1
The role of the OxyR gene in ‘de novo’
acquisition of antibiotic resistance by anaerobic
grown Escherichia coli
By Yke Sijpestijn 11329157 30-06-2020
2 Abstract
The rise of antibiotic resistance (AR) obtained by bacteria is causing major problems in healthcare systems since infections caused by antibiotic-resistant bacteria are no longer treatable. Bacteria like Escherichia coli (E.coli) can transfer genetic information, containing resistance properties, through horizontal gene transfer and other kinds of exchange. However, E.coli has shown to obtain AR “de novo” through genetic mutations and adaptations at the gene expression level after exposure to sublethal antibiotic concentrations. One gene that is known to assist bacteria in obtaining AR is the OxyR gene, which protects the bacterial cell from hydrogen peroxide (H2O2) in aerobic conditions and from nitrosative stress in anaerobic conditions. Whether AR could still be obtained by E.coli without the OxyR gene was investigated in this research by performing an evolution experiment. Also, the difference in obtaining AR between ΔOxyR E.coli in anaerobe conditions and aerobe conditions was studied. After performing the evolution experiment, E.coli, without OxyR and growing in an anaerobic
environment, was able to acquire AR to amoxicillin, enrofloxacin, kanamycin, and tetracycline.
Although it took the anaerobically grown cultures longer to resist higher antibiotic concentrations than it took the aerobically grown cultures, AR was still obtained in both cultures.
3 Introduction
The discovery of antibiotics during the 20th century was a medical breakthrough because many deadly bacterial infections could now be cured efficiently (O’neill et al., 2014). But as a consequence of how evolution works, the targeted bacteria ultimately obtained antibiotic resistance (AR) (Zaman et al., 2017). Nowadays, the rise of AR causes major problems in healthcare systems, since infections caused by antibiotic-resistant bacteria are no longer treatable. Besides, the rise of AR causes trouble to many other common procedures, like catheterizations and transplantations, that depend on antibiotics to succeed. (Martinez et al., 2008). It is estimated that around 300 million people will die from now to 2050 because of the effects of AR. (O’neill et al., 2014). Nonetheless, AR acquisition by bacteria can be studied well. It is believed that bacteria obtaining AR can be anticipated and therefore can be stopped to prevent major healthcare problems (Martinez et al., 2007).
Evolution can take place at a higher pace when mutations occur. Mutations are the source of increased genetic variability, which can be advantageous for bacteria. Hence, mutations can benefit bacteria when situated in altered unfavorable environments (Shewaramani et al., 2017).
Bacteria like E.coli can transfer genetic information through horizontal gene transfer and other kinds of exchange in which resistance-conferring mobile genetic elements are transported between plasmids (Knopp et al., 2019, Hoeksema et al., 2018). In previous studies, however, E.coli has shown to obtain AR ‘de novo’ through adaptation at the gene expression level and as a result of genetic mutations after gradually exposing E.coli with sublethal antibiotic concentrations (Händel et al., 2014). At first, E. Coli obtains AR to low antibiotic concentrations through ribosome-sensed induction and efflux pump activation, which actively transports the antibiotic out of the bacterial cell membrane. Thereafter, the SOS response, a pathway promoting DNA instability and mutations, is induced by exposure to higher antibiotic concentrations, which will eventually cause resistance genes to be expressed, inhibiting the effectiveness of the antibiotic (Händel et al., 2014). The genes that are permanently or temporarily differentially expressed compared to their susceptible ancestors could play a role in the acquired AR of E.coli (Händel et al., 2016).
Different kinds of bactericidal antibiotics have different mechanisms to kill bacteria (Stokes et al., 2019). For instance, beta-lactams target the cell wall of bacteria (Sykes et al., 2013),
fluoroquinolones inhibit DNA gyrase activity thereby inhibiting DNA replication (Shah et al., 2007 & Dwyer et al., 2007), and aminoglycosides target the ribosomal function (Jana et al., 2006).
Bacteriostatic antibiotics, however, only prevent the growth of the bacteria through inhibit protein synthesis (Kohanski et al., 2010). Different mechanisms at which different antibiotics operate could result in a different set of genes that are mutated between the E.coli cultures (Händel et al., 2014) However, the “radical-based theory” suggests that different bactericidal antibiotics share a common secondary killing mechanism, the formation of reactive oxygen species (ROS) (Dywer et al., 2014). Previous research suggests that all bactericidal antibiotics induce ROS levels in the bacterial cell, which causes a cascade of mutations and overall altered genetic expression (Hoeksema et al.,
4 2018). If the bacteria can protect itself from high ROS levels by protective cellular responses, this mechanism could assist the bacteria by obtaining AR to bactericidal antibiotics (Hoeksema et al., 2018).
