Notting, I.C.
Citation
Notting, I. C. (2009, January 27). Insights in tumorigenesis and metastasis of uveal melanoma. Retrieved from https://hdl.handle.net/1887/13532
Version: Corrected Publisher’s Version
License: Licence agreement concerning inclusion of doctoral thesis in the Institutional Repository of the University of Leiden Downloaded from: https://hdl.handle.net/1887/13532
Note: To cite this publication please use the final published version (if applicable).
Vascular Endothelial Growth Factor-A
in Eyes with
Uveal Melanoma
Guy Missotten
1, Irene Notting
1, Reinier Schlingemann
2, Henk Zijlmans
3, C Lau
4, Paul Eilers
5, Jan Keunen
1, Martine Jager
11
Department of Ophthalmology, Leiden University Medical Center (The Netherlands),
2Department of Ophthalmology, Amsterdam Medical Center (The Netherlands),
3Department of Pathology, Leiden University Medical Center (The Netherlands),
4Schepens Eye Institute, Harvard Medical School, Boston, Massachusetts (USA),
5Department of Medical Statistics, Leiden University Medical Center (The Netherlands)
Published in: Archives of Ophthalmology, October 2006, Volume 124;
1428-1434
Chapter 6 98
Purpose: To determine the presence of vascular endothelial growth factor (VEGF)-A in the aqueous humor of eyes with uveal melanoma, and to identify its source.
Methods: The VEGF-A concentrations were determined in aqueous humor samples obtained after enucleation from 74 eyes with untreated uveal melanoma and from 8 eyes with treated uveal melanoma. Patient survival and clinical and histopathological tumor variables were compared. In situ hybridization, Western blot analysis and enzyme-linked immunosorbent assay (ELISA) were used to determine expression of VEGF-A in tumor tissue and in overlying retina.
Results: Aqueous VEGF-A concentrations ranged from 18 to 826 pg/ml in 74 untreated eyes, while concentrations in 30 control eyes were significantly lower (median 50.1 pg/ml) (p<0.001). Concentrations in 8 eyes treated eyes were much higher (median 364 pg/ml). In situ hybridization on tissue sections and Western blot and ELISA on tissue extracts revealed VEGF-A in uveal melanoma tissue and in retinal tissue.
Conclusion: Uveal melanoma is associated with increased concentrations of VEGF-A in aqueous humor. Aqueous VEGF-A concentration correlates with largest basal tumor diameter and tumor height. In eyes with uveal melanoma, tumor and retinal tissue are sources of VEGF-A.
Abstract
Introduction
Uveal melanoma is the most common primary intraocular neoplasm in adults, with an incidence in the Caucasian population of 0.8 per 100,0001. Once metastases have formed the prognosis for patients with uveal melanoma, is poor. Only 15% of patients survive the first year after diagnosis of distant metastases2-3, with a median survival of 6 months. Therefore, the development of new treatment strategies for metastatic uveal melanoma is urgently needed.
Uveal melanoma disseminates hematogeneously, as there is no major lymphatic drainage from the eye. Because growth of solid tumors and development of metastases are dependent on the formation of new blood vessels, antiangiogenesis treatment may help to prevent spread and subsequent growth of metastases. One of the major groups of cytokines influencing adult angiogenesis is the vascular endothelial growth factor (VEGF) family4. VEGF-A is secreted by various types of tumor cells, and can cause increased vascular permeability endothelial cell growth, angiogenesis, monocyte activation and chemotaxis5. Eyes with uveal melanoma may reveal aqueous flare, which is considered a sign of increased vascular permeability.6 Expression of the VEGF-A gene and protein occurs in healthy ocular tissues, especially the retina, and has been shown to be up-regulated during the neovascularization responses associated with proliferative retinopathies.7C Concentration of VEGF-A have been found to be increased in the aqueous fluid of eyes that have formed intraocular neovascularization because of ischemic retinal diseases such as diabetic retinopathy8-11, retinal vein occlusion12, neovascular glaucoma13, radiation retinopathy14, as well as in eyes with hemangiomas15. In a previous study, it was demonstrated that cell lines from uveal melanoma secreted several angiogenic factors, including VEGF-A16. In addition, Boyd et al. 14 showed increased VEGF concentrations in aqueous fluid and vitreous of eyes with uveal melanoma.
