Developing Bacillus subtilis as a versatile bioproduct platform for agricultural and pharmaceutical applications
Song, Yafeng
DOI:
10.33612/diss.168189909
IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below.
Document Version
Publisher's PDF, also known as Version of record
Publication date: 2021
Link to publication in University of Groningen/UMCG research database
Citation for published version (APA):
Song, Y. (2021). Developing Bacillus subtilis as a versatile bioproduct platform for agricultural and pharmaceutical applications. University of Groningen. https://doi.org/10.33612/diss.168189909
Copyright
Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).
Take-down policy
If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.
Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum.
Chapter 2
High-efficiency secretion of β-mannanase in Bacillus subtilis
through protein synthesis and secretion optimization
Yafeng Song1, 2,3, Gang Fu1, 2, Huina Dong1,2, Jianjun Li4, 5*, Yuguang Du4, 5 Dawei Zhang1,3,*
1 Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences, Tianjin 300308, P. R. China 2 Department of Chemical and Pharmaceutical Biology, Groningen Research Institute of Pharmacy, University of Groningen, 9713 AV, Groningen, The Netherlands 3 Key Laboratory of Systems Microbial Biotechnology, Chinese Academy of Sciences, Tianjin 300308, P. R. China 4 National Key Laboratory of Biochemical Engineering, National Engineering Research Center for Biotechnology (Beijing), 100190, China 5 Key Laboratory of Biopharmaceutical Production & Formulation Engineering, PLA, Institute of Process Engineering, Chinese Academy of Sciences, 100190, China
24
Abstract
The manno endo-1, 4-mannosidase (β-mannanase, EC. 3.2.1.78) catalyzes the random hydrolysis of internal (1→4)-β-mannosidic linkages in the mannan polymers. A codon optimized β-mannanase gene from Bacillus licheniformis DSM13 was expressed in
Bacillus subtilis. When four Sec-dependent and two Tat-dependent signal peptide
sequences cloned from B. subtilis were placed upstream of the target gene, the highest activity of β-mannanase was observed using SPlipA as a signal peptide. Then, a 1.25-fold
activity of β-mannanase was obtained when another copy of groESL operon was inserted into the genome of host strain. Finally, five different promoters were separately used to enhance the synthesis of the target protein. The results showed that promoter Pmglv, a
modified maltose-inducible promoter, significantly elevated the production of β-mannanase. After 72 h of flask fermentation, the enzyme activity of β-mannanase in the supernatant when using locust bean gum as substrate reached 2207 U/mL. This work provided a promising β-mannanase production strain in industrial application.
Keywords: β-mannanase, Bacillus subtilis, signal peptides, promoters, chaperones, signal
25
0
2
00
Introduction
β-mannanase (endo-1,4-β-D-mannan mannosidase, EC. 3.2.1.78), an extracellular enzyme, is responsible for randomly cleaving the backbone of mannan-based polysaccharides, releasing short β-1,4-mannooligomers as well as new chain ends1. It plays an important role in the hydrolysis of hemicellulose, which is estimated to be the second most abundant polysaccharide in nature because mannans constitute the predominant component of hemicellulose fractions in various plant tissues2. Furthermore, it displayed synergistic interactions with β-mannosidase and α-galactosidase 3, due to the elaborate chemically distinctness and interlocking of polysaccharides within the plant cell walls. Being one of the most significant mannan-degrading enzymes, β-mannanases are widely distributed among plants, marine mollusks, fungi and some species of bacteria, and many have been purified and characterized4-8. The broad substrate specificities and resistance to harsh conditions of some β-mannanases cloned from different species permit their industrial applications, ranging from food, feed, paper and pulp biobleaching, bioactive oligosaccharides production in addition to second generation biofuels9. Owing to the importance and demand for mannooligosaccharides, β-mannanases have been extensively researched. These efforts comprise the enzyme cloning, purification and identification of the X-ray crystal structures to facilitate the elucidation of catalytic mechanisms and engineering of improved enzymes with regard to product specificity and catalytic efficiency.
β-mannanase (ManB) from Bacillus licheniformis DSM13 (ATCC14580) which belongs to glycoside hydrolase family 26 10, performed well in thermo-stability and alkali-stability under a wide range of conditions, especially when substrates were high-molecular-weight mannans consisting of more than six mannose monomers11. The half-life time of activity (τ1/2) of ManB remained as high as approximately 80 hours, when incubating temperature increased up to 50oC. In addition, it also kept stable within pH ranging from 5-12 after incubation for 30 min at 50oC. In many cases, genes encoding β-mannanases originated from different bacteria and fungi species were heterologously expressed in Escherichia
coli and Pichia pastoris, respectively12-14. Similarly, β-mannanase (ManB) has once been expressed in E. coli by applying OmpA signal peptide directing its secretion11. However, only half of the enzymes secreted into the medium and half stayed within the periplasmic
26
space. This elevated costs for downstream purification process and hampered its commercial implementation.
B. subtilis, a Gram-positive bacterium, is widely used in expressing a variety of enzymes,
therapeutic proteins and metabolites15-20 due to the Generally Recognized As Safe (GRAS) status, which gives it a priority in food, beverage, feed additive, pharmaceuticals applications. The most significant advantage of this bacterium is to secrete proteins directly into the culture medium at high concentrations19, 21-23 . Furthermore, genetic engineering strategies and high-efficiency transformation methods22-25 make the genetic manipulation more accessible, which prompt the optimizations of this host strain. Although B. subtilis has been used to express mannanase, neither the regulation of transcription and translation nor the secretion pathway has been optimized18, 26-29. For instance, B. subtilis WB600, a protease-deficient strain, and Brevibacillus brevis have been employed to express mannanase Man23, but with only two vectors being investigated to improve its production30. In another example, lacking systematic optimizations, a shuttle vector carrying an endo-1,4-beta-mannosidase from Bacillus pumilus was expressed in B.
subtilis 1A751, leading to a low level of enzyme production (8.65U/mL)31. Therefore, a combination of above-mentioned approaches was conducted to verify whether it could reduce specific bottlenecks encountered by β-mannanase during the secretion process, to further increase the final production.
In the present study, we attempted to increase the synthesis and secretion of β-mannanase in B. subtilis. The β-mannanase gene from B. licheniformis DSM13 was codon optimized after the removal of the native signal peptide, followed by the expression in pMA5. In the following optimization processes, we firstly selected the most suitable signal peptide among 6 candidates, which could direct the secretion of most β-mannanases into the medium. The second step was the identification of the bottlenecks that hindered the secretion and release of high concentration proteins. This was achieved by expressing our target protein in host strains that overexpressed genes encoding bottleneck candidates, such as secretion components, chaperones or signal peptidase. The final step was intended to increase the flux of the protein amounts by efficient synthesis. In this phase, several constitutive promoters and inducible promoters were evaluated and compared. As a result, the combination of these strategies (Figure 1) considerably increased the final production of β-mannanase. Furthermore, this improvement not only prompted the potential industrial
27
0
2
00
application of β-mannanase, but also implied the feasibility of this strategy being applied to increase the production of many other heterologous proteins in B. subtilis.
