2−
t
1C1 and C2 represent the OD values at timepoints t1 and t2 (in minutes) during logarithmic phase. Improving Growth rate measurement protocol
This initial protocol however, seemed flawed as the duration of the lag phase (the phase preceding the logarithmic phase) had a high variation between deletion strains and even between replications of the same deletion strains, we reckoned this was due to the cells lysing by lack of proper aeration, also the protocol did not explicitly say to dilute the culture in the cuvet while measuring it resulting in growth curves underestimating OD values at later time points. Thus the protocol was changed accordingly to ensure the cells stayed in the proper conditions for the whole duration of the experiment and measurements were done properly. The following changes were made:
LB agar plates were prepared and B. subtilis strains were streaked out using sterile toothpicks. The plates were then incubated upside down in a 37C stove for approximately 16 hours. Next was the addition of a preculture: single colonies were inoculated in 2 ml LB or Amber Eppendorf tubes and vortexed until homologous, after which the OD600 and OD495 for LB and Amber respectively, were measured. Overnight cultures were prepared by adding the single colony medium to LB or Amber for a total volume of 10 ml and a starting OD600/495 value of 0.01 in 150ml Erlenmeyer flasks ensuring proper aeration. Next morning, OD600/495 values were measured and inoculated in fresh or Amber for a total volume of 15 ml and a start OD value of 0.1, subsequently OD values were measured hourly for 8 measurements.
Lag phase variation analysis
Because of the high variation in duration of lag phase seen in the results using the initial protocol, the improved growth rate measurement protocol was altered to further analyze this phenomenon. The hypothesis for this phenomenon was that the bacteria in further deletion strains were lysing more after reaching stationary phase in comparison to the wild type (PG344).
To construct the conditions of long duration vs short duration spent in stationary phase, the preculture which was added to the new protocol was grown to log phase in 5 ml Amber medium (150ml Erlenmeyer 37C 200rpm) after which 2 O/N cultures were incubated for each strain in 10ml Amber medium (150ml Erlenmeyer flask 37C 200rpm for approximately ~17 hours) with different OD495 values, after some trial and error the following O/N OD495 values were chosen to simulate the conditions: One O/N culture with an OD495: 0.01 and one O/N culture with an OD495: 0,2 (simulating short and long duration spent in stationary phase respectively or a nutrient rich and nutrient deprived state respectively). Next morning, OD495 values were measured of both O/N
cultures and inoculated in fresh Amber for a total volume of 15 ml and a start OD value of 0.1, subsequently OD495 values were measured hourly for 8 measurements. Growth curves showing difference in lag duration were made by plotting natural logarithm of OD against time.
Subsequently the relation between lag phase duration and O/N OD495 value (simulating duration spent in stationary phase) was explored bye incubating multiple O/N cultures of the same strain each with different OD495 values.
Cell morphology analysis
To determine morphological differences between strains and between different O/N OD of the same strain, phase contrast and fluorescence microscopy was used. FM95 and DAPI were used for
membrane and DNA staining respectively. A 1% agarose solution was used to prepare microscopy slides. Samples were prepared by incubating O/N cultures of deletion strains with an OD495 value of 0.01 and 0.2. Next morning two samples of 100ul of both O/N cultures for each strain was taken, and subsequently 1 ul FM95 or 1 ul of DAPI was added, after which the samples were vortexed and incubated at 37C, 200rpm for 5 minutes. Then 2ul of sample was transferred to the 1% agarose microscopy slide and checked by Olympus BX fluorescence microscope.
Knock back of wild type genes
The bacterial cells in later deletion strains seemed to lyse in stationary phase, the hypothesis that the absence of a particular gene or combination of genes deleted in previous deletion steps caused this increased cell lysis was proposed. Due to time constraints B. subtilis deletion strain IIG-Bs27-7, which was the earliest deletion strain showing an increased lag phase was used to transform with isolated B. subtilis 168 (used as wild type) genomic DNA after repeatedly being subjected to late stationary phase multiple times in the hope to recombine with Wild Type genes that increase the viability in late stationary phase.
In order to do this, B. subtilis IIG-Bs27-7 was made competent using competence/starvation method. A surplus of isolated WT genomic DNA was added to the competent IIG-Bs27-7, after which they were incubated O/N at 37C and 200rpm in a water bath. Next morning OD495 values were measured and the cell suspension was subsequently diluted to an OD495 value of 0.2 in 15 ml fresh Amber medium, this was repeated 3 times where after transformed IIG-Bs27-7 cells were plated out on LB agar plates and incubated at 37C.
10 colonies were picked and grown according to lag variation analysis protocol, growth curves were made by plotting the natural logarithm of OD against time. Colonies showing no increased lag phase with O/N OD495: 0.2 compared to wild type PG344 were grown to log phase and stored in 25% glycerol in -80 freezer for later use.
Integration of PmtlA-comKS cassette
B. subtilis 168 was transformed with PJOE7361.1.3 which contained a PmtlA-comKS cassette improving the
competence. Genomic DNA was isolated from the transformed B. subtilis 168 PmtlA-comKS cells and were amplified in PCR with primers RVS001 and RVS002 (sequence can be found in supplementary materials) a negative control consisting of isolated B. subtilis 168 genomic DNA was also included. The length between the primers was expected to be 518bp and the insert length was expected to be 1915bp (Figure 1). The resulting PCR products were analyzed by gel electrophoresis and showed bands at just under 2.5kb in samples 1,2 and 3 and bands at just above 500bp for the negative control (Figure 2).
These bands are in agreement with the expected sizes of the
PmtlA-comKS cassette plus added length due to primers. These results indicate the successful integration of the PmtlA-comKS cassette in the B.subtilis 168 genome.
Figuur 1. Plasmid map of pJOE7361.1.3 (corrected by A.C.H van den Berg van Saparoea). Insert correcting yvcA is shown in orange. Segment of yvcA
in correction insert is shown in cyan. Red shows the overlap by yvcA and
hisI terminator. Green shows the integrated chloramphenicol resistance
cassette. (edited from A.C.H van den Berg van Saparoea). Expected sequence lengths using primers RVS001 and RVS002 are 2433 bp and 518 bp for insert and control respectively.
Growth rate measurements
Decrease in growth rateFigure 2. Gel electrophoresis of PCR products. (A,B and C):
PCR products of isolated genomic DNA of B. subtilis 168 transformed with pJOE7361.1.3 using primers RVS001 and RVS002. (D) Negative control: B. subtilis 168 genomic DNA cut with primers RVS001 and RVS002.
Earlier experiments indicated a decrease in growth rate at deletion strain IIG-Bs27-27 in comparison to the wild type (PG344) and deletions strains preceding IIG-Bs27-27 when grown in minimal media (Amber medium) at 37 and 48 C. For this reason we tried
replicating these findings using the initial protocol, but since that protocol was partly flawed, data acquired using that protocol will
not be included in the analysis. Data acquired using the improved growth rate measurement protocol were used for the growth curve and doubling time results but still showed a high variation in duration of lag time between different deletion strains and replications of the same strain in Amber medium at 37 and 48C, thus proper comparison of growth curves could not be made. Variation in lag phase duration did not prevent us from calculating the doubling time based on the logarithmic phase. Table 1. Number of biological repeats used for doubling time analysis per strain
Strain Number of repeats in Amber at
37°C
Number of repeats in Amber at 48°C
PG344 9 5
IIG-Bs27-14 9 5
IIG-Bs27-26 5 4
IIG-Bs27-27 6 5
IIG-Bs27-28 9 6
Figure 3 shows growth curves of deletion strains IIG-Bs27-14, IIG-Bs27-26, IIG-Bs27-27, IIG-Bs27-28
and PG344 as wild type. As the growth figure shows, the only variance between Bs27-14, IIG-Bs27-26 and PG344 is the difference in lag phase duration, besides that, IIG-Bs27-27 and IIG-Bs27-28 do not show the normal characteristics of a bacterial growth curve, instead they seem to start log phase immediately without a lag phase or the exact opposite happens where the duration of the lag phase is increased dramatically. As seen by the average doubling times in figure 3 of deletion strains IIG-Bs27-14, IIG-Bs27-26, IIG-Bs27-27, IIG-Bs27-28 and PG344 as wild type based on the logarithmic phase of multiple growth curve replications. There seems to be a significant increase in doubling time duration in IIG-Bs27-27 compared to the wild type and preceding deletion strains when grown in Amber medium at both 37 and 48C. Furthermore, no significant difference in doubling time is seen
C
B A
Figuur 3. Growth curves and average doubling time of B. subtilis strains in Amber. Colors in legend are the same strain in
each graph. (A) Growth curve of strains in Amber at 37°C. (B) Growth curve of strains in Amber at 48°C. (C) Average doubling time of strains in Amber at 37°C and 48°C. Error bars represent the standard deviation.