To further understand the role of the VEGF family and angiogenesis in uveal melanoma, we determined VEGF-A in the aqueous humor of eyes with uveal melanoma. To identify its production source, the presence of VEGF-A was examined using 3 different techniques in uveal melanoma tissue and in the overlying retina.
Methods Patients, clinical findings and aqueous humor samples
Aqueous humor samples from 82 consecutive eyes enucleated for uveal melanoma were tested for VEGF-A. The total group was divided into a group of 74 untreated eyes and a group of 8 eyes that had received local treatment before enucleation (1 eye had been treated with transpupillary thermotherapy (TTT), 5 eyes with ruthenium radiation [1 of which also underwent TTT twice], and 2 eyes with proton beam irradiation). Data regarding radiation retinopathy were collected from patients medical records. Patients with diabetes mellitus were excluded from the study, as diabetes influences VEGF-A concentrations in aqueous
Chapter 6 100
humor 8-12,17.
In the untreated group, the mean patient age at the time of enucleation was 63.8 years (age range 28-87 years). Thirty-seven patients were male and 37 were female. Aqueous humor samples were collected within 10 minutes after enucleation and were frozen at -80 °C. To investigate whether enucleation in itself affected VEGF-A aqueous humor concentrations, aqueous humor samples of 3 melanoma patients were collected before and after enucleation.
The mean follow-up time was 64.2 months (range 1 – 136 months). The 74 tumors were classified histopathologically according to cell type, tumor localization, integrity of Bruch’s membrane and pigmentation grade (Table 1). The largest basal tumor diameter and the tumor height were measured in millimeters and the number of mitoses was counted in 15 high- power fields with a magnification of x320. The mean tumor height was 5.6 mm ± SD 2.8 and mean largest basal tumor diameter was 11.1 mm ± SD 3.2.
As control specimens we used 30 samples of aqueous humor obtained from patients at the time of cataract surgery. Patients with diabetes mellitus or with other retinopathies were excluded from the control group. In 22 other patients with retinal detachment aqueous humor samples were obtained at the time of surgery. Thestudy was Institutional Review Board approved and adheredto the tenets of the Declaration of Helsinki.
In situ hybridization
In situ hybridization was performed as described previously18 on paraffin-embedded sections of 10 uveal melanomas. In brief, VEGF-A complementary DNA (cDNA) was cloned into pGEM3 plasmide (pGEMo-3Zf[+] Vector, Promega, Madison, WI). The copy RNA (cRNA) probes were labeled with digoxigenin according to manufacturer’s protocol (Boehringer, Mannheim, Germany). The VEGF-A probes usedwere 5’ GCCTCCGAAACCATGAACTTT 3’ (sense) and 5’ CCGCATAATCTGCATGGTGAT 3’ (antisense). After pre-treatment, the tumor sections were hybridized with 10 ng VEGF-A antisense riboprobe per slide overnight at 62°C. Subsequently, sections were washed and finally treated with 2 U/ml ribonuclease T1 (Roche, Basel, Switzerland) in 2 x SSC plus 1 mmol EDTA. Immunodetection of digoxigenin-labeled hybrids was performed using nitroblue tetrazolium as a chromogen and bicholylindolyl phosphate (Roche) as a coupling agent. Adjacent tumor slides, hybridized with VEGF-A sense riboprobes, were included as negative controls and did not show staining.
Enzyme-linked immunosorbent Assay (ELISA)
The VEGF-A concentration in aqueous humor, tumor and retinal tissue homogenates, and cell line supernatants were measured using an ELISA-kit (Biosource International Inc., California, USA). The lowest measurable concentration was 4 pg/ml with an intra-assay coefficient of variation (CV) of 4.7 % and an interassay CV of 8.1 %. To analyze samples in duplicate and to simultaneously preserve the sample, ocular fluids were diluted at 1:2.