Since E.coli is a gut bacteria, it is living in anaerobic conditions where mutation could differ from growing E.coli aerobically (Shewaramani et al., 2017). Normally, during aerobic respiration, oxygen is the universal electron acceptor and by-products of this cellular process are oxygen radicals, which damage various bacterial cell processes (Hoeksema et al., 2018). But, anaerobic respiration requires different electron acceptors, for instance, nitrate and nitrite, which are converted to low levels of Nitric Oxide (NO) in anaerobic growth of bacteria (Bundy et al., 2000). Higher levels of NO could lead to conversion to reactive nitrogen species (RNS) like peroxynitrite (ONOO–), nitroxyl anion (NO–), and nitrogen dioxide (NO2) (Brandes et al., 2007). The formation of these RNS radicals can disturb many cellular processes similarly to ROS. (Ozcan et al., 2015).
Thus, antibiotics that enter the gastrointestinal tract can give E.coli a chance to acquire anaerobic “de novo” AR. Previous studies showed that E.coli underwent a higher mutation rate in anaerobic conditions than in aerobic conditions (Shewaramani et al., 2017). These findings suggest that E.coli experienced more base-pair substitutions, insertions, deletions, and structural variants in anaerobic conditions. The higher mutation rates can provide E.coli the opportunity to become more resistant to antibiotics, depending on the gene in which the mutations have occurred.
Many genes are involved in the acquirement of AR, and it is said that knockout of these genes can eventually result in susceptibility to different kinds of antibiotics again (Tamae et al., 2008). One of the genes that is involved in the homeostatic regulation of ROS in the cell and thereby acquirement of AR is OxyR, a thiol-containing transcriptional activator belonging to the LysR family (Gonzalez-Flecha et al., 1997). The OxyR gene gets activated by hydrogen peroxide (H2O2), which inflicts oxidative stress to E.coli. On a molecular scale, exposure to H2O2 will cause a disulfide bond formation between two cysteine residues, oxidizing the OxyR protein (Pomposiello et al., 2001). Oxidized OxyR is active and regulates the expression of catalase, hydroperoxide, glutathione reductase, and alkyl hydroperoxide reductase genes, which defend the cell from H2O2. Glutathione reduces the disulfide bonds which can make OxyR inactive, while glutathione reductase re-reduces glutathione, making this transcriptional regulation self-controlled (Pomposiello et al., 2001).
However, in this experiment, E.coli was grown anaerobically and will undergo nitrosative stress instead of oxidative stress. Previous research found that, in anaerobic conditions, the conformational change of the OxyR protein cannot be initiated by H2O2 but will be initiated by S-nitrosothiols, which transfer NO to a cysteine residue. Like H2O2, S-nitrosylation of the cysteine residues triggers the activation of OxyR and induces expression of OxyR regulated genes (Hausladen et al., 1996). Besides, previous research found that the OxyR gene protects E.coli from nitrosative stress in anaerobic conditions (Seth et al., 2012). In this experiment, the OxyR gene is removed. Thus, without the OxyR gene, it would be expected that E.coli is less protected against nitrosative stress that
5 could be induced by amoxicillin, enrofloxacin, kanamycin, and tetracycline, which are antibiotics from different classes.
Whether AR could still be obtained by E.coli without the OxyR gene is investigated in this research, by performing an evolution experiment. During the evolution experiment, the increasing minimal inhibitory concentration (MIC) of amoxicillin, enrofloxacin, kanamycin, and tetracycline were measured to determine AR acquirement by ΔOxyR E.coli. Thereby, the difference in obtaining AR between ΔOxyR E.coli grown in anaerobe conditions and aerobe conditions is studied.
Materials & Methods
Antibiotic preparation
All antibiotics had a stock solution of 10mg/mL. Each antibiotic was filtered with a 0.2μM filter before usage. Fresh antibiotics were made every 3 days.
10μg/mL amoxicillin solution was made by dissolving 0.1g amoxicillin in 0.5mL 1M HCl and 9.5mL Milli Q water.
10μg/mL enrofloxacin solution was made by dissolving 0.1g enrofloxacin in 5mL 0.1M HCl. Next, the pH value was brought to 10 by adding 260μL 4MNaOH. 4.74mL Milli Q water was added. 10μg/mL kanamycin was made by dissolving 0.1g kanamycin in 10mL Milli Q water.
10μg/mL tetracycline was made by dissolving 0.1g tetracycline in 0.5mL 1M HCl and 9.5ml Milli Q water.
MIC
The minimal inhibitory concentration (MIC) of antibiotics that will inhibit the visible growth of the mutant E.coli strain was measured with a 96-wells plate. To each well, 150μL Evans with 55mM glucose was added. A dilution of amoxicillin, enrofloxacin, kanamycin, and tetracycline was made with the maximum desired antibiotic concentration. 300μL diluted antibiotic was added to column 1 and diluted 2x between each column by adding 150μL to the next column. After reaching column 10, 150μL was disposed of. The bacterial culture with a final OD of 0.05 was added to column 1-11, which makes column 11 the positive control containing bacteria but no antibiotics. Column 12 served as a negative control to make sure there was no contamination. The 96-wells plate was incubated at 37°C for 23 hours at an absorbance measurement of 595nm inside a plate reader. An OD measurement at an absorbance measurement of 595nm was made every 10 minutes (138 measurements).