Figure 1. Scheme of Combined strategies to improve the secretion of β-mannanase. Approaches include
improvements of protein synthesis and secretion capacity. The former was performed by application of strong promoters and codon optimization of the target gene. The latter was intended to strengthen the transportation of mature proteins, with signal peptides selection performed on plasmids and overexpression of secretion machinery components on the chromosome.
Materials and Methods
Strains, plasmids, and cultivation conditions
Plasmids and bacteria strains used in this study were listed in Table 1 and Table 2. E. coli strains were cultured at 37°C with 220 rpm orbital shaking in lysogeny broth (LB) medium [1% tryptone, 0.5% yeast extract, 0.5% NaCl]. B. subtilis cells harboring appropriate plasmids were cultivated at 37°C in 2×SR medium [3% tryptone, 5% yeast extract and 0.6% K2HPO4, pH 7.2] in 250-mL triangular flasks. Appropriate antibiotics were supplemented to the medium when required: 100 μg/mL ampicillin for E. coli, 40 μg/mL kanamycin and 10 μg/mL chloramphenicol for B. subtilis. Only B. subtilis 1A751 derivative strains with genes encoding Sec-secretion components, signal peptidases, and molecular chaperones integrated into the genome (Table 2) were cultured with media adding 10 μg/mL chloramphenicol as well as 2% (w/v) of xylose. Strains containing inducible promoters were separately cultivated in medium with the presence of inducers
28
under different concentrations: 0, 0.001, 0.01, and 0.1 mM of IPTG, and 0, 0.5, 1.0, 2.0% (w/v) of maltose. Cells of B. subtilis were pre-cultured in LB medium overnight and inoculated to OD600 of 0.01, followed by 4 hours of incubation in 2×SR medium. Different final concentrations of IPTG were then added to the medium with strains containing Pgrac,
respectively. For the strains carrying Pmglv, maltose was added to the medium immediately
after the inoculation. Cell growth was monitored by measurement of the optical density at 600 nm (OD600). Standard deviations are based on a minimum of three statistically independent experiments.
Table 1 Plasmids used in this study
Plasmids Genotype and/or relevant characteristics
pMA5 E. coli/B. subtilis shuttle vector, PhpaII, Apr, Kmr BGSC
pMA5-Man pMA5 derivative, β-mannanase, T4 terminator This work
pMA5-1Man pMA5-Man derivative, SPamyL, This work
pMA5-2Man pMA5-Man derivative, SPlipA, This work
pMA5-3Man pMA5-Man derivative, SPnprB, This work
pMA5-4Man pMA5-Man derivative, SPnprE, This work
pMA5-5Man pMA5-Man derivative, SPphoD, This work
pMA5-6Man pMA5-Man derivative, SPywbN, This work
pMA5-2Man1 pMA5 derivative, PaprE, β-mannanase This work
pMA5-2Man2 pMA5 derivative, P43, β-mannanase This work
pMA5-2Man4 pMA5 derivative, Pgrac, β-mannanase This work
pMA5-2Man5 pMA5 derivative, Pmglv, β-mannanase This work
General manipulation
The native signal peptide of β-mannanase (NCBI accession number AAU39670) from B.
licheniformis DSM13 was removed and the rest sequences were codon optimized for B. subtilis. The sequence of the native signal peptide being removed was:
29
0
2
00
overlap extension (POE)-PCR32 method. β-mannanase and linearized vector fragment were prepared by PCR amplification using PrimerSTAR Max DNA Polymerase mix containing dNTP and DNA polymerase (TaKaRa, Japan), and primers (ms/ma and vs/va, respectively), according to the instructions of the manufacturer. POE-PCR amplification mixture comprises Q5 DNA polymerase, dNTP mix, amplified β-mannanase and linearized vector fragments. The PCR protocol was as follows: denaturation at 98oC for 30 s, followed by 30 cycles of denaturation at 98oC for 5 s and then annealing at 55oC for 10 s and extension at 72°C for 4 min. The POE-PCR products were directly transformed into competent E. coli DH5α, and positive colony samples were selected to be further validated by sequencing the fragments (Genwiz, China).
Other plasmids were constructed following the same method. Primers used to amplify the signal peptide fragments and promoter fragments, as well as other oligonucleotides used in this study were listed in Table S1. The genome of B. subtilis 168 served as the template to amplify signal peptide27 fragments including SPamyL, SPlipA, SPnprB, SPnprE, SPphoD, SPywbN,
and promoter fragments including PaprE, and P43. The fragment lengths of PaprE and P43
were 200 bp and 275 bp, respectively. Pgrac containing the promoter, lacO sequences and
the regulator protein lacI was 1548 bp, and originated from the plasmid pHT43 plasmid.33 Pmglv was a modified maltose inducible promoter,34, 35 which was constructed by
researchers in our lab (unpublished work). Constructed plasmids were transformed into B.