Table 1:
Histopathological variables in 74 untreated eyes with uveal melanoma
Abbreviations: LN VEGF-A, natrual logarithm of the VEGF-A cencentration; VEGF-A, vascular endothelial growth factor.
Retinal and tumor tissue homogenates
Retinal and tumor tissue were collected from 10 patients. Retinal tissue was obtained from areas adjacent to and overlaying the tumor. Tissue was snap-frozen in liquid nitrogen within 10 minutes after enucleation. Thirty microgram of tissue was lysed in 200 µl of radio- immunoprecipitation assay (RIPA) buffer (Roche, Mannheim, Germany). The sample was homogenized and protease and phosphatase inhibitor was added. Insoluble fragments were removed by centrifugation at 13000 rpm for 10 minutes and the supernatant lysate was
Characteristic No of patients Mean LN VEGF-A conc
± SD
VEGF-A conc
pg/mL P-value
Cell type
Spindle 31 4.8 ± 0.7 144.5 0.108*
Mixed 31 5.3 ± 0.7 216.6
Epitheliod 12 5.0 ± 0.8 154.9
Location
Choroid 51 4.7 ± 0.7 141.7 0.024•
Cilairy body
involvement 23 5.4 ± 0.6 259.2
Bruch’s membrane
Intact 19 4.9 ± 0.8 175.2 0.396•
Broken 33 4.8 ± 0.8 161.4
Undeterminable 22
Pigmentation grade
None 3 4.7 ± 0.2 107 0.211*
Slight 34 5.0 ± 0.8 200.7
Moderate 28 5.0 ± 0.8 172
Severe 9 4.8 ± 0.5 136
Chapter 6 102
immediately frozen at -80°C.
Western blot analysis
To determine the presence of VEGF-A in retina and tumor tissue, Western blot analysis was performed on uveal melanoma tissue and on retinal tissue obtained from 10 patients.
Tissue lysates (30 µg/lane) were separated by 12.5% sodium dodecylsulfate polyacrylamide gel electrophoresis. Proteins were immunodetected using the appropriate anti-VEGF-A monoclonal antibody (R&D Systems). Protein bands were visualized using the Supersignal®
Chemiluminescent substrate kit (Pierce, Rockford, IL). Semi-quantitative estimates of relative protein levels were made using computerized densitometry (Scion Image for windows).
Statistical analysis
The distribution of aqueous humor VEGF-A samples was skewed. Therefore, in all statistical analyses the natural logarithm of the VEGF concentration (indicated as LN VEGF-A) was used to get the natural distribution that is needed for standard statistical tests. The Pearson product moment correlation was used to assess the correlation between LN VEGF-A and largest basal diameter (LBD) and tumor height. A melanoma-specific survival analysis was performed using the Kaplan-Meier method and log-rank test. Cox proportional hazards regression analysis was used to establish a predictive model for survival. All statistic analyses were performed with SPSS 11.0 statistical software package.
Results
Our results demonstrated increased aqueous VEGF-A in eyes with uveal melanoma. Aqueous concentration of VEGF-A correlates with patient survival, largest basal tumor diameter, tumor height and ciliary body involvement. Our results showed that uveal melanoma cells and overlying retina produce VEGF-A. Boyd et al. described increased concentrations of VEGF-A in the aqueous humor of eyes with uveal melanoma but, based on varied immunohistochemical test results, concluded that the source of the VEGF-A is not fully understood.19 Because VEGF-A is a leakage factor and a stimulant for new vessel formation, we hypothesize that larger tumors, characterized by increased vessel densities and increased vessel leakage, produce higher concentrations of VEGF-A. Therefore, we set out to test VEGF-A concentrations in the aqueous humor in a series of uveal melanomas.
VEGF in aqueous humor
To test whether aqueous humor samples obtained after enucleation were representative of the in vivo setting, VEGF-A concentrations were determined in aqueous humor in 3 patients taken before and after enucleation. These concentrations differed by less than 5 %, indicating that aqueous humor specimens obtained immediately after enucleation are representative of
the in vivo setting: the values for 3 patients were 101.4 and 103.2, 148.6 and 143.2, and 153.4 and 150.4 pg/ml before and after enucleation, respectively.