Evans medium with 55mM glucose was used for the MIC. First, the Evans medium was autoclaved for 20 minutes at 121°C. Next, a 10% volume of 550mM glucose stock solution was added to the sterile Evans medium to create Evans medium with 55mM glucose.
6 Bottle MIC
A bottle MIC is performed to check whether the results match the plate reader MIC. The bacteria are grown with 1,8mL 55mM glucose in 18mL anaerobic culture bottles with Evans medium.
Removal of the chromosomal Kanamycin resistance gene by FLP recombination
The ΔOxyR E.colistrain contained a kanamycin-resistant gene. To prepare the removal of the kanamycin gene, E.coli DH5alpha was plated on LB + AMP (ampicillin (100μg/mL)) or LB + CHL (chloramphenicol (100μg/mL)) and incubated overnight at 30 °C. The next day, a single colony of E.coli DH5alpha was inoculated in 10mL LB+ampicillin or LB+chloramphenicol and incubated overnight in the 30°C 200 rpm shaking incubator. The plasmid was isolated using the miniprep kit (Thermo Scientific GeneJET Plasmid Miniprep Kit), the cells were made electrocompetent and electrophoresis was performed. After electroporation, 1000μL LB was added to recover the cells. The cells were incubated in the 30 °C 200 rpm shaking incubator. After 60 minutes, 50μL of the cells were plated on 3 LB plates with ampicillin and incubated at 30°C for 36 hours. One colony of each plate was inoculated in 5mL LB medium and incubated overnight at 45°C to induce FLP recombinase expression. To get single candidate recombinants, 5μL of the overnight culture was mixed with 495μL LB medium to get a 100-fold dilution. Then, 50μL of the diluted overnight culture was plated on 3 LB plates without antibiotics and incubated at 30°C for 2 days. The 30°C incubator was used to prevent partial loss of the pcp20 plasmid. After incubation, the 3 plates were divided into 2 and a colony of each half was suspended in 100μL LB medium to get 6 different suspensions.
To screen the genomic recombination and the plasmid loss, 4 different plates with either LB, LB + AMP, LB + CHL, and LB + KAN (kanamycin) were used. Each plate was divided into 6 and 15μL of each suspension was plated on the 4 plates. The plates were incubated overnight at 37°C. The
candidate sensitive to all antibiotics was used and archived.
(According to the protocol of Datsenko et al., 2000, Barrick La b et al., FLP Recombination in E. coli 2014)
Making electrocompetent E.coli cells
Before electroporation, the E.coli cells needed to be made electrocompetent. Firstly an overnight culture of ΔOxyR E.coli was grown in LB medium. 500μL (OD 0.05) of the stationary-phase culture is added to two 50mL flasks with 10mL LB medium. Cells were grown for 2 hours until they had reached the mid-exponential phase (an OD of approximately 0.6). Cells were centrifuged for 6 minutes at 4500 rpm. The pellet was washed four times consecutively by adding 10mL 10% glycerol. A 100x diluted concentration is made by resuspending the culture in 100μL 10% glycerol. The culture was divide into 50 μl aliquots to proceed to electroporation.
7 Transforming E.coli Cells by Electroporation
Electroporation was performed to increase the permeability of the E.coli cell membrane.
1μL of DNA (<100ng) was added to the electrocompetent cells. After 10 minutes of sitting on ice, the mixture was placed in the pulser, Ec I setting.
(Kingston et al., 1995,Datsenko et al., 2000)
Evolution experiment
An ΔOxyR E.coli strain (properties strain: F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), λ, rph-1, Δ(rhaD-rhaB)568, ΔoxyR749::kan, hsdR514) was used for the evolution experiment.
Evans medium is a defined minimal medium, which was used to grow the mutant E.coli (table 1). 4M NaOH was used to increase the pH of the Evans medium to 6.9. E.coli was incubated in 18mL
anaerobic culture bottles, that contain three autoclavable parts: a screw cap with an opening, a non-toxic butyl rubber stopper (which is gas impermeable), and a recyclable screw cap culture bottle. The anaerobic culture bottles with Evans medium were autoclaved for 30 minutes at 121°C to remove as much oxygen as possible. 10 % Glucose was added to the Evans medium as a supplement to generate a rich medium with a high amount of carbon. The 10% Glucose medium was made by adding 50 g glucose to 500mL MiliQ water, after which the medium was autoclaved for 10 minutes at 110°C. 60% Glycerol was used to store bacterial cultures at -80°C. Resazurin was used as an oxygen indicator.