subtilis under the standard competent transformation method. Table 2 Strains used in this study
Strains Genotype and/or relevant characteristics Sources
E. coli DH5α F−ΔlacU169(-80d lacZΔM15) supE44 hsdR17 recA1 gyrA96 endA1
thi-1 relA1
Invitrogen
B. subtilis 1A751 eglSΔ102 bglT/bglSΔEV aprE nprE his BGSC
B. subtilis 1A7511 1A751 derivative, pMA5-1Man, Kmr This work
B. subtilis 1A7512 1A751 derivative, pMA5-2Man, Kmr This work
B. subtilis 1A7513 1A751 derivative, pMA5-3Man, Kmr This work
30
Strains Genotype and/or relevant characteristics Sources
B. subtilis 1A7515 1A751 derivative, pMA5-5Man, Kmr This work
B. subtilis 1A7516 1A751 derivative, pMA5-6Man, Kmr This work
B. subtilis 1A751S1 1A751 derivative, amyE::Pxyl-secY, Cmr, pMA5-2Man, Kmr This work
B. subtilis 1A751S2 1A751 derivative, amyE::Pxyl-secE, Cmr, pMA5-2Man, Kmr This work
B. subtilis 1A751S3 1A751 derivative, amyE::Pxyl-secG, Cmr, pMA5-2Man, Kmr This work
B. subtilis 1A751S4 1A751 derivative, amyE::Pxyl-secYEG, Cmr, pMA5-2Man, Kmr This work
B. subtilis 1A751S5 1A751 derivative, amyE::Pxyl-secDF, Cmr, pMA5-2Man, Kmr This work
B. subtilis 1A751S6 1A751 derivative, amyE::Pxyl-secA, Cmr, pMA5-2Man, Kmr This work
B. subtilis 1A751S7 1A751 derivative, amyE::Pxyl-ffh, Cmr, pMA5-2Man, Kmr This work
B. subtilis 1A751S8 1A751 derivative, amyE::Pxyl-scr, Cmr, pMA5-2Man, Kmr This work
B. subtilis 1A751P1 1A751 derivative, amyE::Pxyl-sipS, Cmr, pMA5-2Man, Kmr This work
B. subtilis 1A751P2 1A751 derivative, amyE::Pxyl-sipT, Cmr, pMA5-2Man, Kmr This work
B. subtilis 1A751P3 1A751 derivative, amyE::Pxyl-sipU, Cmr, pMA5-2Man, Kmr This work
B. subtilis 1A751P4 1A751 derivative, amyE::Pxyl-sipV, Cmr, pMA5-2Man, Kmr This work
B. subtilis 1A751P5 1A751 derivative, amyE::Pxyl-sipW, Cmr, pMA5-2Man, Kmr This work
B. subtilis 1A751P6 1A751 derivative, amyE::Pxyl-dnaK, Cmr, pMA5-2Man, Kmr This work
B. subtilis 1A751P7 1A751 derivative, amyE::Pxyl-groESL, Cmr, pMA5-2Man, Kmr This work
B. subtilis 1A751S9 1A751 derivative, amyE::Pxyl-hbs, Cmr, pMA5-2Man, Kmr This work
B. subtilis 1A751S10 1A751 derivative, amyE::Pxyl-SRP, Cmr, pMA5-2Man, Kmr This work
B. subtilis 1A751S11 1A751 derivative, amyE::Pxyl-ftsY, Cmr, pMA5-2Man, Kmr This work
B. subtilis 1A751P8 1A751 derivative, amyE::Pxyl-prsA, Cmr, pMA5-2Man, Kmr This work
B. subtilis 1A751SPP1 1A751 derivative, amyE::Pxyl-groESL, Cmr, pMA5-2Man1(PaprE) , Kmr This work
B. subtilis 1A751SPP2 1A751 derivative, amyE::Pxyl-groESL, Cmr, pMA5-2Man2 (P43) , Kmr This work
B. subtilis 1A751SPP4 1A751 derivative, amyE::Pxyl-groESL, Cmr, pMA5-2Man4 (Pgrac) , Kmr This work
31
0
2
00
SDS-PAGE analysis
Supernatant samples were harvested and separated by centrifugation (12000g, 10 minutes, 4oC) after fermentation in flasks for different hours to perform sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) (NuPAGE 10 % Bis-Tris Gel, Commassie Brilliant Blue, Invitrogen Life Technologies, USA). Cell precipitate was resuspended with 50 μL lysis buffer (50 mM Tris/HCl, 150 mM NaCl, pH 8.0) per OD600. Prestained Protein Ladder, purchased from Invitrogen Life Technologies, was applied to determine the molecular weights of the proteins with prominent bands.
Enzyme assays
Dinitrosalicylic acid (DNS) method was performed to determine the β-mannanase activity by measuring the amount of reducing sugar released from locust bean gum (LBG). The substrate, 0.5% LBG (Sigma G0753) was dissolved in acetic acid-sodium acetate buffer, pH 5.5. 40 μL of appropriate dilutions of culture supernatants (i.e. the secreted β-mannanase) and 40 μL of the substrate were mixed and incubated at 37oC for 30 minutes. 100 μL of DNS was added to the enzyme reaction mixture and boiled for 10 minutes to stop the reaction. The mixture was then cooled on ice for 5 minutes and diluted with 320 μL of double distilled water before measuring the absorbance at 540 nm. One unit (U) of β-mannanase activity is defined as the amount of enzyme that liberates 1 μmol of reducing sugar (using D-mannose as a standard) per minute under the given experimental conditions.
Results and Discussion Host and vector selection
Compared to E. coli and yeast, two extensively used protein expression hosts, B. subtilis possesses its own advantages in producing proteins such as its strong capacity of secreting high concentration proteins into the culture medium and well-characterized secretion pathways25, 36. In some cases, when E. coli serves as the host, large fraction of proteins might be remained within cytoplasmic or periplasmic space of the cells, making the downstream separation and purification much more complex. When comparable secretion capacity occurs between the two generally recognized as safe species, i. e. yeast and B.
32
application. Therefore, we used B. subtilis 1A751, a protease-deficient strain, as the host to express β-mannanase.
The multicopy plasmid pMA5 was employed as the parent plasmid to express β-mannanase37. The fragment of the target protein was successfully placed downstream of promoter PhpaII, and upstream of T4 terminator, resulting in pMA5-Man. Thereafter, a
series of pMA5-Man vectors with different signal peptide fragments were constructed, to facilitate the target protein secretion.
Increased secretion of β-mannanase by selecting the most efficient signal peptide
Typically, to secrete β-mannanase directly into the culture medium, screening one efficient signal peptide that well functioned in B. subtilis was necessary. There are several well-characterized secretion pathways elucidated in B. subtilis, especially the general secretory (Sec) pathway, and the twin-arginine (Tat) translocation pathway. We selected four signal peptides (SPamyL, SPlipA, SPnprB, and SPnprE) from Sec pathway38-40 and two
(SPphoD and SPywbN) from Tat pathway41, 42, which were reported to highly direct the
secretion of different enzymes.
Figure 2. Comparison of efficiency of different signal peptides. The molecular weight of mature
β-mannanase is about 38 kDa. Column Ct: plasmids without the gene of β-mannanase. A: SDS-PAGE analysis of β-mannanase in the supernatant secreted by B. subtilis. Four Sec-dependent signal peptides (SPamyL, SPlipA, SPnprB, and SPnprE) and two Tat-dependent (SPphoD, SPywbN) signal peptides were used, and
SPlipA was the most efficient. B: SDS-PAGE analysis of β-mannanase of the cell samples. The two
Tat-dependent signal peptides could not be removed successfully, leading to the size of proproteins larger than the mature ones.