Amber 48°C PG344 IIG-Bs27-14 IIG-Bs27-26 IIG-Bs27-27 IIG-Bs27-28 Amber 37°C 0 10 20 30 40 50 60 70 80 90 100
Average Doubling times in Amber at 37°C and 48°C
Ti m e in m in u te s
between PG344, IIG-Bs27-14 and IIG-Bs27-26 when grown in Amber medium at 37C. Whilst grown at 48C there seems to be a slight increase in doubling time in IIG-Bs27-26 compared to the wild type although not significant.
The average doubling times of deletion strains IIG-Bs27-14, IIG-Bs27-26, IIG-Bs27-27, IIG-Bs27-28 and PG344 indicate a increase in doubling time in IIG-Bs27-27 compared to preceding deletion strains and wild type.
Lag variation
The high variation in the duration of the lag phase was further analyzed by incubating O/N cultures of deletion strains with a high optical density (OD495: 0.2) and with a low optical density (OD495:0.01), simulating a long duration spent in stationary phase versus a short duration spent in stationary phase respectively. Figure 4 shows growth curves of 14, 26, IIG-Bs27-27 and PG344 with O/N OD495: 0.01 and 0.2.
14, 26, IIG-Bs27-27 all show a large difference in lag duration between O/N OD495: 0.01 and 0.2. While PG344 does not show any significant difference between the different O/N OD values.
These results indicate that the O/N OD value is responsible for the high variation in lag duration.
Subsequently the relation between lag phase duration and O/N OD495 value (simulating duration spent in stationary phase) was explored by incubating O/N cultures of IIG-Bs27-14, IIG-Bs27-26 and PG344 with OD495 values of 0.01, 0.02, 0.03, 0.04, 0.05, 0.125 and 0.2, simulating different durations spent in stationary phase.
As can be seen from figure 5. IIG-Bs27-14, IIG-Bs27-26 show a positive relationship between the O/N OD values and the duration of the lag phase compared to the wild type PG344. These results indicate that deletion strains IIG-Bs27-14, IIG-Bs27-26 and probably multiple preceding deletion strains have increased lysis in stationary phase compared to the wild type PG344.
Figure 4. Growth curve of B. subtilis strains with O/N OD495 0.01 and 0.2 in
Amber at 37°C. full lines represent O/N OD 0.01 and striped lines represent O/N
OD 0.2 0 60 120 180 240 300 360 420 0.08 0.8 8 PG344 OD 0.01 PG344 OD 0.2 IIG-Bs27-14 OD 0.01 IIG-Bs27-14 OD 0.2 IIG-Bs27-26 OD 0.01 IIG-Bs27-26 OD 0.2 IIG-Bs27-27 OD 0.01 IIG-Bs27-27 OD 0.2
0 60 120 180 240 300 360 420 0.05
0.5 5
PG344
Overnight OD495 value
OD
0.01
OD
0.02
OD
0.03
OD
0.04
Time in minutes
O
D
4
9
5
C B AFigure 5. Growth curve of strains with varying overnight OD495 values grown in Amber at 37°C. Colors representing O/N
OD495 values: 0.01, 0.02, 0.03, 0.04, 0.05, 0.125 and 0.2 are the same in each graph. (A) Growth curves of PG344 with varying O/N OD495 values. (B) Growth curves of IIG-Bs27-14 with varying O/N OD495 values. (C) Growth curves of IIG-Bs27-26 with varying O/N OD495 values.
0 60 120 180 240 300 360 420 0.05 0.5 5
IIG-BS27-26
Time in minutes
O
D
4
9
5
0 60 120 180 240 300 360 420 0.05 0.5 5IIG-Bs27-14
Time in minutes
O
D
4
9
5
Cell morphology analysis
The protocol for this cell morphology analysis included the incubation of O/N cultures with an OD495
value of 0.01 and 0.2 resembling a nutrient rich and nutrient deprived state of the cells respectively. This was done for the strains PG344, IIG-Bs27-7, IIG-Bs27-14 and IIG-Bs27-26 where after the samples were stained with DAPI and FM95 (DNA and membrane respectively).
14
Figure 6. Morphological differences of strains between overnight OD495 value: 0.01 and 0.2 stained with DAPI and FM95.
(A,B,C and D): Wild type strain PG344 grown in Amber with O/N OD 0.01 stained with DAPI and FM95 respectively. (E,F,G and H): Wild type strain PG344 grown in Amber with O/N OD 0.2 stained with DAPI and FM95 respectively. (I,J,K and L): IIG-Bs27-7 grown in Amber with O/N OD: 0.01 stained with DAPI and FM95 respectively. (M,N,O and P): IIG-IIG-Bs27-7 grown in Amber with O/N OD: 0.2 stained with DAPI and FM95 respectively. (Q,R,S and T): IIG-Bs27-14 grown in Amber with O/N OD: 0.01 stained with DAPI and FM95 respectively. (U,V,W and X): IIG-Bs27-14 grown in Amber with O/N OD: 0.2 stained with DAPI and FM95 respectively. (Y, Z, AA, AB): IIG-Bs27-26 grown in Amber with O/N OD: 0.01 stained with DAPI and FM95 respectively. (AC, AD, AE and AF): IIG-Bs27-26 grown in Amber with O/N OD: 0.2 stained with DAPI and FM95 respectively.
Figure 6 shows phase contrast pictures of B. subtilis strains, DNA was stained with DAPI and FM95 was used for membrane staining. The figure shows morphological differences between O/N OD 0.01 and 0.2 for strains PG344, IIG-Bs27-7, IIG-Bs27-14 and IIG-Bs27-26.
PG344 with O/N OD: 0.01 (Figure 6 A-D) shows no apparent cell lysis, although the PG344 sample with O/N OD: 0.2 (Figure 6 E-H) contained a lot of background noise. Although there seems to be a lot of background noise, the majority of the cells seem to be alive with proper DNA and membrane morphologies. The background noise is due to lysed cell parts which were also stained by DAPI and FM95, making this hard to compare to other strains. IIG-Bs27-7 show no apparent cell lysis in the O/N OD: 0.01 samples (figure 6 I-L), while background noise is clearly visible in the samples with O/N OD: 0.2 (figure 6 M-P). IIG-Bs27-14 shows no cell lysis in the OD: 0.01 samples (figure 6 Q-T). Interestingly, IIG-Bs27-14 samples with O/N OD: 0.2 (figure 6 U-X) seem to have auto fluorescent spots, besides that there seems to be a lot of cell lysis in the O/N OD:0.2 samples as the staining of DNA by DAPI seemed ineffective. Strain IIG-Bs27-26 also does not show cell lysis in O/N OD: 0.01 sample (figure 6 Y-AB) as DNA and membrane staining indicate no apparent morphological problems. IIG-Bs27-26 O/N OD: 0.2 samples (figure 6 AC-AF) on the other hand seem to have lysed cell parts as seen by the
background noise, besides that DAPI and FM95 staining seemed ineffective. As can be seen in figure 6 (AE and AF) some cells seem to have shifted their morphology to a round shape.
These morphological results indicate an increase in cell lysis in comparison to control PG344 when deletion strains are nutrient deprived as they are grown to stationary phase and beyond.
Knock back of WT genes
The apparent cell lysiswhich occurs when cells reach stationary phase was considered to be due to a previous deletion step deleting a semi essential gene or combination of genes which generally lowered the survivability of cells in a nutrient deprived state such as in stationary phase. We transformed IIG-Bs27-7 with wild type B. subtilis 168 DNA and grew them O/N with OD: 0.2 for 3 repeats, in the hope to knock back the
previously deleted gene or combination of genes
responsible for the lowered survivability of cells in stationary phase in later deletion strains. Figure 7 shows the growth curve of multiple IIG-Bs27-7 168 transformants with O/N OD: 0.2 compared to the growth curve of wild type PG344 (Blue) and to non-transformed IIG-Bs27-7 with O/N OD: 0.2 (yellow).