Table 1. Components of Evans medium Molar mass (M) Substance
0.1 NaH2PO4.2H2O 0.01 KCl 0.0125 MgCl2.6H2O 0.1 NH4Cl 0.02 Na2SO4 0.002 Titriplex (nitrilotriacetic) 0.02 CaCl2.2H2O Trace elements
To determine whether ΔOxyR E.coli was able to acquire AR to amoxicillin, enrofloxacin, kanamycin, and tetracycline, an evolution experiment was performed. To prepare for the evolution experiment, ΔOxyR E.coli was grown on LB agar plates and inoculated in anaerobic culture bottles with 18ml Evans medium with 55mM glucose at 37 °C and 200rpm in a shaking incubator. To make sure it is a susceptible strain, a MIC was performed.
8
To start the evolution experiment, 2 replicates were made with the following antibiotic concentrations: 1μg/mL amoxicillin, 0.25μg/mL tetracycline, 2μg/mL kanamycin and 0.03125μg/mL enrofloxacin. A bottle without antibiotics was used as a control. To all bottles, an OD of 0.1 of ΔOxyR E.coli was added and the bottles were incubated in the shaking incubator at 37°C. All samples were checked for growth and the OD600 was measured using a photo spectrometer. If the culture had an OD of 75% or higher, an OD of 0.1 of the culture was added to a bottle containing the same antibiotic concentration and added to a bottle containing the double amount of the antibiotic. The control bottle was continued without antibiotics for the entire experiment.
This process was continued until the maximum concentration of antibiotic was reached at
which E.coli displayed an OD of 75% or higher compared to the previous antibiotic concentration. A MIC was performed twice a week for each culture and every 2 weeks for the control. A sample of E.coli that had an OD of 75% or higher was stored at -80 °C with 60% glycerol.
Results
Evolution experiment
During the evolution experiment, ΔOxyR E.coli was endeavored to obtain AR to amoxicillin, enrofloxacin, kanamycin, or tetracycline. If the OD600 value was 75% or higher compared to the previous antibiotic concentration, the concentration of antibiotics got increased two-fold. Figure
1 shows the amoxicillin concentration that ΔOxyR E.coli could endure over time (1A&1B) and the
number of generations (1C&1D). The concentration of amoxicillin that ΔOxyR E.coli could tolerate in aerobe conditions over time (1B) and over the number of generations (1D) are shown. All the
following results for amoxicillin, enrofloxacin, kanamycin, and tetracycline of aerobic ΔOxyR E.coli were obtained by Tine Visser.
It took the first ΔOxyR E.coli strain that was growing in amoxicillin (AMO I) 19 days and 59 generations to get to the maximum amoxicillin concentration of 1024μg/mL. The second
ΔOxyR E.coli strain in amoxicillin (AMO II) reached an amoxicillin concentration of 1024μg/mL after 23 days and 68 generations. ΔOxyR E.coli in aerobe conditions (AMO aerobic) reached a maximum amoxicillin concentration of 2048μg/mL after 20 days and 95 generations.
A B
9
C D
Figure 1. Increasing amoxicillin concentrations that ΔOxyR E.coli could resist.
Shown is the log(2) increasing amoxicillin concentrations over time (1A&1B) and over the number of generations (1C&1D) in which ΔOxyR E.coli could grow. Also, the increasing amoxicillin concentrations in which aerobic ΔOxyR E.coli could grow are shown (1B&1D), obtained by Tine Visser.
The enrofloxacin concentration that ΔOxyR E.coli could endure is shown in figure 2. The first ΔOxyR E.coli strain growing in enrofloxacin (ENRO I) reached a maximum concentration of 1024μg/mL after 30 days (2A) and 83 generations (2C), the second strain (ENRO II) reached a maximum concentration of 1024μg/mL after 27 days (2A) and 81 generations (2C), after which it could not grow in 1024μg/mL for 2 days. The anaerobic grown ΔOxyR E.coli strain (ENRO aerobic) reached a maximum concentration of 2048μg/mL after 31 days (2B) and 150 generations (2D).
A B
10 Figure 2. Increasing enrofloxacin concentrations that ΔOxyR E.coli could resist.
Shown is the log(2) increasing enrofloxacin concentrations over time (2A&2B) and over the number of generations (2C&2D) in which ΔOxyR E.coli could grow. Also, the increasing amoxicillin concentrations in which aerobic ΔOxyR E.coli could grow are shown (2B&2D)
The kanamycin concentration that ΔOxyR E.coli could endure is shown in figure 3. The first
ΔOxyR E.coli strain growing in kanamycin (KAN I) reached a maximum concentration of 512μg/mL after 24 days (3A) and 71 generations (3C). The second ΔOxyR E.coli strain (KAN II) reached a maximum concentration of 512μg/mL as well, after 22 days (3A) and 70 generations (3C). The ΔOxyR E.coli strain that was grown in aerobic conditions reached a maximum concentration of 2048μg/mL after 20 days (3B) and 101 generations (3D)
A
B
C D
Figure 3. Increasing kanamycin concentrations that ΔOxyR E.coli could resist.