33
0
2
00
Six different signal peptide fragments were inserted between PhpaII and β-mannanase gene
of pMA5-Man, respectively. Then they were transformed into the B. subtilis 1A751. After 72 h of fermentation, most of the enzymes could secrete into the medium. We could easily recognize that all of the signal peptides could drive the protein secrete into the medium since the prominent bands corresponding to the size of 38kDa were observed on the SDS-PAGE gel (Figure 2A), which were in accordance with the theoretical molecular weight of the mature protein. Among the four Sec pathway signal peptides, SPlipA (1A7512)
was the most efficient one (enzyme activities listed in Table S2), with almost a twofold activity of SPnprB (1A7514), which turned out to be the least efficient. SDS-PAGE result
of the supernatant samples (Figure 2A) also showed that both the two Tat-dependent signal peptides (SPphoD, SPywbN) could direct the secretion of β-mannanase, but at relatively
low levels. Substantial fractions of protein precursors remained within the cytoplasmic of the cells harboring Tat-dependent signal peptides. This was observed from further analysis of the cell samples by SDS-PAGE (Figure 2B). In addition, those remained proteins had a larger size than the mature proteins, implying that most of the Tat signal peptides could not be successfully removed by the signal peptidases. However, when Sec-dependent signal peptides performed, only small fractions of proteins remained in the cytoplasm (Figure 2B), with signal peptides being removed. Thus, we concluded that β-mannanase tended to be highly secreted under the direction of Sec-pathway signal peptide SPlipA.
Therefore, pMA5-2Man (SPlipA) was used for the following experiments.
Increase the secretion of β-mannanase by systematic gene overexpression
Since both the enzyme activity detection of the cytoplasmic extracts and the SDS-PAGE result of the cell fraction samples (Figure 2B) indicated that some β-mannanases retained in the cytoplasm, we concluded that only the most suitable signal peptide itself could not guarantee their maximum production in B. subtilis, but some other bottlenecks within the secretion pathway needed to be addressed. Insufficiency of each component of the secretion machinery might decrease the final secretion amounts of β-mannanases. It was reported that the secretion level of α-amylase was remarkably improved by systematic overexpression of Sec-pathway related genes to screen the main bottleneck candidates43. Thus it was suspected this process to be a necessary step to distinguish the components that limited β-mannanase secretion, considering the different sequences between α-amylase and β-mannanase. Therefore, we transformed pMA5-2Man (SPlipA) into B.
34
subtilis 1A751 derivative strains containing the overexpression genes encoding elements
of Sec secretion machinery, respectively. Each single copy of these overexpressed genes integrated into the B. subtilis chromosome at amyE locus via double crossing-over43, and under the strict control of promoter Pxyl. Candidate recombinant strains were listed in
Table 2. B. subtilis 1A751S1 (secY), 1A751S2 (secE), 1A751S3 (secG), 1A751S4 (secYEG), 1A751S5 (secDF), 1A751S6 (secA), 1A751S7 (ffh), 1A751S8 (scr), 1A751S9 (hbs), 1A751S10 (SRP), and 1A751S11 (ftsY) were strains which overexpressed genes of the Sec-translocon components and B. subtilis 1A751P1(sipS), 1A751P 2(sipT), 1A751P3 (sipU), 1A751P4 (sipV), 1A751P5 (sipW), 1A751P6 (partial dnaK operon), 1A751P7 (groESL operon) and 1A751P8 (prsA) were strains that overexpressed different signal peptidases and molecular chaperones.
These candidates were selected because of their importance in secretion process. Among the Sec translocase complex17, SecYEG constituted the secretion channel, and SecDF served as the accessory protein. SecA provided energy for crossing membrane by catalyzing the hydrolysis of ATP. The signal recognition particle (SRP) consisted of a GTPase named Ffh, two histone-like proteins (Hbs) and scRNA (scr), and FtsY was the SRP receptor. To some extent, well cooperation or not between these elements and β-mannanase considerably influenced the secretion process, as well as the ATP-dependent molecular chaperones, such as DnaK and GroESL. Among the seven type I signal peptidases, five (sipS, sipT, sipU, sipV, and sipW) were identified to locate on the chromosome. Either the presence of SipS or SipT was sufficient for processing of precursor proteins and cell viability44.
After bacteria being inoculated into the 2×SR fermentation medium and cultured at 37oC for 4 hours in 250-mL triangular flasks, xylose was added to a final concentration of 2% (m/v) to induce the overexpression of the relevant genes in Sec secretion pathway. Fermentation cultures were harvested to obtain supernatant samples to detect the β-mannanase activities and perform the SDS-PAGE after 72 h of incubation. Compared to
B. subtilis 1A751 (pMA5-2Man), no strains that overexpressed genes had increased the
enzyme activities for several times. No dramatic effects on the target protein secretion led to the enzyme yields almost keeping equivalent to levels of the control strain B. subtilis 1A7512 (pMA5-2Man) (Figure 3A and Table S2). These strains were B. subtilis 1A751S1 (secY), 1A751S2 (secE), 1A751S6 (secA), 1A751S8 (scr), 1A751P3 (sipU), 1A751P4
35
0
2
00
(sipV), 1A751P5 (sipW), 1A751P6 (partial dnaK operon), 1A751S7 (ffh), 1A751S10 (SRP), and 1A751P8 (prsA).
When separately overexpressed genes (secY, secE, and secG) encoding the channel of Sec translocase complex45, there were no apparent changes in the β-mannanase secretion levels. However, combinatorial overexpression of the channel genes (secYEG) enhanced the secretion to 116% compared to B. subtilis 1A7512 (pMA5-2Man). This implied that balanced amounts of the translocase components were critical for the increased number of the functional SecYEG channels, thus enhancing the target protein secretion. In addition, overexpression of the translocase accessory protein SecDF (1A751S5), the SRP receptor FtsY (1A751S11), had positive effects on the secretion, but the improvements were not very obvious (Figure 3B). Despite the fact that Ffh could assist the forming of stable SRP complex, no elevated level of production was observed.
Not only the translocase complex plays an important role in its secretion, but also many other factors affect this process. For example, the signal peptidases (SPPases) were responsible for the cleavage of the N-terminal signal peptides, so that mature proteins could secrete into the medium. The SipS (1A751P1) and SipT (1A751P2) overexpression indeed enhanced the secretion of β-mannanase, as could be seen from Figure 3A and 3B. This was consistent with the previous conclusion that SipS or SipT served as the dominant SPPases 46. We supposed that overexpression of these SPPases could intensify the cleavage of the signal peptides, accelerate the transportation, thus reducing the accumulation of these cytoplasmic proteins. Even though increased amounts of secretory β-mannanases were obtained, a small portion of mature proteins still existed within the cells (Figure 4). Therefore, other secretion bottlenecks still have to be discovered.