Clinical and histopathological variables
Of 74 patients with uveal melanoma 20 died of uveal melanoma during follow-up, 11 died of nonrelated causes and 43 are still alive. We determined VEGF-A concentration in aqueous humor from 30 control eyes at the time of cataract surgery. The median concentration was 50.1 pg/ml (range 4-149 pg/ml).
Compared with the controls in 74 eyes with uveal melanoma, the median VEGF-A concentration was significantly higher at 146.5 pg/ml (range 18-826 pg/ml) (p<0.001) (figure 1A). None of the 74 eyes showed retinal neovascularisation at the time of enucleation. The median VEGF-A concentration in aqueous humor of 8 additional eyes with uveal melanoma that had undergone treatment in the past was 364 pg/ml (range 79 - 3000). Three of these eyes (1 eye that had twice received TTT and once Ruthenium therapy, and 2 eyes that had been treated with proton beam irradiation) had developed radiation retinopathy, and showed very high VEGF-A concentrations (555, 1877 and 3000 pg/ml, respectively) (table 2).
To assess why some eyes with previously untreated uveal melanomas produced more VEGF-A than others, we looked for associations between the aqueous VEGF-A levels and clinical and histopathological variables. To perform statistical tests, the natural logarithm of the VEGF-A values were used to obtain a normal distribution.
Using Pearson product moment correlation significant positive correlations were found between LN VEGF-A and the largest basal tumor diameter (p<0.0001) (figure 1B) and tumor height (p=0.001) (figure 1C). The LN VEGF-A was compared with other histopathologic variables as given in table 1. There were no correlations between LN VEGF-A and the presence of necrosis (p=0.90), breakdown of Bruch membrane (p=0.40), number of mitoses (p=0.873), pigmentation grade (p=0.21) or cell type (p=0.81). The mean LN VEGF-A of 4.7 in 51 choroidal tumors was significantly lower than the mean LN VEGF-A of 5.4 in 23 tmors with ciliary body involvement (p=0.02). Patient survival was studied in relation to LN VEGF-A. The patients were divided into 2 groups, having values above or below the median LN VEGF-A of 4.93. Statistically significant lower patient survival was found in the group with a high VEGF-A compared with the group with lower LN VEGF-A (p<0.05, log-rank test, figure 1D). Cox proportional hazards regression analysis showed a significant difference in survival (p=0.043) with a B of 0.78 and a S.E. of 0.38. This indicates that doubling of VEGF-A concentration is associated with an increased risk of dying of uveal melanoma of 2.174 = 20.78. In univariate Cox proportional hazards regression analysis of melanoma- specific mortality, largest basal tumor diameter, LN VEGF-A and cell type had the strongest relationship with survival (χ² = 5.3; χ2= 4.6; χ2=4.1, respectively; table 3). Multivariate analysis showed no significance for LN VEGF-A. Largest basal tumor diameter and cell type reached significance in a multivariate model.
Chapter 6 104
Figure 1: Graphs showing correlation between VEGF-A and study eye variables. (A) In 74 untreated eyes with uveal melanoma (UM), the median aqueous VEGF-A concentration of 146.5 pg/mL, which was significantly higher than that in 30 control eyes (P<.001, Pearsons product moment correlation). (B) A significant positive correlation was found between the natrual logarithm of VEGF-A concentration (LN VEGF-A) and largest basel diameter (P<.001, Pearson product moment correlation). (C) A significant positive correlation was found between LN VEGF-A and the tumor height (P=.001 Pearson product moment correlation). (D) Statistically significant lower patient survival was associated with higher LN VEGF-A compared with lower LN VEGF-A (P=.04, Cox proportional hazards regression analysis).
Table 2: Eight treated eyes with uveal melanoma.
Abbreviations: VEGF-A vascular endothelial growth factor; TTT, transpupillairy thermotherapy.