As the growth curves of figure 7 imply, transformants 2,4,6,7 and 8 (shown in light pink) do not show an increase in lag
phase compared to the control PG344. The growth curve of
transformant 4 even shows a decrease in lag phase compared to PG344. In contrast, transformants 1,3 and 5 (shown in green) are comparable to the growth curve of non-transformed IIG-Bs27-7 or showed an increased lag time compared to PG344 and were thus discarded.
These results indicate the successful knock back of particular wild type genes responsible for survivability in stationary phase in transformants 2,4,6,7 and 8.
Discussion
The integration of the PmtlA-comKS cassette in B. subtilis 168 to improve the competence in later deletion strains was checked by means of gel electrophoresis, the bands on the gel indicate the
Figure 7. Log2 transformed growth curve of IIG-Bs27-7 transformed with wild type B. subtilis 168 DNA. Control PG344 is shown in blue whereas negative control IIG-Bs27-7 (not transformed
with wild type DNA O/N OD495: 0.2) is shown in yellow. Transformants 2,4,6,7 and 8 (shown in light pink) were stocked for later use. Transformants 1,3 and 5 (shown in green) were discarded.
0 60 120 180 240 300 360 -4 -3.5 -3 -2.5 -2 -1.5 -1 -0.5 0 0.5 1
Log2 transformed Growth curve of IIG-Bs27-7 transformants
transformant 1 transformant 2 transformant 3 transformant 4 transformant 5 transformant 6 transformant 7 transformant 8
Time in minutes
Lo g2 O D 4 9 5successful integration of the cassette. A transformation efficiency experiment was done, but the results were discarded because of contamination in some of the plates. This should be repeated in future experiment to make sure this mannitol inducible competence works properly. Furthermore, it should also be checked whether the PmtlA-comKS transformed B. subtilis 168 cells are still able to transform using the normal competence/starvation protocol.
Evaluating the results of the growth rate measurements, the growth rate data indicate a decrease in growth rate in deletion strain IIG-Bs27-27 compared to wild type PG344 and preceding deletion strains. These results are in agreement with the earlier findings of A.C.H van den Berg van Saparoea and indicate that the increase in doubling time in deletion strain IIG-Bs27-27 is due to the genes deleted in this deletion step.
The deleted genes in this step were kinD, mhqR, motA and motB. Aguilar et al. (2010) found the product of kinD to be a checkpoint protein that links spore formation to extracellular-matrix
production in Bacillus subtilis biofilms. Deletion of kinD resulted in increased sporulation in wild type strains however, many genes associated with sporulation and biofilm formation were already deleted in preceding deletion steps. This suggests that the deletion of kinD is not responsible for this
significant increase in doubling time.
The products of motA and motB are two subunits of the flagellar anchor complex important for motility and chemotaxis, lack of these genes could potentially result in decreased growth rate. The fact that many other flagellar subunits such as flgE, flgD and flgL had already been deleted in previous deletion strains (IIG-Bs27-4 and IIG-Bs27-8) and the fact that flgL mutants have the same phenotype as motA mutants suggests that a decrease in growth rate would have already been visible in the deletion strain where flgL was deleted (chan et al., 2014).
The gene mhqR encodes a transcription regulator which negatively regulates members of the MhqR regulon (mhqA, mhqNOP and azoR2) providing regulation of oxidative and electrophilic stress resistance genes. Lack of this negative transcription regulator might cause the over expression of members of the MhqR regulon (Kawai et al., 2015).
All in all, it seems that the overexpression of genes puts an unnecessary burden on cells by lowering the relative amount of energy used for division.
The results from the growth curve data showed a high variation in the lag phase duration, making statistical analysis of growth curves of deletion strains impossible. The relation between variation in lag phase duration and duration spent in stationary phase was further analyzed by incubating O/N cultures with different OD values. IIG-Bs27-14, IIG-Bs27-26, IIG-Bs27-27 all show a large difference in lag duration between O/N OD495: 0.01 and 0.2. While PG344 does not show any significant
difference between O/N OD: 0.01 and 0.2. Furthermore, the growth curves of 14, IIG-Bs27-26, IIG-Bs27-27 do not seem to follow a normal growth curve pattern with a distinct lag, log and stationary phase. The growth curves of the OD: 0.01 samples seem to lack a lag phase altogether while the OD: 0.2 samples have a greatly increased lag phase. This can be explained by the fact that the OD: 0.01 samples did not reach stationary phase after ~17 hours of incubation while the OD: 0.2 did reach a state of nutrient deprivation.
Further experiments concerning the variation in lag phase duration seem to indicate a positive relationship between the O/N OD value and the duration of the lag phase in Bs27-14 and IIG-Bs27-26. In contrast, no difference in lag phase is observed in the wild type PG344. These results indicate an increase in cell lysis when cells reach stationary phase which is the phase where nutrients are deprived, and no more glucose is available. This increase in cell lysis might be due to previously
deleted genes which are responsible for viability and robustness in stationary phase. Because
increased cell lysis in stationary phase is an unwanted characteristic of the deletion strains, IIG-Bs27-7 was transformed with wild type B. subtilis 168 DNA to knock back certain genes that might be responsible for this increased cell lysis.
The results gathered from the wild type gene knock back experiments suggest some transformants successfully regained the ability to survive nutrient deprivation as can be seen by the absence of an increased lag phase duration in the successful transformants compared to wild type PG344. This indicates that these transformants successfully recombined with B. subtilis 168 DNA and regained genes responsible for the decreased viability in a nutrient deprived environment. IIG-Bs27-7 was used as recipient of the B. subtilis 168 DNA. Because, due to time constraints and failed experiments, the deletion strain that began showing the decreased viability in a nutrient deprived state could not be narrowed down, future experiments should narrow down the deletion strain where this phenomenon first starts so that the responsible genes can also be narrowed down.
The cell morphology analysis showed morphological differences between O/N OD: 0.01 and 0.2 (nutrient rich and nutrient deprived state respectively) these results indicate an increase in cell lysis in the nutrient deprived state. Interestingly, IIG-Bs27-14 showed auto fluorescent spots in cells
incubated with O/N OD: 0.2 whereas the O/N OD: 0.01 cells did not show these spots. This
autofluorescence is probably due to the accumulation of a protein which is positively regulated either by previous deletion of a negative regulator or by accumulation due to the incapability of breaking this protein down. Because these spots are only visible in the O/N OD: 0.2 cells, this protein might be only expressed in stationary phase indicating a relation to the expression profile switch which
happens when cells reach stationary phase or rather a nutrient deprived state. Furthermore, IIG-Bs27-26 cells incubated with O/N OD: 0.2 were sometimes ball shaped. This is indicative of cells just starting to lyse which means this experiment was not done quickly enough and cell lysis might have occurred in the time between making photographs and preparing the microscopy samples.
Due to time constrains this experiment could not be replicated and thus some photographs, especially the photographs from PG344, show a lot of background noise. Because of this, proper comparison between wild type PG344 and the deletion strains could not be made, besides this fact, we tried doing a cell count analysis but due to contamination this experiment also failed. Future experiments should replicate the cell morphology analysis using different O/N incubation times, because IIG-Bs27-27 has a significantly lower growth rate and did not reach stationary phase in comparison to the other deletion strains and PG344. Besides that, the cell count analysis could be repeated and should be done with a dilution of 1*106 and 1*108 as these dilutions seemed to result in countable amounts of cells.
References
Aguilar, C., H. Vlamakis, A. Guzman, R. Losick, and R. Kolter. 2010. KinD is a checkpoint protein linking spore formation to extracellular-matrix production in Bacillus subtilis biofilms. mBio 1(1):e00035-10. doi:10.1128/mBio.00035-10.
Bernard, P., Gabant, P., Bahassi, E. M. & Couturier, M. (1994). Positive-selection vectors using the F plasmid ccdB killer gene. Gene 148, 71–74.