The overexpression of groESL operon, intracellular chaperones which were in charge of mediating protein folding, decreasing aggregation, and maintaining pre-proteins in translocation-competent conformations, highly increased (125% activity of the control) the secretion amount of β-mannanase (Figure 3). This was similar with the result that GroESL actively contributed to the Sec-dependent export process, which has been demonstrated in E. coli47. Partial dnaK operon also encoded intracellular chaperones, but
their overexpression almost had no positive effects on the secretion. This might attribute to its preference for binding to certain polypeptide sequences48, and the major function of DnaK was in response to stress affecting the Sec translocon. An extracytoplasmic
36
chaperone, PrsA, which could increase the α-amylase secretion by several times43, 49, failed to assist β-mannanase with the secretion. This could be probably due to the tremendously different primary sequences and folding states between the two target proteins. Until now, even though we know the fact that these chaperones participate in protein translocation, more knowledge is needed to explain their abilities to interact with substrates and assist the folding of certain target proteins. Based on that, it would be much easier to further facilitate the target protein secretion.
Figure 3. Effects of overexpression genes on β-mannanase secretion. A: Relative activities of
β-mannanase that secreted by different B. subtilis strains (1A751S1, 1A751S2, 1A751S3, 1A751S4, 1A751S5, 1A751S6, 1A751S7, 1A751S8, 1A751S9, 1A751S10, 1A751S11, 1A751P1, 1A751P2, 1A751P3, 1A751P4, 1A751P5, 1A751P6, 1A751P7, 1A751P8 overexpressed secY, secE, secG, secYEG, secDF, secA,
37
0
2
00
ffh, scr, hbs, SRP, ftsY, sipS, sipT, sipU, sipV, sipW, partial dnaK operon, groESL operon, prsA,
respectively.) Column control was set as 100% activity, and the strains were B. subtilis 1A7512, carrying SPlipA. Error bars represent standard deviations of biological triplicates. B: SDS-PAGE analysis of
β-mannanase in the supernatant secreted by B. subtilis strains that overexpressed different genes.
Increase the secretion of β-mannanase by using strong promoter
Overexpression of genes including translocon components (secYEG, secDF, ftsY), SPPases (sipS, sipT), and chaperones (groESL operon), could increase the secretory production of β-mannanases to different levels, with the highest (groESL operon) being 125% of the control strain (Figure 3A). However, a small fraction of mature enzymes still remained within the cells after strengthening the secretion pathway (Figure 4). It seemed that these remained cytoplasmic proteins could not be avoided. Therefore, we shifted to enhance the synthesis of enzymes by optimizing the level of transcription and translation so that more proteins could be secreted. Using strong promoters was one of the most efficient methods to increase the production, when no obvious secretion bottlenecks hindering the transportation.
Figure 4. SDS-PAGE analysis of β-mannanase cell samples of B. subtilis strains that overexpressed
different genes. Strains B. subtilis 1A751S1, 1A751S2, 1A751S3, 1A751S4, 1A751S5, 1A751S6, 1A751S7, 1A751S8, 1A751S9, 1A751S10, 1A751S11, 1A751P1, 1A751P2, 1A751P3, 1A751P4, 1A751P5, 1A751P6, 1A751P7, 1A751P8, overexpressed gene of secY, secE, secG, secYEG, secDF, secA, ffh, scr, hbs, SRP, ftsY,
sipS, sipT, sipU, sipV, sipW, partial dnaK operon, groESL operon, prsA, respectively.
We selected three constitutive promoters and two inducible promoters to determine the most suitable one. Promoter PhpaII was the original promoter in pMA5, detected to be a
relatively strong promoter.50 Promoter PaprE was reported to highly drive the expression of
the downstream gene of α-Amylase when bacteria were under stationary phase20. Promoter P43 was a well-characterized constitutive strong promoter, and widely used in
38
many protein expressions in B. subtilis.30, 51, 52 The inducible promoters included IPTG
inducible promoter Pgrac (Figure 5A), and a modified maltose inducible promoter Pmglv
(Figure 5B). With the concentration of the inducers increasing, the production of secreted β-mannanase increased. According to the results of the SDS-PAGE, when the concentration of IPTG and maltose were 0.1 mM and 2% (m/v), the promoters performed better (Figure 5A and 5B) than either higher or lower concentration.
Figure 5. Optimization of the concentration of inducers to improve the β-mannanase production. A:
SDS-PAGE analysis of β-mannanase in the supernatant secreted by B. subtilis 1A751SPP4 (Pgrac), with the
concentration of IPTG increased from 0 to 0.1mM. B: SDS-PAGE analysis of β-mannanase in the supernatant secreted by B. subtilis 1A751SPP5 (Pmglv), with the concentration of maltose increased from 0 to
2% (m/v).
To determine the most efficient promoter, these strains containing different promoters (1A751P7, 1A751SPP1, 1A751SPP2, 1A751SPP4, 1A751SPP5) were cultured in the 2×SR medium at 37oC for 72 h, with the optimized concentrations of inducers. The enzyme activity produced by 1A751SPP5 (Pmglv) was the highest 2207 U/mL (Figure 6A
and Table 3 and Table S2), with almost a 3.1-fold activity of the control strain 1A751P7 (groESL operon, PhpaII). This was probably because maltose served as both the inducer and
carbon sources, which promoted bacteria growth, as could be inferred from the higher OD600 (Figure 6B) of this strain than the control one (1A751P7). Compared to other strains, the period of stationary phase of 1A751SPP5 (Pmglv) was much longer, which kept
the cells continuously producing, accumulating and subsequently secreting β-mannanase into the medium. The function of maltose was evaluated by incubating the control strain
39
0
2
00
1A751P7 in the medium with 2% of maltose (1A751P7-a) and 0.1 mM IPTG (1A751P7-b). The enzyme activity of β-mannanase secreted by 1A751P7-a increased to 124% of the control strain (Table 3), whereas adding IPTG did not increase the secretion of β-mannanase. 1A751SPP2 (P43) secreted the second highest amount of β-mannanase (Table S2), which was about 1.8-fold activity of the control one. The constitutive promoter P43 was much stronger than PhpaII and PaprE, even though PaprE could keep at
high strength during the stationary phase. 1A751SPP4 (Pgrac) could only reach 90%
enzyme activity of the control strain, which was still lower than the strains with promoter P43.
Figure 6. Comparison of β-mannanase amounts produced by strains with different promoters. A:
SDS-PAGE analysis of β-mannanase in the supernatant secreted by strains with constitutive promoters (PhpaII, PaprE, P43) and inducible promoters (Pgrac, Pmglv). B: Growth curve of B. subtilis strains with promoter
PhpaII (Control) and Pmglv.
Table 3. Relative activity of β-mannanase secreted by different recombinant strains
Strains Promoters Relative activity of
β-mannanase (%) 1A751P7 PhpaII 100 1A751P7-a PhpaII 124 1A751P7-b PhpaII 102 1A751SPP1 PaprE 32 1A751SPP2 P43 179 1A751SPP4 Pgrac 87
40
1A751SPP5 Pmglv 310
B. subtilis 1A751P7-a and B. subtilis 1A751P7-b represent that the same strain B. subtilis 1A751P7 cultured
in medium adding 2% (m/v) of maltose and 0.1mM IPTG, respectively.