A
D C
A B
D C
B
Nr Therapy VEGF conc pg/mL
1 Ruthenium plaque 78.9
2 Ruthenium plaque 86.2
3 Ruthenium plaque 97.2
4 TTT 173.2
5 Ruthenium plaque 555
6 Proton beam therapy 1058
7 Ruthenium +2x TTT 1877.5
8 Proton beam therapy 3000
Table 3:Univariate Cox proportional hazards regression analysis of melanoma-specific mortality Variable Regression
coefficient (standard
error)
Likeli-hood
ratio P Hazards
ratio (95%
confidence interval)
Largest basal diameter
0.172 (0.076) 5.3 0.024 1.188
(1.02-1.38)
VEGF-ALN 0.777 (0.384) 4.6 0.04 2.174
(1.02-4.62)
Cell type* 1.085 (0.575) 4.1 0.06 2.959
(0.96-9.13)
Height 0.193 (0.097) 4.0 0.05 1.213
(1.00-1.47)
Age 0.038 (0.020) 4.0 0.055 1.039
(0.99-1.08)
VEGF-A production by tumor cells based on results of in situ hybridization
Because an association was observed between tumor size and VEGF-A concentration in aqueous humor, it would be logical to assume that VEGF-A is produced by the tumor cells.
Although it has been shown that uveal melanoma cell lines produce VEGF-A16, results of immunohistochemical staining of uveal melanoma tissues have been contradictory. Therefore, we performed in situ hybridization of VEGF-A in 10 eyes with uveal melanoma. Intense expression of VEGF-A mRNA was found in the retinal pigment epithelium, and in the inner nuclear layer, in ganglion cells and in external limiting membrane. The staining was m
Figure 2: In situ hybridization of VEGF-A in 10 eyes with uveal melanoma demonstrated diffuse VEGF-A expression throughout the tumors, especially around blood vessels. (A) Intense cytoplasmatic staining of VEGF-A
A B
C
A B
C
Chapter 6 106
mRNA in tumor cells (arrows). (B) Retinal staining adjecent to the tumor. Diffuse staining in disarranged retina. (C) Slight staining of tumor cells (arrow).
more intense in detached retina. There was diffuse VEGF-A expression throughout the tumors, especially around blood vessels (figure 2).
Expression of VEGF-A in tumor and retinal tissue
The in situ hybridization data showed that not only the tumor cells, but also the overlying retina might be sources of VEGF-A. We extended our study to determine VEGF-A protein levels in uveal melanoma and adjacent retinal tissue with semi-quantitative Western blot analysis and ELISA.
Western blot analysis (figure 3A) performing on retinal and tumor tissues contained VEGF-A.
Relative protein levels showed that retinal tissue contained 1.62-fold more VEGF-A than tumor tissue. ELISA in the 10 samples showed expression of VEGF-A in all tumor and retinal tissues (figure 3B). The mean ± SD levels of VEGF-A were 6 ± 1.7 ng/g of retinal tissue and 6.5 ± 1.5 ng/g of tumor tissue.
Because these expression data indicated that the cause of VEGF-A production might be retinal detachment , we determined VEGF-A concentrations in the aqueous humor of 22
Figure 3: Western blot analysis (A) and enzyme-linked immonusorbent assay (B) showed VEGF-A in retinal tissues and in tunor tissues from 10 eyes with uveal melanoma.
RelativeproteinlevelsVEGF-A in ng/g tissue
A
B
VEGF-A
RelativeproteinlevelsVEGF-A in ng/g tissue
A
B
VEGF-A
eyes with a retinal detachment. Aqueous humor, samples were obtained during retinal detachment surgery. The median VEGF-A concentration ws 43.5 pg/ml (range 20-427 pg/
ml). This is similar to that found in the cataract cases. Therefore, the increased concentrations of VEGF-A in the aqueous humor of eyes with uveal melanoma cannot be explained by concominant retinal detachment. It is more likely that a combination of ischemia in the tumor and ischemia in the overlying retina causes induction of VEGF-A production in both tissues.