Bertani, G. (1951). Studies on Lysogenesis I: The Mode of Phage Liberation by Lysogenic Escherichia Coli. Journal of Bacteriology, 62, 293-300.
Chan, J.M., Guttenplan, S.B., & Kearns, D.B. (2014). Defects in the flagellar motor increase synthesis of poly--glutamate in Bacillus subtilis. Journal of Bacteriology, 196, 740-753.
Fabret, Céline & Ehrlich, S & Noirot, Philippe. (2002). A new mutation delivery system for genome-scale approaches in Bacillus subtilis. Molecular microbiology. 46. 25-36.
10.1046/j.1365-2958.2002.03140.x.
Himeoka, Yusuke & Kaneko, Kunihiko. (2016). Theory for transitions between log and stationary phases: universal laws for lag time.
Hutchison III, C.A., Chuang, R., Noskov, V.N., Assad-Garcia, N., Deerinck, T.J., Ellisman, M.H. et al. (2016). Design and synthesis of a minimal bacterial genome. Science, 351, aad6253.
Juhas, M., Reuß,D.R., Zhu,B.,& Commichau,F.M.(2014). Bacillus subtilis and Escherichia coli essential genes and minimal cell factories after one decade of genome engineering. Microbiology, 160, 2341-2351.
Kawai, Y., Mercier, R., Wu, L., Domínguez-Cuevas, P., Oshima, T., & Errington, J. (2015). Cell growth of wall-free L-form bacteria is limited by oxidative damage. Current Biology, 25, 1613-1618.
Reuß, D.R., Commichau, F.M., Gundlach, J., Zhu, B., & Stülke, J. (2016). The Blueprint of a Minimal Cell: MiniBacillus. Microbiology and Molecular Biology Review, 80, 955-987.
Kawai, Y., Mercier, R., Wu, L., Domínguez-Cuevas, P., Oshima, T., & Errington, J. (2015). Cell growth of wall-free L-form bacteria is limited by oxidative damage. Current Biology, 25, 1613-1618.
Mamoru Komatsu, Takuma Uchiyama, Satoshi Ōmura, David E. Cane, Haruo Ikeda
Genome-minimized Streptomyces host for the heterologous expression of secondary metabolism Proceedings of the National Academy of Sciences Feb 2010, 107 (6) 2646-2651; DOI: 10.1073/pnas.0914833107 Lam, E., Hastie, A., Lin, C. et al. Genome mapping on nanochannel arrays for structural variation analysis and sequence assembly. Nat Biotechnol 30, 771–776 (2012) doi:10.1038/nbt.2303 Rahmer, R., Morabbi Heravi, K., & Altenbuchner, J. (2015). Construction of a Super-Competent Bacillus subtilis 168 Using the Pmtla-comKS Inducible Casette. Frontiers in Microbiology, 6, 1431. Reuß, D.R., Altenbuchner, J., Mäder, U., Rath, H., Ischebeck, T., Kumar Sappa, P. et al. (2017). Large-scale reduction of the Bacillus subtilis genome: consequences for the transcriptional network, resource allocation, and metabolism. Genome research, 27, 289-299.
Wenzel, M., & Altenbuchner, J. (2015). Development of a markerless gene deletion system for Bacillus subtilis based on the mannose phosphoenolpyruvate-dependent phosphotransferase system.
Microbiology, 161, 1942-1949.
Zhang, X.Z.,Yan,X., Cui,Z.L., Hong, Q. &Li,S.P.(2006).mazF, a novel counter-selectable marker for unmarked chromosomal manipulation in Bacillus subtilis. Nucleic Acids Res 34, e71
Supplementary materials:
Table S1. Strains and plasmids used in this study
168 trpC2 Laboratory stock
BSB1 trp+ Laboratory stock
PG344 spoIIE::erm P. Gamba, unpublished work
IIG-Bs27-7 See Table S2
IIG-Bs27-14 See Table S2
IIG-Bs27-24 See Table S2
IIG-Bs27-25 See Table S2
IIG-Bs27-26 See Table S2
IIG-Bs27-27 See Table S2
IIG-Bs27-28 See Table S2
DH5α
E. Coli. F– φ80lacZΔM15 Δ(lacZYA-argF)U169 recA1 endA1 hsdR17(rK–, mK+) phoA supE44 λ– thi-1 gyrA96
relA1 D. Hanahan (1986)
pJOE7361.1.3
pJOE7361.1.2 derivate containing a CM resistance
cassette A.C.H van den Berg van Saparoea
Table S2. All strains and deletion steps from Reuß et al. (2017) and J.
Altenbuchner (unpublished work)
Strain Main property of deletion Deleted Genes
B.subtilis DSPb DSPb
phy, yotN, yotM, yotL, yotK, yotJ, yotI, yotH, yotG, yotF, yotE, yotD, yotC, yotB, sspC, yosX, yosW, yosV, yojW, yosU, yosT, yosS, yosR, nrdF, yosQ, nrdEB, nrdI, yosL, yosK, yosJ, yosI, yosH, yosG, yosF, yosE, yosD, yosC, yosB, yosA, yorZ, yorY, yorX, yorW, yorV, mtbP, yorT, yorS, yorR, yorQ, yorP, yorO, yorN, yorM, yorL, yorK, yorJ, yorI, yorH, yorG, yorF, yorE, yorD, yorC, yorB, yorA, yoqZ, yoqY, yoqX, yoqW, ligB, yoqU, yoqT, yoqS, yoqR, yoqP, yoqO, yoqN, yoqM, yoqL, yoqK,yoqJ, yoqI, yoqH, yoqG, yoqF, yoqE, yoqD, yoqC, yoqB, yoqA, yopZ, yopY, yopX, yopW, yopV, yopU, yopT, yopS, yopR, yopQ, yopP, yopO, yopN, yopM, yopL, yopK, yopJ, yopI, yopH, yopG, yopF, yopE, yoyH, yoyI, yopD, yopC, yopB, yopA, yonX, yonV, yonU, yoyJ, yonT,yonS, yonR, yonP, yonO, yonN, yonK, yonJ, yonI, yonH, yonG, yonF, yonE, yonD, yonC, yonB, yonA, yomZ, yomY, yomX, yomW, yomV, yomU, youA, yomT, yomS, yomR, yomQ, yomP, yomO, yomN, yomM, yozP, yomL, youB, yomK, yomJ, yomI, yomH, yomG, yomF, yomE, yomD, blyA, bhlA, bhlB, bdbB, yolJ, bdbA, sunT, sunA, sunI, uvrX, yolD, yolC, yolB, yolA, yokL, yokK, yokJ, yokI, yokH, yokG, yokF, yokE, yokD, yokC, yokB, yokA
TFC7A Dskin arsB, yqcK, arsR, yqcI, rapE, phrE, yqzI, yqcG, yqcF, yqxJ, yqxI,
cwlA,yqxH, yqxG, yqcE, yqcD, yqcC, yqcB, yqcA, yqbT, yqbS, yqbR, yqbQ, yqbP, yqbO, yqbN, yqbM, yqbK, yqzN, yqbJ, yqbI, yqbH, yqbG, yqbF, yqbE, yqbD, yqbC, yqb, yqbB, yqbA, yqaT,
yqaS, yqaR, yqaQ, yqaP, yqaO, yqaN, yqzO, yqaM, yqaL, yqaK, yqaJ, yqaI, yqaH, yqaG, yqdA, yqaF, yqaE, yqaD, yqaC
TF8A DPBSX
yjoAB, rapA, phrA, yjpA, xlyB, yjqABC, xkdA, xre, yjzJ, xkdB, xkdC, ykzK, ykdD, xtrA, xpf, xtmA, xtmB, xkdE, xkdF, xkdG, ykzL, ykdH, ykdI, ykdJ, ykzM, xkdK, ykdM, ykdN, xkzB, ykdO, ykdP, ykdQ, ykdR, ykdS, ykdT, ykdU, xkzA, xkdV, xkdW, xkdX, xepA, xhlAB, xlyA