All of the strains carrying constitutive promoters could drive the transcription and translation of the β-mannanase, but to extremely different levels. Promoter Pmglv could
prodigiously improve the secretion yields of β-mannanase. In this research, selection of the suitable signal peptide, overexpression of secretion components or chaperones to reduce the secretion bottlenecks, selection of the strong promoters to enhance the transcription and translation, were combined to optimize and improve the final production of β-mannanase to 2207 U/mL. Considering the potential application of this enzyme in the feed industry, enzyme assay was conducted at 37oC, which was not the optimal temperature. If the temperature was set between 50oC and 60oC, we supposed that higher enzyme activity would be obtained. Nevertheless, the enzyme activity produced by flask fermentation was already much higher than other reported B. subtilis strains30, 31. It is quite promising that a much higher production of β-mannanase would be obtained once this strain cultivated in fed-batch and further optimization of fermentation process was conducted. In conclusion, not only the valuable promoter Pmglv could be used for the
production of β-mannanase, but also these strategies could be adapted to improve other protein expression systems in B. subtilis.
Abbreviations Used
SP: Signal peptide; IPTG: Isopropyl β-D-1-thiogalactopyranoside; DNS: Dinitrosalicylic acid;
Acknowledgements
This work was supported by the National Nature Science Foundation of China (31370089，21506244), State Key Development 973 Program for Basic Research of China (2013CB733600), National High Technology Research and Development Program of China (863 Program) (No. 2014AA093511), Nature Science Foundation of Tianjin City (CN) (16JCYBJC23500, 15JCQNJC09500) and the Key Projects in the Tianjin Science & Technology Pillar Program 11ZCZDSY08600.
41
0
2
00
Notes
This work has been included in a patent application by Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences.
References
(1) Dhawan, S.; Kaur, J., Microbial mannanases: an overview of production and applications. Crit Rev Biotechnol 2007, 27, 197-216.
(2) Saha, B. C., Hemicellulose bioconversion. J Ind Microbiol Biotechnol 2003, 30, 279-91.
(3) Malgas, S.; van Dyk, J. S.; Pletschke, B. I., A review of the enzymatic hydrolysis of mannans and synergistic interactions between beta-mannanase, beta-mannosidase and alpha-galactosidase. World J Microbiol Biotechnol 2015, 31, 1167-75.
(4) Talbot, G.; Sygusch, J., Purification and characterization of thermostable
beta-mannanase and alpha-galactosidase from Bacillus stearothermophilus. Appl
Environ Microbiol 1990, 56, 3505-10.
(5) Shi, P.; Yuan, T.; Zhao, J.; Huang, H.; Luo, H.; Meng, K.; Wang, Y.; Yao, B., Genetic and biochemical characterization of a protease-resistant mesophilic beta-mannanase from Streptomyces sp. S27. J Ind Microbiol Biotechnol 2011, 38, 451-8.
(6) Puchart, V.; Vrsanska, M.; Svoboda, P.; Pohl, J.; Ogel, Z. B.; Biely, P., Purification and characterization of two forms of endo-beta-1,4-mannanase from a thermotolerant fungus, Aspergillus fumigatus IMI 385708 (formerly Thermomyces lanuginosus IMI 158749). Biochim Biophys Acta 2004, 1674, 239-50.
(7) Bourgault, R.; Bewley, J. D., Variation in its C-terminal amino acids determines whether endo-beta-mannanase is active or inactive in ripening tomato fruits of different cultivars. Plant Physiol 2002, 130, 1254-62.
(8) Larsson, A. M.; Anderson, L.; Xu, B.; Munoz, I. G.; Uson, I.; Janson, J. C.; Stalbrand, H.; Stahlberg, J., Three-dimensional crystal structure and enzymic characterization of beta-mannanase Man5A from blue mussel Mytilus edulis. J Mol Biol 2006, 357, 1500-10.
(9) Sanchez, C., Lignocellulosic residues: biodegradation and bioconversion by fungi.
Biotechnol Adv 2009, 27, 185-94.
(10) Henrissat, B.; Davies, G., Structural and sequence-based classification of glycoside hydrolases. Curr Opin Struct Biol 1997, 7, 637-44.
42
(11) Songsiriritthigul, C.; Buranabanyat, B.; Haltrich, D.; Yamabhai, M., Efficient recombinant expression and secretion of a thermostable GH26 mannan
endo-1,4-beta-mannosidase from Bacillus licheniformis in Escherichia coli. Microb
Cell Fact 2010, 9, 20.
(12) Yamabhai, M.; Emrat, S.; Sukasem, S.; Pesatcha, P.; Jaruseranee, N.; Buranabanyat, B., Secretion of recombinant Bacillus hydrolytic enzymes using Escherichia coli expression systems. J Biotechnol 2008, 133, 50-7.
(13) Cai, H.; Shi, P.; Luo, H.; Bai, Y.; Huang, H.; Yang, P.; Yao, B., Acidic
beta-mannanase from Penicillium pinophilum C1: Cloning, characterization and assessment of its potential for animal feed application. J Biosci Bioeng 2011, 112, 551-7.
(14) Chauhan, P. S.; Puri, N.; Sharma, P.; Gupta, N., Mannanases: microbial sources, production, properties and potential biotechnological applications. Appl Microbiol
Biotechnol 2012, 93, 1817-30.
(15) Ferreira, L. C.; Ferreira, R. C.; Schumann, W., Bacillus subtilis as a tool for vaccine development: from antigen factories to delivery vectors. An Acad Bras Cienc 2005,
77, 113-24.
(16) Zweers, J. C.; Barak, I.; Becher, D.; Driessen, A. J.; Hecker, M.; Kontinen, V. P.; Saller, M. J.; Vavrova, L.; van Dijl, J. M., Towards the development of Bacillus
subtilis as a cell factory for membrane proteins and protein complexes. Microb Cell Fact 2008, 7, 10.
(17) van Dijl, J. M.; Hecker, M., Bacillus subtilis: from soil bacterium to super-secreting cell factory. Microb Cell Fact 2013, 12, 3.
(18) Degering, C.; Eggert, T.; Puls, M.; Bongaerts, J.; Evers, S.; Maurer, K. H.; Jaeger, K. E., Optimization of protease secretion in Bacillus subtilis and Bacillus licheniformis by screening of homologous and heterologous signal peptides. Appl Environ
Microbiol 2010, 76, 6370-6.