Discussion
Our study demonstrated increased VEGF-A concentrations in the aqueous humor of eyes with uveal melanoma. In our sample which was larger than the group analysed by Boyd et al.20 we compared VEGF-A concentrations and clinical and histopathological variables and observed an association between LN VEGF-A and largest basal tumor diameter, the tumor height and ciliary body involvement. It is known that uveal melanoma cell lines produce VEGF-A in vitro, and our in situ hybrydization results demonstrated VEGF-A expression in uveal melanoma was not the sole source of VEGF-A production, as VEGF-A was also expressed in adjacent and overlying retina. In various types of tumors including brain21, breast22 and colorectal23 tumors VEGF-A is produced by the tumor. This was previously unsubstantiated for uveal melanoma, as the reported immunohistocehmical protein expression of VEGF-A, had varied among studies. Sheidow et al.24 demonstrated expression of VEGF-A in 94% of uveal melanomas, although at low levels: staining was weak in 62% of the tumors20. Vinoreset al.25 found VEGF-A expression in only 26% of uveal melanomas. Other immunohistochemical studies 20, 26 found lower percentages. Our results and those of in situ hybridization study by Stitt et al. 26 showed marked expression of VEGF-A messenger RNA, especially around blood vessels. Boyd et al.26 reported the presence of VEGF mRNA in 100% of 20 tumors examined by reverse transcriptase polymerase chain reaction (RT-PCR)23.
Stitt et al.26 suggested that retina may be a source of VEGF-A, as they found increased production of VEGF-A mRNA in ganglion cells and inner nuclear layer of the retina, proximal and distal to tumor deposits, and this was confirmed by our study. Vinores25 reported expression of VEGF-A in eyes with uveal melanoma in retinas, close to (46%), and distant from (24%) the melanoma. Kivela et al.27 proposed the prognostic significance of the finding of retinal detachments in eyes with uveal melanoma, which correlated with increased tumor size, and increase of tumor vessels networking. The results of our in situ hybridization investigation suggest that the tumor and retina are sources of aqueous VEGF-A, and we observed VEGF-A expression in detached retinal tissue. Because eyes with retinal detachment only did not show increased concentrations of aqueous VEGF-A compared with controls (p = 0.11), we concluded that retinal detachment alone was insufficient to increase VEGF-A concentrations as seen in eyes with uveal melanoma. Uveal melanoma may secrete factors that induce
Chapter 6 108
VEGF-A production in an autocrine fashion and in the surrounding tissues. This is consistent with our finding that aqueous VEGF-A concentration was not an independent prognostic factor in our study, but correlated with largest basal tumor diameter and with tumor height.
This suggests that aqueous VEGF-A concentrations, retinal distress or retinal detachment, and tumor size are all interrelated factors.
The high VEGF-A concentrations in 8 pretreated eyes in our study are in accordance with observations by Boyd et al14 that eyes with neovascularization after radiotherapy had a higher aqueous VEGF-A concentration. In our series, 3 pretreated eyes had radiation retinopathy and these had the highest VEGF-A concentrations of any eyes tested. One eye that had previously undergone proton beam irradiation without noticable radiation retinopathy clinically, also had a high concentrations of VEGF-A. Ocular neovascularization is an serious complication after irradiation, and may lead to a secondary enucleation. Our data suggest a potentially benificial role for anti-VEGF-A therapy in these eyes to avoid neovascularization, neovascular glaucoma and subsequent enucleation.
In conclusion, the correlation between aqueous VEGF-A concentration and largest basal tumor diameter, tumor height and increased expression of VEGF-A by uveal melanoma cells suggest important mechanism in uveal melanoma angiogenesis. Their possible application as targets for therapy warrants further study, especially in cases of radiation retinopathy.
Acknowledgements
We thank C. van der Bent and especially C.J.M.Kröse for technical assistance. We thank Dr.
N.E. Schalij-Delfos, Drs. J.C. Bleeker and Dr T.O. Missotten (Catholic University Leuven) for providing the control aqueous humor specimens. We thank Dr D. de Wolff-Rouendaal for histopathological evaluation of the tumor eyes.
References
Bergman L, Seregard S, Nilsson B, Ringborg U, Lundell G, Ragnarsson-Olding B. Incidence of uveal 1.
melanoma in Sweden from 1960 to 1998. Invest Ophthalmol Vis Sci 2002; 43: 2579-2583.
Diener-West W, Hawkins BS, Markowitz, Schachat AP. A review of mortality from choroidal melanoma.