D4 DproF1
alkA, adaA, adaB, ndhF, ybcC, ybcF, ybcH, ybcI, ybzH, ybcL, ybcM, skfA, skfB, skfC, skfE, skfF, skfG, skfH
D5 Polyketide gene cluster, Dpks::CmR
pksA,B,C,D, E, acpK,
pksG,pksH,pksI,pksJ,pksK,pksL,pksM,pksR,pksS
D6 DproF3, DproF2 (ICEBs1)
DproF3: ydiM, ydzUV, ydiO, ydiP, ydzW, ydiR, ydiS, ydjA, ydjB, ydjC
IIG-Bs1 Trp+
IIG-Bs2 DmanPA::erm manP, manA
IIG-Bs4 DproF5 ynxB, ynzFG, ynaB, ynaC, ynaD, ynaE, ynaF, ynaG, ynzI, ynaI
IIG-Bs5 DproF6
yozV, yobD, yozH, yozI, yobE, yobF, yozW, yozX, yozJ, yozY, yozZ, rapK, phrK, yobH, yozK, yozL, yozM, yobI, yoyA, yobJ, yobK, yobL, yobM, yobN, yobO
IIG-Bs8
DCmR (= deletion of CmR gene
introduced by Westers et al.) CmR
IIG-Bs9 DSubtilosin sboA,sboX, albA, albB, albC, albD, albE, albF, albG
IIG-Bs10 DPlipastin ppsA, ppsB, ppsC, ppsD, ppsE
IIG-Bs11 DBacilysin bacA,bacB, bacC, bacD, bacE, bacF, ywfH
IIG-Bs12 DproF7
yrkK, yrkJ, yrkI, yrkH, yrkF, yrkE, yrkD, yrzM, yrzN, yrkC, yrkB, bltR, blt, bltD, yrkA, yrzO, yrdR, yrdQ, yrdP, czcD, yrdN, gltR, yrdK, brnQ, azlB, azlC, azlD, yrdF, cypA, yrdD, yrdC, yrdB, yrdA, aadK, yrpB, yrpC, yrpD, yrpE
IIG-Bs13 Bacilysocin ytpA, ytpB, ytoA
IIG-Bs14 Sdp toxin sdpA, sdpB, sdpC, sdpI, sdpR
IIG-Bs20 Protease, Sporulation bpr, spoIIGA, sigE, sigG
IIG-Bs22
glucomannan utilisation, cell wall synthesis,
ydgG, ydgH, ydgI, ydgJ, ydgK, ydhB, ydhC, ydhD, ydhE, ydhF, phoB, ydhG, ydhH, ydhI, ydhJ, ydhK, pbuE, gmuB, gmuA, gmuC, gmuD, gmuR, gmuE, gmuF, gmuG, ydhU
IIG-Bs23 processing of sigF
spoIIAA, spoIIAB, sigF, spoVAA, spoVAB, spoVAC, spoVAD, spoVAEB, spoVAEA, spoVAF
IIG-Bs26 biofilm
epsO, epsN, epsM, epsL, epsK, epsJ, epsI, epsH, epsG, epsF, epsE, epsD, epsC, epsB, epsA, slrR
IIG-Bs27 biofilm yqxM, sipW, tasA
IIG-Bs-27-2 germination, autolysin lytD, yvyI, gerBA, gerBB, gerBC, ywtG, ywtF, ywtE
IIG-Bs27-3
sporulation sigma factor (skin element deleted before)
yqeF, cwlH, yqeD, yqeC, yqeB, spoIVCB, spoIVCA, arsC, arsB, yqcK, arsR, yqcI, rapE, phrE, yqzI, yqcG, yqcF, yqxJ, yqxI, cwlA, yqxH, yqxG, yqcE, yqcD, yqcC, yqcB, yqcA, yqbT, yqbS, yqbR, yqbQ, yqbP, yqbO, yqbN, yqdB, yqbM, yqbK, yqzN, yqbJ, yqbI, yqbH, yqbG, yqbF, yqbE, yqbD, yqbC, yqbB, yqbA, yqaT, yqaS, yqaR, yqaQ, yqaP, yqaO, yqzO, yqaM, yqaL, yqaK, yqaJ, yqaI, yqaH, yqaG, yqdA, yqaF, yqaE, yqaD, yqaC, yqaB, spoIIIC, yrkS
IIG-Bs27-4
flagella (deletion without promotor and sigD)
fliE, fliF, fliG, fliH, fliI, fliJ, ylxF, fliK, flgD, flgE, ylzI, fliL, fliM, fliY, cheY, fliZ, fliP, fliQ, fliR, flhB, flhA, flhF, ylxH, cheB, cheA, cheW, cheC, cheD
IIG-Bs27-5 sporulation spoIVB
IIG-Bs27-7 germination, protease
gerPF, gerPE, gerPD, gerPC, gerPB, gerPA, yisI, yisJ, yisK, yisL, wprA
IIG-Bs27-8 flagella yvzG, fliT, fliS, fliD, yvyC, hag, csrA, fliW, yviE, flgL, fliK IIG-Bs27-9 spore coat proteins cotO, cotZ, cotY, cotX, cotW, cotV, yjcA, yjzK, yjcZ, spoVIF
IIG-Bs27-11
germination, regulatory genes for differentiation
yclG, gerKA, gerKC, gerKB, yclH, yclI, yclJ, yclK, rapC, phrC, yczM, yczN, yclM, yclN, yclO, yclP, yclQ, ycnB, ycnC, ycnD, ycnE, yczG
IIG-Bs27-14 Tetracyclin resistance
yybP, yybO, yyzI, yyzJ, yyzK, yyzL, yybN, yybM, yybL, yybK, yybJ, yybI, yybH, yybG, yybF, yybE, yybD, yybC, yybB, yybA, yyaT, yyaS, yyaR, yyaQ, yyaP, tetB, tetL, yyaO, yyaN, yyaM, yyaL, yyaK, yyaJ
IIG-Bs27-16 extracellular protease yitM, yitO, yitP, yizB, yitQ, yitR, nprB, yitS
IIG-Bs27-17 extracellular protease vpr
IIG-Bs27-18 inositol degradation
yxxB, yxeR, yxeQ, yxeP, yxeO, yxeN, yxeM, yxeL, yxeK, yxeJ, yxeI, yxeH, yxeG, yxeF, yxeE, yxeD, yxeC, yxeB, yxeA, yxdM, yxdL, yxdK, yxdJ, iolJ, iolI, iolH, iolG, iolF, iolE, iolD, iolC, iolB, mmsA, iolR, iolS, yxcE, yxcD
IIG-Bs27-19 extracellular protease yktA, yktB, ykzI, suhB, ykzC, ykzD, nprE
IIG-Bs27-20 extracellular protease ywbB, ywbA, epr
IIG-Bs27-24
integration of PmtlA-comK-comS between hisI-yvcB (no antibiotic selection. The ComKcomS cassette has no marker. It was integrated first by deleting part of hisI (auxothrophy) and then by selecting his prototrophs with hisI as part of the cassette comKcomS
was integrated.) Partial deletion of yvcA
IIG-Bs27-25 regulatory genes for differentiation
yydD, yydC, yydB, yydA, yyzF, yycS, yycR, yycG, yycQ, yycP, yycO, yycN, rapG, phrG
IIG-Bs27-26 Extracellular protease mpr, ybfJ
IIG-Bs27-28
intracellular protease (pks gene cluster deleted before)
ymzD, ymzC, pksA, pksB, pksC, pksD, pksE, acpK, pksF, pksG, pksH, pksI, pksJ, pksL, pksM, pksN, pksR, pksS, ymzB, ymaE, aprX, ymzE, ymaC, ymaD, ebrB, ebrA, ymaG
IIG-Bs27-29 chemotaxis)
yulE, yulD, yulC, yulB, yuxG, tlpB, mcpA, tlpA, mcpB, tgl, yuzH, yugU, yugT, yugS, yugP, yuzI, mstX, yugO, yugN, yugM
IIG-Bs27-30
regulatory gene for differentiation,
spore coat protein,
rhamnosgalacturonan degradation
yefB, yefC, yeeA, yeeB, yeeC, yeeD, yezA, yezG, yeeF, yeeG, rapH, phrH, yeeI, yeeK, yezE, yesE, yesF, cotJA, cotJB, cotJC, yesJ, yesK, yesL, yesM, yesN, yesO, yesP, yesQ, yesR, yesS, rhgT, yesU, yesV, yesW, yesX, yesY, yesZ, yetA, lplA, lplB, lplC, lplD, yetF, yetG, yetH, yetI, yezD, yetJ, yetK, yetL, yetM, yetN, yetO
IIG-Bs27-31 extracellular protease yhfM, yhfN, aprE, yhfO, yhfP, yhfQ
IIG-Bs27-33
maltose utilisation, spore coat protein, esterase