Shown is the log(2) increasing kanamycin concentrations over time (3A&3B) and over the number of generations (3C&3D) in which ΔOxyR E.coli could grow. Also, the increasing kanamycin concentrations in which aerobic ΔOxyR E.coli could grow are shown (3B&3D).
11
The tetracycline concentration that ΔOxyR E.coli could endure is shown in figure 4. The first ΔOxyR E.coli strain growing in tetracycline (TET I) reached a maximum concentration of 32μg/mL after 21 days (4A) and 62 generations (4C), the second strain (TET II) reached a maximum
concentration of 32μg/mL after 20 days (4A) and 58 generations (4C). TET I could grow in 16μg/mL tetracycline for 4 days after reaching the maximum concentration. TET II & TET aerobic showed the same for 1 day. The anaerobic grown ΔOxyR E.coli strain (TET aerobic) reached a maximum concentration of 64μg/mL after 20 days (4B) and 102 generations (4D).
A B
C D
Figure 4. Increasing tetracycline concentrations that ΔOxyR E.coli could resist.
Shown is the log(2) increasing tetracycline concentrations over time (4A&4B) and over the number of generations (4C&4D) in which ΔOxyR E.coli could grow. Also, the increasing tetracycline concentrations in which aerobic ΔOxyR E.coli could grow are shown (4B&4D).
Throughout the evolution experiment, the minimal inhibitory concentration (MIC) was measured twice a week for each strain to examine whether the strains were obtaining AR to the corresponding antibiotic. The increasing MIC (μg/mL) of amoxicillin over time (5A) and over the number of generations (5C) are shown. AMO I reached a maximum MIC of 2048μg/mL after 48 days and 78
12
generations and AMO II reached a maximum MIC of 2048μg/mL after 48 days and after 90
generations. The MIC values of aerobic grown ΔOxyR E.coli in amoxicillin over time (5B) and the number of generations (5D) are shown. AMO aerobic reached a MIC of 4096μg/mL after 30 days and 146 generations. All the MIC values of each antibiotic from aerobic grown ΔOxyR E.coli are obtained by Tine Visser.
ENRO I reached a maximum MIC of 2048μg/mL for enrofloxacin after 60 days (5E) and 83
generations (5G). ENRO II reached a maximum MIC of 2048μg/mL after 70 days (5E) and 85 generations (5G). ENRO aerobic reached a maximum MIC of 2048μg/mL after 31 days (5F) and 150 generations (5H). A B C D E F
13
G H
Figure 5. Acquisition of AR to amoxicillin and enrofloxacin
Shown are the obtained MIC values (μg/ml) of amoxicillin and enrofloxacin over time (5A&5E) and the MIC values of amoxicillin and enrofloxacin over the number of generations (5C&5G). MIC values of amoxicillin and enrofloxacin for aerobically grown ΔOxyR E.coli are shown over time (5B&5F) and the number of
generations (5D&5H).
The increasing MIC of kanamycin and tetracycline are shown in figure 6. KAN I reached a maximum MIC of 256μg/mL after 46 days (6A) and 72 generations (6C) for kanamycin. KAN II reached a maximum MIC of 512μg/mL after 48 days (6A) and 61 generations (6C). KAN aerobic reached a maximum MIC of 4096μg/mL after 31 days (6B) and 160 generations (6D).
TET I reached a maximum MIC of 32μg/mL after 44 days (6E) and 74 generations (6G). TET
II reached a maximum MIC of 16μg/mL after 15 days (6E) and 36 generations (6G). TET aerobic reached a maximum MIC of 64μg/mL after 20 days (6F) and 120 generations (6H).
A B
C D
14
E F
G H
Figure 6. Acquisition of AR to kanamycin and tetracycline
Shown are the obtained MIC values (μg/ml) of kanamycin and tetracycline over time (6A&6E) and the MIC values of kanamycin and tetracycline over the number of generations (6C&6G). MIC values of kanamycin and tetracycline for aerobically grown ΔOxyR E.coli are shown over time (6B&6F) and the number of
generations (6D&6H).
Discussion
It can be concluded that E.coli, without OxyR and growing in an anaerobic environment, was able to acquire antibiotic resistance (AR) to amoxicillin, enrofloxacin, kanamycin, and tetracycline.