(19) Chen, J.; Zhu, Y.; Fu, G.; Song, Y.; Jin, Z.; Sun, Y.; Zhang, D., High-level intra- and extra-cellular production of D-psicose 3-epimerase via a modified xylose-inducible expression system in Bacillus subtilis. J Ind Microbiol Biotechnol 2016, 43,
43
0
2
00
(20) Chen, J.; Gai, Y.; Fu, G.; Zhou, W.; Zhang, D.; Wen, J., Enhanced extracellular production of alpha-amylase in Bacillus subtilis by optimization of regulatory
elements and over-expression of PrsA lipoprotein. Biotechnol Lett 2015, 37, 899-906. (21) Chen, J.; Zhao, L.; Fu, G.; Zhou, W.; Sun, Y.; Zheng, P.; Sun, J.; Zhang, D., A novel
strategy for protein production using non-classical secretion pathway in Bacillus
subtilis. Microb Cell Fact 2016, 15, 69.
(22) Xue, G. P.; Johnson, J. S.; Dalrymple, B. P., High osmolarity improves the
electro-transformation efficiency of the gram-positive bacteria Bacillus subtilis and
Bacillus licheniformis. Journal Of Microbiological Methods 1999, 34, 183-191.
(23) Ano, T.; Kobayashi, A.; Shoda, M., Transformation Of Bacillus subtilis with the Treatment by Alkali Cations. Biotechnology Letters 1990, 12, 99-104.
(24) Lu, Y. P.; Zhang, C.; Lv, F. X.; Bie, X. M.; Lu, Z. X., Study on the
electro-transformation conditions of improving transformation efficiency for Bacillus
subtilis. Letters In Applied Microbiology 2012, 55, 9-14.
(25) Dong, H.; Zhang, D., Current development in genetic engineering strategies of
Bacillus species. Microb Cell Fact 2014, 13:63., 10.1186/1475-2859-13-63.
(26) Heravi, K. M.; Wenzel, M.; Altenbuchner, J., Regulation of mtl operon promoter of
Bacillus subtilis: Requirements of its use in expression vectors. Microbial Cell Factories 2011, 10.
(27) Brockmeier, U.; Caspers, M.; Freudl, R.; Jockwer, A.; Noll, T.; Eggert, T., Systematic screening of all signal peptides from Bacillus subtilis: A powerful strategy in optimizing heterologous protein secretion in gram-positive bacteria.
Journal Of Molecular Biology 2006, 362, 393-402.
(28) Wu, S. M.; Feng, C.; Zhong, J.; Huan, L. D., Enhanced production of recombinant nattokinase in Bacillus subtilis by promoter optimization. World Journal Of
Microbiology & Biotechnology 2011, 27, 99-106.
(29) Song, Y.; Nikoloff, J. M.; Fu, G.; Chen, J.; Li, Q.; Xie, N.; Zheng, P.; Sun, J.; Zhang, D., Promoter Screening from Bacillus subtilis in Various Conditions Hunting for Synthetic Biology and Industrial Applications. PLoS One 2016, 11, e0158447. (30) Zhou, H.; Yang, Y.; Nie, X.; Yang, W.; Wu, Y., Comparison of expression systems
for the extracellular production of mannanase Man23 originated from Bacillus
44
(31) Guo, S.; Tang, J. J.; Wei, D. Z.; Wei, W., Construction of a shuttle vector for protein secretory expression in Bacillus subtilis and the application of the mannanase
functional heterologous expression. J Microbiol Biotechnol 2014, 24, 431-9. (32) You, C.; Zhang, X. Z.; Zhang, Y. H., Simple cloning via direct transformation of
PCR product (DNA Multimer) to Escherichia coli and Bacillus subtilis. Appl Environ
Microbiol 2012, 78, 1593-5.
(33) Phan, T. T.; Nguyen, H. D.; Schumann, W., Novel plasmid-based expression vectors for intra- and extracellular production of recombinant proteins in Bacillus subtilis.
Protein Expr Purif 2006, 46, 189-95.
(34) Ming-Ming, Y.; Wei-Wei, Z.; Xi-Feng, Z.; Pei-Lin, C., Construction and
characterization of a novel maltose inducible expression vector in Bacillus subtilis.
Biotechnol Lett 2006, 28, 1713-8.
(35) Ming, Y. M.; Wei, Z. W.; Lin, C. Y.; Sheng, G. Y., Development of a Bacillus
subtilis expression system using the improved Pglv promoter. Microb Cell Fact 2010, 9, 55.
(36) Song, Y.; Jonas, M. N.; Zhang, D., Improving Protein Production on the Level of Regulation both of Expression and Secretion Pathways in Bacillus subtilis. J
Microbiol Biotechnol 2015, 3, 3.
(37) Xia, Y.; Xie, S.; Ma, X.; Wu, H.; Wang, X.; Gao, X., The purL gene of Bacillus
subtilis is associated with nematicidal activity. FEMS Microbiol Lett 2011, 322,
99-107.
(38) Brockmeier, U.; Wendorff, M.; Eggert, T., Versatile expression and secretion vectors for Bacillus subtilis. Curr Microbiol 2006, 52, 143-8.
(39) Zhang, X. Z.; Cui, Z. L.; Hong, Q.; Li, S. P., High-level expression and secretion of methyl parathion hydrolase in Bacillus subtilis WB800. Appl Environ Microbiol 2005,
71, 4101-3.
(40) Olmos-Soto, J.; Contreras-Flores, R., Genetic system constructed to overproduce and secrete proinsulin in Bacillus subtilis. Appl Microbiol Biotechnol 2003, 62, 369-73. (41) Gerlach, R.; Pop, O.; Muller, J. P., Tat dependent export of E. coli phytase AppA by
using the PhoD-specific transport system of Bacillus subtilis. J Basic Microbiol 2004,
45
0
2
00
(42) Liu, R.; Zuo, Z.; Xu, Y.; Song, C.; Jiang, H.; Qiao, C.; Xu, P.; Zhou, Q.; Yang, C., Twin-arginine signal peptide of Bacillus subtilis YwbN can direct Tat-dependent secretion of methyl parathion hydrolase. J Agric Food Chem 2014, 62, 2913-8. (43) Chen, J.; Fu, G.; Gai, Y.; Zheng, P.; Zhang, D.; Wen, J., Combinatorial Sec pathway
analysis for improved heterologous protein secretion in Bacillus subtilis:
identification of bottlenecks by systematic gene overexpression. Microb Cell Fact
2015, 14, 92.
(44) Westers, L.; Westers, H.; Quax, W. J., Bacillus subtilis as cell factory for
pharmaceutical proteins: a biotechnological approach to optimize the host organism.
Biochim Biophys Acta 2004, 1694, 299-310.
(45) Kudva, R.; Denks, K.; Kuhn, P.; Vogt, A.; Muller, M.; Koch, H. G., Protein
translocation across the inner membrane of Gram-negative bacteria: the Sec and Tat dependent protein transport pathways. Res Microbiol 2013, 164, 505-34.