sspH, yfjF, yfjE, yfjD, yfjC, yfjB, yfjA, malA, malR, malP, malQ, yfiC, catD, catE, yfiF, yfiG, yfiH, yfiI, yfiJ, yfiK, yfiL, yfiM, yfiN, padR, estB, yfiQ, yfiR, yfiS, yfiT, yfiU, yfiV
IIG-Bs27-35 quorum sensing competence regulation comQ, comX, comP, comA
IIG-Bs27-36 biofilm yuaB
IIG-Bs27-37 spore coat protein
ywrJ, cotB, cotH, cotG, ywrF, ywrE, ywrD, ywrC, ywrB, ywrA, ywqO, ywqN, ywqM, ywqL, ywqK, ywqJ, ywqI, ywqH, ywqG
IIG-Bs27-38 germination yvzF, gerAA, gerAB, gerAC
IIG-Bs27-39 germination
yojG, yojF, yoyC, yojE, gerT, yojB, yojA, yodA, yodB, yodC, yodD, yodE, yoyD, yodF, ctpA, yodH, yodI, yodJ
IIG-Bs27-40 Hypothetical
yueI, yueH, yueG, yueF, yuzE, yuzF, yueE, yueD, yueC, yueB, yukB, yukC, yukD, yukE, yukF, ald, yukJ
IIG-Bs27-41 Bacitracin resistance
yttB, yttA, bceB, bceA, bceS, bceR, ytrF, ytrE, ytrD, ytrC, ytrB, ytrA, ytzC, ytqA, ytqB, ytpB, ytpA, ytoA
IIG-Bs27-42 pectine esterase, b-lactamase
yoxC, yoxB, yoaA, yoaB, yoaC, yoaD, misc_RNA31, yoaE, yoaF, yoaG, yozQ, yoaH, yoaI, exlX, yoaK, pelB, yoaM, yozS, yoaN, yoaO, yoaP, yoaQ, yozT, yozF, yoaR, yoaS, yozG, yoaT, yoaU, cyeA, yoaW, yoaZ, penP, yobA, yozU, yobB
IIG-Bs27-43 erythromycin resistance manP, manA, yjdF, yjdG, yjdH, yjdI, yjzH, yjdJ
IIG-Bs27-44 peptidase, galactose utilization
yxkH, msmX, yxkF, aldY, yxkD, misc_RNA60, yxkC, galE, yxkA, yxjO, yxjN, yxjM, yxjL, pepT
IIG-Bs27-45 Quercetin resistance
yxaM, yxaL, yxaJ, yxaI, yxaH, qdoI, yxaF, yxnA, yxaD, yxzK, yxaC, yxaB
IIG-Bs27-46 Lichenan degradation
bglS, licT, yxiP, yxiO, deaD, yxiM, yxzI, yxzJ, yxiK, yxiJ, yxiI, yxzG, yxiH, yxiG, yxzC, yxiF
IIG-Bs27-47
Twin arginine export, fosfomycin resistance
yncM, ynzK, cotC, tatAC, yndA, yndB, ynzB, yndD, yndE, yndF, yndG, yndH, yndJ, yndK, yndL, yndM, fosB
IIG-Bs27-47-1
carbon-flux-regulating HPr
yvdD, yvdC, yvdB, yvdA, yvcT, yvcS, yvcR, yvcQ, yvcP, yvcN, crh
IIG-Bs27-47-2 Spore coat protein
ypsA, cotD, yprB, yprA, ypqE, ypqA, yppG, yppF, yppE, yppD, sspM
IIG-Bs27-47-3 arabinose transport, galactan utilization
araE, araR, yvbT, yvbU, cyeB, yvbW, RNA_56, yvbX, yvbY, yvfW, yvfV, yvfU, yvfT, yvfS, yvfR, rsbQ, rbsP, ganB, ganA, ganQ, ganP, cycB, ganR, yvfI, yvfH
IIG-Bs27-47-4
chitosanase, alcohol dehydrogenase, Levan degradation
yraN, yraM, csn, yraL, yraK, yraJ, yraI, yraH, yraG, yraF, adhB, yraE, yraD, yraB, yrzP, adhA, yraA, sacC, levG, levF, levE, levD, levR
IIG-Bs27-47-5 Spore coat glycosylation
yweA, spsL, spsK, spsJ, spsG, spsF, spsE, spsD, spsC, spsB, spsA, ywdL, ywdK, ywdJ, ywdI, ywdH
IIG-Bs27-47-6 N-acetylglucosamin degradation
nagA, nagBA, yvoA, yvnB, yvnA, cypX, yvmC, yvmB, yvmA, yvlD, yvlC, yvlB, yvlA, yvkN, yvzB
IIG-Bs27-47-8
Arabinan degradation, Glycolat oxidation
sspI, ysfB, glcD, glcF, ysfE, cstA, abfA, araQ, araP, araN, araM, araL, araD, araB, araA, abnA, ysdC, ysdB
IIG-Bs27-47-9
3-methyladenine glycosylase, O6-methylguanine-DNA methyltransferase, spore killing factor
alkA, adaAB, ndhF, ybcC, ybcF, ybcH, ybcI, ybzH, ybcLM, skfA, skfB, skfC, skfE, skfF, skfG, skfH, ybdG, ybdJ, ybdK, ybzI, ybdM, ybdN, ybdO, ybxG, csgA, ybxH, ybxI, cybC, ybyB, ybeC IIG-Bs27-47-10 Putative paraquat resistance yfhH, yfhI, sspK, yfhJ, yfhK, yfhL, yfhM, csbB, yfhO, yfhP
IIG-Bs27-47-11
Autolysin, germination, poly-g-glutamate
lytD, yvyI, gerBA, gerBB, gerBC, ywtG, ywtF, ywtE, pgdS, pgsE, pgsA, pgsC, pgsB, rbsR, rbsK, rbsD, rbsA, rbsC, rbsB, ywsB, ywsA
IIG-Bs27-47-12
Chemotaxis, comK regulator, cell wall synthesis, 2,-4-dienoyl-CoA-reductase, AbrB anti-repressor
ykzT, cheV, kre, ykuC, ldt, ykuE, fadH,fadG, ykzU, ykuH, ykuI, ykuJ, ykuK, abbA, ykuL
IIG-Bs27-47-13 Glucarate/Galactarate degradation ycbC, ycbD, gudP, gudD, ycbG, garD, ycbJ
IIG-Bs27-47-14 Hypothetical
cotT, yjeA, yjfA, yjfB, yjfC, yjgA, yjgB, yjgC, yjgD, yjhA, yjhB, yjiA, yjiB, yjiC, yjzI, yjjA, yjkA, yjkB, yjlA, yjlB
IIG-Bs27-47-15 Xylan/xylose degradation
xynP, xynB, xylR, xylA, xylB, yncB, yncC, alrB, yncE, yncF, cotU, ynzJ
IIG-Bs27-47-16 Hypothetical ykzB, ykoL, ykoM, ykoN, ykoP, ykoQ, ykoS, ykoT
IIG-Bs27-47-17 Hexuronate utilization, sporulation
uxaC, yjmB, yjmC, yjmD, uxuA, uxuB, exuT, exuR, uxaB, uxaA, yjnA, yjoA, yjoB, rapA, phrA, xlyB, yjqA, yjqB, yjqC, xkdA, xre, yjzJ, xkdB, xkdC, xkzK, xkdD, xtrA, xpf, xtmA, xtmB, xkdE, xkdF, xkdG, xkzL, xkdH, xkdI, xkdJ, xkzM, xkdK, xkdM, xkdN, xkzB, xkdO, xkdP, xkdQ, xkdR, xkdS, xkdT, xkdU, xkzA, xkdV, xkdW, xkdX, xepA, xhlA, xhlB, xlyA, spoIISB, spoIISA
IIG-Bs27-47-18 hypothetical
ykvN, ykvO, ykvP, ykzQ, ykvQ, ykzR, ykvR, ykvS, ykzS, ykvT, ykvU
IIG-Bs27-47-19
Peptidoglycon hydrolase, quinone resistance
yocH, yocI, misc_RNA32 (bsrB, 6S-2RNA), yocJ, yocK, yocK, yocL, yoyB, yocM, yozN, yocN, yozO, yozC
IIG-Bs27-47-20 Galacturonic acid utilization ypwA, kdgT, kdgA, kdgK, kdgR, kduI, kduD, ypvA, yptA, ypzG
IIG-Bs27-47-21
Spore wall maturation, methionine regeneration
yoyE, yodL, yodM, yozD, yoyF, yodN, yozE, yokU, kamA, yodP, yodQ, yodR, yodS, yodT, yoyG, cgeE, cgeD, cgeC, cgeA, cgeB _(Phage SPbeta) ypqP, msrB, msrA, ypoP, dinF, ypmT, ypmS, ypmR
IIG-Bs27-47-22
Phenoloc acid decarboxylase, peniciliin binding protein PBP 4, levan sucrase
padC, yveG, yveF, racX, pbpE, sacB, levB, yveA, yvdT, yvdS, yvdR. yvdQ, yvdP, cotR
IIG-Bs27-47-23
Insertion slrR at aprE locus: We observed a strong lysis in the mutants and thought this might be the loss of slrR. So we introduced it again but the effect was low or undetectable. Deleting it again was too much efforts.