Furthermore, it took the anaerobically grown cultures longer to resist higher antibiotic concentrations than it took the aerobically grown cultures. Besides, the anaerobic cultures showed increasing MIC values at a slower pace, which could imply that aerobic conditions were favorable for E.coli in obtaining AR. The results show differences between ΔOxyR E.coli growth in anaerobe and aerobe conditions. But eventually, the cultures became resistant in both environments. This could imply that the availability of oxygen in the environment is not decisive whether E.coli actually can obtain AR or not, only the pace in AR acquirement was influenced. However, the difference in mutated genes in both environments was not investigated. This would be a candidate for further research, in which whole-genome sequencing (WGS) could be used to obtain genetic differences between the cultures. Subsequently, the possible influence that the OxyR knockout could have on the acquirement of different mutations than WT E.coli could be investigated in further research.
15
The maximum antibiotic concentration that ΔOxyR E.coli could tolerate was higher when being in aerobe conditions. However, the maximum antibiotic concentration was only 2-fold higher for amoxicillin, enrofloxacin, and tetracycline. This could imply that these antibiotics pursue their mechanism of action in both environments likewise.
Nonetheless, previous studies indicated that the formation of reactive oxygen species (ROS) will cause oxidative stress and that oxygen radicals were one of the lethal factors together with the specific antibiotic target mechanism (Hoeksema et al., 2019), which suggests that ROS formation assists the antibiotic with its bactericidal function (Dywer et al., 2014). Therefore, it could be expected that ΔOxyR E.coli in anaerobe conditions would face less ROS because there is no oxygen available to generate the oxygen radicals. Still, the anaerobe cultures obtained AR at a slower pace, which creates speculations about the damaging properties of nitrogen radicals when oxygen is not present. A higher formation of reactive nitrogen species (RNS) in anaerobe conditions could accompany antibiotics in bactericidal lethality, similar to ROS. The study of Ozcan et al., 2015 found that RNS could cause nitrosative stress inside the bacterial cell, damaging the bacteria in various ways. It could be that obtaining resistance to nitrosative stress and oxidative stress involves different mechanisms, leading to different paces in obtaining AR. The actual amount of nitrogen radicals inside the bacterial cell after exposure to antibiotic radicals could be a measurement of antibiotic action in further research.
Previous studies suggested that the OxyR gene could protect the bacteria cell from nitrosative stress in anaerobic conditions (Seth et al., 2012). A comparison between the number of nitrogen radicals inside the ΔOxyR E.coli cell and WT E.coli cell could be analyzed, which can confirm the role of OxyR in decreasing the amount of RNS inside the bacterial cell. Studying differences between ΔOxyR and WT E.coli in genetic and physiological systems could overall add understanding to processes involving AR.
Kanamycin is an aminoglycoside antibiotic that relies on oxygen for transport across the bacterial cytoplasmatic membrane (Jana et al., 2006), therefore it could be expected that bacteria are better protected against kanamycin in anaerobe conditions. However, in this experiment,
ΔOxyR E.coli growing with kanamycin showed a 4-fold higher maximum concentration in aerobe conditions, which could imply that there are other mechanisms involved in obtaining AR to kanamycin. Whether this is a result of the OxyR deletion or not should be further investigated.
Figures 1 to 6 display differences between AR acquisition of anaerobic and aerobic grown
ΔOxyR E.coli. Here, the graphs over time differ from the graphs over the number of generations, because the number of generations reproduced by ΔOxyR E.coli per incubation is higher in aerobic conditions. This may not be confused with the number of incubations it took to obtain the maximum antibiotic concentration at which the cultures could grow. In this research, aerobic grown
ΔOxyR E.coli reached the maximum antibiotic concentration and the maximum MIC after fewer incubations than anaerobic grown ΔOxyR E.coli. The number of generations was calculated from the
16
obtained OD values, which were almost always higher aerobically than anaerobically. Suggesting that E.coli has an improved growth when oxygen was present, therefore obtaining AR faster over time.
During the evolution experiment, ΔOxyR E.coli without any antibiotic sometimes showed less bacterial growth than with an antibiotic present. This could imply that obtaining AR involves a change to alternative metabolic mechanisms (Martinez et al., 2008), which are induced when the antibiotic is present. When the antibiotic would not be present, the alternative mechanisms that the bacteria have been using cannot operate anymore and the previous mutations caused the regular mechanisms to be unnecessary. This shows the complexity of obtaining AR and all its physiological changes inside the bacteria it would induce.
In this research, AR emerged ‘de novo’ as a result of genetic mutations which causes altered gene expression (Hoeksema et al., 2018). These mutations occur upon exposure to high concentrations of antibiotics which induces the SOS-response inside the bacteria, resulting in DNA instability
(Händel et al., 2016). Nowadays, the acquisition of AR by bacteria ‘de novo’ or through other kinds of genetic exchange is causing major health care problems, because it allows many bacterial infections to become deadly again when antibiotic treatment cannot suffice (O’neill et al., 2014). This also includes many common procedures that rely on antibiotics (Martinez et al., 2008). Understanding the bigger picture of bacterial evolution and all the physiological and genetic changes inside the bacterial cell is necessary to overcome AR. Fortunately, AR can be studied in real-time during an evolution
experiment (Martinez et al., 2008), which allows research that could help in eventually overcoming AR.