(46) Tjalsma, H.; Bolhuis, A.; van Roosmalen, M. L.; Wiegert, T.; Schumann, W.; Broekhuizen, C. P.; Quax, W. J.; Venema, G.; Bron, S.; van Dijl, J. M., Functional analysis of the secretory precursor processing machinery of Bacillus subtilis:
identification of a eubacterial homolog of archaeal and eukaryotic signal peptidases.
Genes Dev 1998, 12, 2318-31.
(47) Castanie-Cornet, M. P.; Bruel, N.; Genevaux, P., Chaperone networking facilitates protein targeting to the bacterial cytoplasmic membrane. Biochim Biophys Acta 2014,
1843, 1442-56.
(48) Rudiger, S.; Germeroth, L.; Schneider-Mergener, J.; Bukau, B., Substrate specificity of the DnaK chaperone determined by screening cellulose-bound peptide libraries.
EMBO J 1997, 16, 1501-7.
(49) Wu, S. C.; Ye, R.; Wu, X. C.; Ng, S. C.; Wong, S. L., Enhanced secretory production of a single-chain antibody fragment from Bacillus subtilis by coproduction of
molecular chaperones. J Bacteriol 1998, 180, 2830-5.
(50) Zhang, M.; Shi, M.; Zhou, Z.; Yang, S.; Yuan, Z.; Ye, Q., Production of Alcaligenes faecalis penicillin G acylase in Bacillus subtilis WB600 (pMA5) fed with partially hydrolyzed starch. Enzyme and Microbial Technology 2006, 39, 555-560.
(51) Wang, P. Z.; Doi, R. H., Overlapping promoters transcribed by Bacillus subtilis sigma 55 and sigma 37 RNA polymerase holoenzymes during growth and stationary phases. J Biol Chem 1984, 259, 8619-25.
46
(52) Zhang, H.; Fu, G.; Zhang, D., Cloning, characterization, and production of a novel lysozyme by different expression hosts. J Microbiol Biotechnol 2014, 24, 1405-12.
47
0
2
00
Supporting Information
Table S1. Oligonucleotides used in this study
Name Sequences ms ctaaaaaggagcgatttacatatgcacactgtcagccctgtaaaccc ma ctaaaaaggagcgatttacatatgcacactgtcagccctgtaaaccc vs atgtaaatcgctcctttttaggtggcac va agttatgcagtttgtagaatgcaaaaagtg amyls gccacctaaaaaggagcgatttacatatgaaacaacaaaaacggctttacgcc amyla gggtttacagggctgacagtgtgcgccgctgctgcagaatgaggcag lipas gccacctaaaaaggagcgatttacatatgaaatttgtaaaaagaaggatcattg lipaa gggtttacagggctgacagtgtgagcggcttttgctgacggctgcaac nprbs gtgccacctaaaaaggagcgatttacatatgcgcaacttgaccaagacatc nprba gggtttacagggctgacagtgtgagctgaggcatgtgttacaaaaacc npres ccacctaaaaaggagcgatttacatatgggtttaggtaagaaattgtctg nprea gggtttacagggctgacagtgtgagcctgaacacctggcaggctgat phods gtgccacctaaaaaggagcgatttacatatggcatacgacagtcgttttgatg phoda gaacggggtgttttcagaggtagaagcatttacttcaaaggccccaac ywbns gtgccacctaaaaaggagcgatttacatatgagcgatgaacagaaaaagccag ywbna gggtttacagggctgacagtgtgtggcttagccgcagtctgaacaag spvs atgtaaatcgctcctttttaggtggcac spva cacactgtcagccctgtaaaccctaac apres ctcgcagagcacacactttatgtctattttcgttcttttctgtatgaaaatagttatttc aprea ccttctttttacaaatttcatatgtctttaccctctccttttaaaaaaattcagag p43s cctcgcagagcacacactttatgacttttaaatacagccattgaacatacgg p43a gatccttctttttacaaatttcatatggtgtacattcctctcttacctataatggtacc gracs gcctcgcagagcacacactttatggagctcaggccttaactcacattaattg
48
graca ccttctttttacaaatttcatatg ggtaccttcctcctttaattgg
mglvs gacagcctcgcagagcacacactttatgcttttgtcccctg
mglva gatccttctttttacaaatttcatatgtattccccctagctaattttcg
promvs cataaagtgtgtgctctgcgagg
promva catatgaaatttgtaaaaagaaggatcattgcacttgt
Table S2. Enzyme activities of β-mannanases secreted by different Bacillus subtilis strains
Enzyme activities of β-mannanases secreted by strains containing different signal peptides
Strains Signal peptides Enzyme activities (U/ml)
B. subtilis 1A7511 SPamyL 487±27
B. subtilis 1A7512 SPlipA 533±32
B. subtilis 1A7513 SPnprB 281±19
B. subtilis 1A7514 SPnprE 363±25
B. subtilis 1A7515 SPphoD 86±13
B. subtilis 1A7516 SPywbN 133±16
Enzyme activities of β-mannanase secreted by strains overexpressed different genes
Strains Overexpressed genes Enzyme activities (U/ml)
B. subtilis 1A7512 -- 561±28
B. subtilis 1A751S1, secY 533±32
B. subtilis 1A751S2, secE 550±29
B. subtilis 1A751S3, secG 499±33
B. subtilis 1A751S4, secYEG 651±37
B. subtilis 1A751S5, secDF 577±34
B. subtilis 1A751S6, secA 572±26
B. subtilis 1A751S7 ffh 544±30
B. subtilis 1A751S8 scr 527±25
B. subtilis 1A751S9 hbs 466±31
B. subtilis 1A751S10 SRP 498±29
B. subtilis 1A751S11 ftsY 589±36
49
0
2
00
B. subtilis 1A751P2 sipT 577±31
B. subtilis 1A751P3 sipU 522±38
B. subtilis 1A751P4 sipV 500±32
B. subtilis 1A751P5 sipW 504±24
B. subtilis 1A751P6 partial dnaK operon 521±29
B. subtilis 1A751P7 groESL operon 701±37
B. subtilis 1A751P8 prsA 561±31 Enzyme activities of β-mannanase secreted by strains containing different promoters
Strains promoters Enzyme activities (U/ml)
B. subtilis 1A751P7 PhpaII 711±28
B. subtilis 1A751P7-a PhpaII 883±34
B. subtilis 1A751P7-b PhpaII 726±43
B. subtilis 1A751SPP1 PaprE 228±23
B. subtilis 1A751SPP2 P43 1274±52
B. subtilis 1A751SPP4 Pgrac 619±25
B. subtilis 1A751SPP5 Pmglv 2207±73
B. subtilis 1A751P7-a and B. subtilis 1A751P7-b represent that the same strain B. subtilis 1A751P7 cultured