IIG-Bs27-47-24
Myo-inositol uptake, butandiol dehydrogenase, g-aminobutyric acid permease
pspA, ydjG, ydjH, ydjI, ydjJ, iolT, bdhA, ydjM, ydjN, ydzJ, ydjO, ydjP, yeaA, cotA, gabP, ydzX, yeaB, yeaC, yeaD, yebA
IIG-Bs27-47-25
Lichenan utilization, ECF-type sigma factor Y
licH, licA, licC, licB, licR, yxzF, aag, katX, yxlH, yxlG, yxlF, yxlE, yxlD, yxlC, sigY, yxlA, yxkO
IIG-Bs27-47-26
Autolysin, purin utilization, extracellular RNase Bsn, aminosugar utilization
lytH, yunB, yunC, yunD, yunE, yunF, yunG, pucH, pucR, pucJ, pucK, pucL, pucM, yuzJ, pucE, pucD, pucC, pucB, pucA, pucG, pucF, bsn, yurJ, frlR, frlD, frlM, frlN, frlO, frlB, yurQ, yurR, sspG, yurS, yurT, yuzN
IIG-Bs27-47-27 Pullulanase, flippase
ytzH, ytmP, amyX, ytlR, ytlQ, ytlP, ytkP, ytjP, pbuO, ythQ, ythP, ytzE, ytzG, murJ, ytfP, opuD, yteV, yteU, yteT, yteS, yteR, yteP, ytdP, ytcQ, ytcP
IIG-Bs27-47-28 Teichoic acid alanylation ywzH, dltA, dltB, dltC, dltD, dltE
IIG-Bs27-47-29
Urea utilization, response regulator aspartate phosphatase
mta, ywnC, ywnB, ywnA, ureC, ureB, ureA, ywzE, ywzF, csbD, ywmF, rapB
IIG-Bs27-47-30 Peptidyl-prolyl isomerase yrhK, cypB, bscR, yrhH, yrzI, yrhG, yrhF, yrhE, yrhD, yrhC
IIG-Bs27-47-31
Surfactin, comS,
4-phosphopantetheinyl transferase srfAA, srfAB, comS, srfAC, srfAD, ycxA, ycxB, ycxC, ycxD, sfp
IIG-Bs27-47-32
Glycine betaine transporter, Amylase, overflow metabolism, multidrug.efflux transporter
yceB, yceC, yceD, yceE, yceF, yceG, yceH, yceI, yceJ, yceK, opuAA, opuAB, opuAC, amhX, ycgA, ycgB, amyE, ldh, lctP, mdr, ycgE, ycgF, ycgG
IIG-Bs27-47-33 sporulation
spoIIIAH, spoIIIAG, spoIIIAF, spoIIIAE, spoIIIAC, spoIIIAB, spoIIIAA, yqhV
IIG-Bs27-47-35
Gluconate utilization, oxidative stress resistance
gntR, gntK, gntP, gntZ, ahpC, ahpF, bglA, yyzE, yydK, yyzN, yydJ, yydI, yydH, yydG, yydF
IIG-Bs27-47-36
Salicin-, histidin utilization, arabinan degradation
yxxF, yxiE, bglH, bglP, yxxE, yxxD, yxiD, yxiC, yxiB, abn2, yxzL, hutP, hutH, hutU, hutI, hutG, hutM
IIG-27-47-37 Utilization of specific carbon sources
ydaS, ydaT, ydbA, gsiB, ydbB, ydbC, ydbD, dctB, dctS, dctR, dctP, ydbI, ydbJ, ydbK, ydbL, ydbM, ydbN, ydbO
27-47-38 (PS38) Spore coat proteins (For 27-47-38 I tried a method for deletion by just fusing flanking sequences to CmR and integrating the linear DNA. Cmr had
mrpA sites for site-specific recombination by MrpA and mrpA is on the plasmid pJOE6732.1. So Cmr could be removed again.)
27-47-40 (PS40) ywzA-ywbO ywzA, galT, galK, ywcD, ywcC, slrA, ywcA, ywbO
27-47-41 (PS41) ywbF-sacY ywbF, ywbE, ywbD, ywbC, ywbB, ywbA, epr, sacX, sacY, gspA
27-47-42 (PS42) yugK-yuxJ
yugK, yugJ, yuzA, yugI, alaT, yugG, yugF, yugE, patB, kinB, kapB, kapD, yuxJ
27-47-43 (PS43)
DCmlR (For 27-47-38 I tried a method for deletion by just fusing flanking sequences to CmR and integrating the linear DNA. Cmr had mrpA sites for site-specific recombination by MrpA recombinase and mrpA is on the plasmid pJOE6732.1. So Cmr could be
removed again.) mrox::cat
27-47-44 (PS44) yizA-yisY yizA, yisP, yisQ, yisR, degA, yisS, yisT, yisU, yisV, yisX, yisY
27-47-45 (PS45) ytaP-ytwF ytaP, msmR, msmE, amyD, amyC, melA, ytwF
27-47-46 (PS46) mgsR-yqgS mgsR, yqgX, yqgV, yqgU, yqgT, yqgS
27-47-47 (PS47) mmr-ywfM mmr, ywgB, ywgA, ywfO, ywzC, rsfA, ywfM
27-47-48 (PS48) yfnH-yfmG
yfnH, yfnG, yfnF, yfnE, yfnD, yfnC, yfnB, yfnA, yfmT, yfmS, yfmR, yfmQ, yfmP, yfmO, yfmN, yfmM, yfmL, yfmK, yfmJ, yfmI, yfmG
27-47-50 (PS50) yxcA-asnH yxcA, yxbG, yxbF, aldX, yxbD, yxbC, yxbB, aslA, yxnB, asnH
PS51 yddN-ydgE
yddN, lrpA, lrpB, yddQ, yddR, yddS, ydzM, yddT, ydzN, ydeA, cspC, ydeB, ydzE, ydeC, ydeD, ydeE, ydeF, ydeG, ydeH, ydeI, ydeJ, ydeK, ydeL, ydeM, ydeN, ydzF, ydeO, ydeP, ydeQ, ydeR, ydeS, ydzO, aseR, aseA, ydzS/1, ydzS/2, ydfB, ydfC, ydfD, ydfE, ydeF, ydfG, ydzP, ydzQ, ydfH, ydfI, ydfJ, nap, ydfK, ydfL, ydfM, mhqN, mhqO, mhqP, ydfQ, ydzR, ydfR, ydfS, cotP, ydgA, ydgB, ydgC, ydgD, ydgE
PS52 bglC-ppsA
bglC, ynfE, xynC, xynD, yngA, yngB, yngC, nrnB, yngE, yngF, yngG, yngHB, yngH, yngI, yngJ, ynzE, yngK, yngL
PS53 lmrB-ycdG
lmrB, lmrA, ansZ, lip, yczC, yccF, natK, natR, natA, natB, yccK, ycdA, ycdB, ycdC, cwlK, rapI, ycdFycdG
PS54
yuzM-mrgA (Leendert: MrgA is zeer conserved)
yuzM, yusN, yusO, yusP, yusQ, yusR, yusS, yusT, yusU, yusV, yusW, yusY, yusZ, mrgA
PS55 yhcM-yhzG
yhcM, yhcN, yhcO, yhcQ, yhcR, yhcS, yhcT, yhcU, yhcW, yhcX, yhzG,
PS56 yvaP-yvbK
yvaP, yvaQ, opuBD, opuBC, opuBB, opuBA, yvaV, opuCB, opuCC, opuCB, opuCA, yfbF, yvbG, yvbH, yvbI, yvbJ, yvbK
PS58 iolW-yvaG iolW, azoR2, yvaC, yvaD, yvaE,yvaF, yvaG
PS59