E.coli acquired AR to amoxicillin, enrofloxacin, kanamycin, and tetracycline when the OxyR
gene was knocked out. Normally, the OxyR gene would protect the bacterial cell from oxidative damage in aerobe conditions (Pomposiello et al., 2001) and nitrosative damage in anaerobe conditions (Seth et al., 2012). E.coli still obtained AR without the protection that the OxyR gene would provide. Although differences were present between anaerobic and aerobic grown culture, more research must be done to obtain knowledge about genetic and physiological differences to eventually overcome AR obtained by E.coli.
Supplementals PCR
To confirm the knockout of the OxyR gene, a PCR was constructed. Table 2 shows the properties of the primers that were used to PCR ΔOxyR E.coli and MG1655 WT E.coli. No master mix was made because there were only 6 PCR reagents. For each PCR measurement 12.5μL Go Taq Green Master mix was used as the solution, containing bacterially derived DNA polymerases. 1μl Forward primer,
1μL reversed primer, 9μL MQ water, and 1.5μL DNA were added to the solution. Table 3 shows the PCR program that was run.
17 Table 2. Primer properties for PCR
Shown are the primer sequences, the number of nucleotides and at what temperature they were run.
Primer Name Sequence 5'-3' Tm Product Size Designed by
Fw*1 TGATCTTGAGTACCTGGTG 45 19nt Tine Visser
Rv**1 CAGATAAACAACCCCATCGC 45 20nt Tine Visser
Fw2 AGGCTCGGTTAGGGTAAG 45 19nt Tine Visser
Rv2 AGTTTAAACATCTGGCACG 45 19nt Tine Visser
* Forward primer ** Reverse primer
Table 3. PCR program profile
Shown is the PCR program profile that was ran. The temperature, time, and the number of repetitions are shown.
Temperature [°C] Time Repetitions 94 10 min x1 94 40 s x30 45 40 s 72 1 min 72 5 min x1 4 ∞ x1 Gel electrophoresis
1.5 % agarose gel was prepared by adding 4.5g agarose to 100mL TAE buffer. 6μL of the sample and
6μ of the ladder was loaded to the gel. The gel was run for 30 minutes at 110V
Gel electrophoresis was performed to visualize DNA fragments of ΔOxyR E.coli and MG1655 WT E.coli, shown in figure 7. Primer1 sequenced base pairs in the OxyR gene fragment. Primer 2 sequenced base pairs outside the OxyR region as well. ΔOxyR1 did not show a DNA fragment, indicating that the OxyR gene was removed. ΔOxyR2 showed a fragment because the second primer sequenced a segment of the DNA strain that was outside the OxyR region. WT1 and WT2 showed fragments, indicating that the OxyR gene was present.
18 Growth curves for ΔOxyR E.coli and MG1655 WT E.coli at 30°C and 37°C
Growth curves were made by incubating both strains separately at 30°C or 37°C inside a plate reader for 23 hours. A measurement was made each 10 minutes. Figure 8 shows the growth curves of ΔOxyR E.coli and WT MG1655 E.coli at 37°C (8A) together with the growth curves at 30°C (8B).
A B
Figure 8. Growth curves of ΔOxyR E.coli and WT MG1655 E.coli
Shown are the growth curves of ΔOxyR E.coli and WT E.coli grown in either 30°C (8A) or 37°C (8B) for 1380 minutes (23 hours). Each dot is an OD measurement with 10-minute intervals.
Figure 7. PCR results of ΔOxyR E.coli and MG1655 WT E.coli. Shown is a photo obtained after the PCR experiment. Bands with the corresponding base pairs are shown. ΔOxyR E.coli contains the sequence of primer set 2, but does not contain the sequence of primer set 1. MG1655 WT
19 References
Barrick La b. (16 May, 2014). FLP Recombination in E. coli. Retrieved 3 September, 2016, from http://barricklab.org/twiki/bin/view/Lab/ProcedureFLPFRTRecombination
Barrick La b. (2014) Electrocompetent E.Coli, from
https://barricklab.org/twiki/bin/view/Lab/ProtocolsElectrocompetentCells
Brandes, Nicolas, et al. "Nitrosative stress treatment of E. coli targets distinct set of thiol‐containing proteins." Molecular microbiology 66.4 (2007): 901-914.
Bundy, Ruth E., et al. "A redox-based mechanism for nitric oxide-induced inhibition of DNA synthesis in human vascular smooth muscle cells." British journal of pharmacology 129.7 (2000): 1513.
Christman, Michael F., Gisela Storz, and Bruce N. Ames. "OxyR, a positive regulator of hydrogen peroxide-inducible genes in Escherichia coli and Salmonella typhimurium, is homologous to a family of bacterial regulatory proteins." Proceedings of the National Academy of Sciences 86.10 (1989): 3484-3488.
Datsenko, K.A., and Wanner, B.L. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U. S. A. 97: 6640-6645.
Dwyer, Daniel J., et al. "Antibiotics induce redox-related physiological alterations as part of their lethality." Proceedings of the National Academy of Sciences 111.20 (2014): E2100-E2109.
Dwyer, Daniel J., et al. "Gyrase inhibitors induce an oxidative damage cellular death pathway in Escherichia coli." Molecular systems biology 3.1 (2007).
Gonzalez-Flecha, Beatriz, and Bruce Demple. "Transcriptional regulation of the Escherichia coli oxyR gene as a function of cell growth." Journal of bacteriology 179.19 (1997): 6181-6186.
Händel, Nadine, et al. "Interaction between mutations and regulation of gene expression during development of de novo antibiotic resistance." Antimicrobial agents and chemotherapy 58.8 (2014): 4371-4379.
Händel, Nadine, et al. "Effects of stress, reactive oxygen species, and the SOS response on de novo acquisition of antibiotic resistance in Escherichia coli." Antimicrobial agents and chemotherapy 60.3 (2016): 1319-1327.
Hausladen, Alfred, et al. "Nitrosative stress: activation of the transcription factor OxyR." Cell 86.5 (1996): 719-729.
20 Hoeksema, Marloes, et al. "Effects of a previously selected antibiotic resistance on mutations acquired during development of a second resistance in Escherichia coli." BMC genomics 20.1 (2019): 284.
Hoeksema, Marloes, et al. "Genome rearrangements in Escherichia coli during de novo acquisition of resistance to a single antibiotic or two antibiotics successively." BMC genomics 19.1 (2018): 973.F
Hoeksema, Marloes, Stanley Brul, and Benno H. ter Kuile. "Influence of reactive oxygen species on de novo acquisition of resistance to bactericidal antibiotics." Antimicrobial agents and
chemotherapy 62.6 (2018): e02354-17.
Jana, S., and J. K. Deb. "Molecular understanding of aminoglycoside action and resistance." Applied microbiology and biotechnology 70.2 (2006): 140-150.
Kingston, Robert E., et al. "Short Protocols in Molecular Biology. Eds. Fred Ausubel, Roger Brent." Advances in Cell and Molecular Biology of Membranes and Organelles 4 (1995).
Knopp, Michael, et al. "De Novo Emergence of Peptides That Confer Antibiotic Resistance." mBio 10.3 (2019): e00837-19.
Kohanski, Michael A., Daniel J. Dwyer, and James J. Collins. "How antibiotics kill bacteria: from targets to networks." Nature Reviews Microbiology 8.6 (2010): 423-435.
Martínez, José L., Fernando Baquero, and Dan I. Andersson. "Predicting antibiotic resistance." Nature Reviews Microbiology 5.12 (2007): 958-965.
Martinez, Jose Luis, et al. "A global view of antibiotic resistance." FEMS microbiology reviews 33.1 (2008): 44-65.
O’neill, J. I. M. "Antimicrobial resistance: tackling a crisis for the health and wealth of nations." Rev. Antimicrob. Resist 20 (2014): 1-16.
Ozcan, Ayla, and Metin Ogun. "Biochemistry of reactive oxygen and nitrogen species." Basic principles and clinical significance of oxidative stress 3 (2015): 37-58.
Pomposiello, Pablo J., and Bruce Demple. "Redox-operated genetic switches: the SoxR and OxyR transcription factors." Trends in biotechnology 19.3 (2001): 109-114.
Seth, Divya, et al. "Endogenous protein S-Nitrosylation in E. coli: regulation by OxyR." Science 336.6080 (2012): 470-473.
Shah, Poonam, and Andrew D. Westwell. "The role of fluorine in medicinal chemistry." Journal of enzyme inhibition and medicinal chemistry 22.5 (2007): 527-540.
Shewaramani, Sonal, et al. "Anaerobically grown Escherichia coli has an enhanced mutation rate and distinct mutational spectra." PLoS genetics 13.1 (2017): e1006570.
21 Stokes, Jonathan M., et al. "Bacterial metabolism and antibiotic efficacy." Cell metabolism (2019).
Sykes, Jane E. Canine and feline infectious diseases-E-BOOK. Elsevier Health Sciences, 2013.
Tamae, Cindy, et al. "Determination of antibiotic hypersensitivity among 4,000 single-gene-knockout mutants of Escherichia coli." Journal of bacteriology 190.17 (2008): 5981-5988.
Zaman, Sojib Bin, et al. "A review on antibiotic resistance: alarm bells are ringing." Cureus 9.6 (2017).