yhxD-yhjP (insertion of comS 3´ to comK) made a mutation in addB due to a PCR error!!! Restored in PS73
yhxD, yhjA, yhjB, yhjC, yhjD, yhjE, sipV, yhjG, yhjH, glcP, ntdC, ntdB, ntdA, yhjM, yhjN, yhjO, yhjP
PS60 ycbC-cwlJ
ycbCD, gudPD, ycbG, garD, ycbJ, BSU_RNA, rtpA, ycbKLMNOP, cwlJ
PS61 salA-kbaA salA, gerD, kbaA
PS62 yfmB-nagP
yfmB, yfmA, yflT, pel, yflS, citS, citT, yflP, citM, yflN, nos, yflL, yflK, yflJ, yflI, yflH, yflG, nagP
PS63 ypfB-ypbB
ypfB, dgrA, ypeB, sleB, prsW, ypdA, gudB, ypbH, ypbG, ypbF, ypbE, ypbD, recQ, ypbB
PS64 yjcM-yjdB (Dpro4) yjcM, yjcN, yjzF, yjzG, yjcO, yjcP, yjcQ, yjcR, yjcS, yjdA, yjdB
PS65 cotT-yjlB (Wiederholung)
cotT, yjeA, yjfA, yjfB, yjfC, yjgA, yjgB, yjgC, yjgD, yjhA, yjhB, yjiA, yjiB, yjiC, yjzI, yjjA, yjkA, yjkB, yjlA, yjlB
PS66 Plus diff-site Insert diff
PS67 yisZ-yitI yisZ, yitA, yitB, yitC, yitD, yitE, yitF, yitG, yitH,yitI
PS68 yhbD-yhcI
yhbD,yhbE, yhbF, prkA, yhbH, yhbI, yhbJ, yhcA, yhcB, yhcCyhcD, yhcE, yhcF, yhcG, yhcH, yhcI
PS69 yjaZ-yjbA yjaZ, appD, appF, appA, appA*, appB, appC, yjbA
PS70 yqkF-yqjU
yqkF, yqkE, yqkD, yqkC, yqkB, yqkA, yqjZ, yqjY, yqjX, polYB, yqzH, yqjV, yqjU
PS70-9526-1 Integration appA-D::P1cre (mutiert)KmR PS70-9560.1 Integration appA-D::P1cre (WT)KmR JA-Bs27
PS71 oppA-yjbC oppA-yjbC
PS73
By one of the deletions (PS59) we made a mutation in addB due to a PCR error and to repair this mutation we
integrated the wt sequence. Repair addB
PS74 yufL-yufQ yufL, yufM, yufN, yufO, yufP, yufQ
Alternative streamlining route, IIG-Bs27-47-24 derived
PG3
licH, licA, licC, licB, licR, yxzF, aag, katX, yxlH, yxlG, yxlF, yxlE, yxlD, yxlC, sigY, yxlA, yxkO
PG4
lytH, fisB, yunC, yunD, yunE, yunF, yunG, pucH, pucR, pucJ, pucK, pucL, pucM, yuzJ, pucE, puD, pucC, pucB, pucA, pucG, pucF, yurI, yurJ, frlR, frlD, frlM, drlN, frlO, frlB, yurQ, sspG, yurS, glxB, yuzN
PG6 cimH, yxkI, yxkE, yxkH, msmX, yxkF, aldY, yxkD, yxkC, galE,
yxkA, yxjO, yxjN, yxjM, yxjL, pepT, yxjJ, yxjI, yxjH, yxjG, yxjF, scoB, scoA, yxjC, yxjB, nupG, yxiT/1, yxiT/2, yxiS, katE, citH,
bglS, licT, yxiP, yxiO, deaD, yxiM, yxzI, yxzJ, yxiK, yxiJ, yxiI, yxzG, yxiH, yxiG, yxzC, yxiF
PG7 yvgN, yvgO, nhaK, cysI, cysJ, helD, yvgT
PG8 cysH, cysP, sat, cysC, ylnD, ylnE, ylnF, yloA, yloB
PG9 splA, splB, ykwB, mcpC, ykwC, ykwD, pbpH, kinA
PG10
gerPF, gerPE, gerPD, gerPC, gerPB, gerPA, yisI, yisJ, yisK, yisL, wprA, yisN, asnO, yizA, yisP, yisQ, yisR, degA, iolX, yisT, yisU, yisV, yisX, yisY, yisZ, yitA, yitB, yitC, yitD, yitE, yitF, yitG, yitH, yitI, yitJ, yitK, yitL, yitM, yitO, yitP, yizB, yitQ, yitR, nprB, yitS, yitT, ipi, yizC, yitU, yitV, yitW, yitY, yitZ, argC, argJ, argB, argD, carA, carB, argF, yjzD,yjaU, yjaV
Table S4. Oligonucleotides used in this study
Name Sequence (5’ -> 3’) Purpose
RVS001 GCAGACCTGCTGTATCACCTGC Check integration of pJOE7361.1.3 in
B. subtilis 168
RVS001 CTCGTCCTGAAACGCAGGTACTTG Check integration of pJOE7361.1.3 in
B. subtilis 168
S1. Materials and Methods
Media
Lysogeny Broth (LB) Compound g/l Bactotrypton 10 Yeast extract 5 NaCl 10For Nutrient Agar plates
Agar 18
For additional NaCl
0.7 M NaCl 40.09
1 M NaCl 58.44
Table 2. Ingredients for basic LB medium, and possible additional ingredients, in grams/litre. (G. Bertani, 1951)
Amber medium AMBER
medium Stock (mM) Final (mM) Dilution
μl stock in 50 ml
K2HPO4 KH2PO4 Kpi pH 7,4 700 300 70 30 10 10 5000 1000 100 10 (NH4)2SO4 1000 10 100 500 NaCl 2000 15 133.33 375 MgSO4 2000 1 2000 25 Fe-NH4-citrate 8,3 0,01 830 60 K-glutamate 1000 10 100 500 Glucose 2220 22 100.91 495 Tryptophan 32 0.25 128 391 ZnCl2 5x2 0.002 1000 50 MnSO4 0.002 CuCl2 0.002 CoCl2 0.002 Na2MoO4 0.002 CaCl2 100 0.1 1000 50 Milli-Q 42554
Table 3. Amber medium protocol. All stocks are made using Milli-Q water. In this study, Amber medium was generally used
without the addition of tryptophan. The volume was appropriately compensated with Milli-Q water. Acknowledgement to Laura C. Bohorquez for the composition and protocol.
Protocols
Improved growth rate protocol Day 1
Step 1 Prepare an NA- plate for each strain to be inoculated (see Supplementary Methods). Step 2
At the end of the afternoon (~17:00) take the minimal strains and wild type
from the -80 C stock. Scrape a small amount of frozen stock out of the
cryotube (be aware, don’t let the -80C stock thaw, put it in the cooled holder
not in the hand), and streak onto a nutrient agar plate using a pipette tip. Use
a sterile toothpick to streak further out to single colonies.
STEP 3
Grow overnight at 37 C stove. Incubate the plates upside down.
Day 2
STEP 4