2.
II. A meta-analysis of 5-year mortality rates following enucleation, 1966 through 1988. Arch Ophthalmol 1992; 110: 245-250.
Pyrhonen S. The treatment of metastatic uveal melanoma. Eur J Cancer 1998; 34: S27-30.
3.
Schlingemann RO, van Hinsbergh VWM. Role of vascular permeability factor/vascular endothelial 4.
growth factor in eye disease. Br J Ophthalmology 1997; 81: 501-512.
Ferrara N. Vascular Endothelial Growth Factor: basic science and clinical progress. Review. Endocr Rev 5.
2004; 25: 581-611.
Küchle M, Nguyen NX, Naumann GO. Quantitative assessment of the blood-aqueous barrier in human 6.
eyes with malignant or benign uveal tumors. Am J Ophthalmol 1994; 117: 521-528.
Witmer AN, Vrensen GF, Van Noorden CJ, Schlingemann RO. Vascular endothelial growth factors and 7.
angiogenesis in eye disease. Prog Retin Eye Res 2003; 22: 1-29.
Shinoda K, Ishida S, Kawashima S, Wakabayashi T, Matsuzaki T, Takayama M, Shinmura K, Yamada M.
8.
Comparison of the levels of hepatocyte growth factor and vascular endothelial growth factor in aqeous fluid and serum with grades of retinopathy in patients with diabetes mellitus. Br J Ophthalmol 1999; 83:
834-837.
Miller JW, Adamis AP, Shima DT, D’amore PA, Moulton RS, O’Reilly M.S, Folkman J, Dvorak H.F, 9.
Brown L.F, Berse B. Vascular endothelial growth factor/vascular permeability factor is temporally and spatially correlated with ocular angiogenesis in a primate model. Am J Pathol 1994; 154: 574-584.
Endo M, Yahagisawa K, Tsuchida K, Okamoto T, Matsushita T, Higushi M, Matsuda A, Takeuchi M, 10.
Makita Z, Koike T. Increased levels of vascular endothelial growth factor and advanced glycation end products in aqueous humor of patients with diabetic retinopathy. Horm Metab Res 2001; 33: 317-322.
Mc Laren M, Elhadd TA, Greene SA, Belch JJ. Elevated plasma vascular endothelial cell growth factor 11.
and thrombomodulin in juvenile diabetic patients. Clin Appl Thromb Hemost 1999; 5: 21-24.
Aiello L.P, Avery R.L, Arrigg P.G, Keyt B.A, Jampel H.D, Shah S.T, Pasquale L.R, Thieme H, Iwamoto 12.
M.A, Park J.E. Vascular endothelial growth factor in ocular fluid of patients with diabetic retinopathy and other retinal disorders. N Engl J Med 1994; 331 : 1480-1487.
Tripathi RC, Li J, Tripathi BJ, Chalam KV, Adamis AP. Increased level of vascular endothelial growth 13.
factor in aqueous humor of patients with neovascular glaucoma. Ophthalmology 1998; 105: 232-237.
Boyd SR, Tan D, Bunce C, Gittos A, Neale MH, Hungerford JL, Charnock-Jones DS, Cree IA. Vascular 14.
endothelial growth factor is elevated in ocular fluids of eyes harbouring uveal melanoma : identification of a potential therapeutic window. Br J Ophthalmol 2002; 86: 448-452.
Los M, Aarsman CJ, Terpstra L, Wittebol-Post D, Lips CJ, Blijham GH, Voest EE Elevated ocular levels of 15.
vascular endothelial growth factor in patients with von Hippel-Lindau disease. Ann Oncol 1997;1015- 1022.
IJland SA, Jager MJ, Heijdra BM, Westphal JR, Peek R. Expression of angiogenic and immunosuppressive 16.
factors by uveal melanoma cell lines. Melanoma Res 1999; 9: 445-450.
Hernandez C, Garcia-Arumi J, Burgos R, Segura R.M, Canton A, Simo R. Vitreous levels of vascular 17.
cell adhesion molecule and vascular endothelial growth factor in patients with proliferative diabetic retinopathy. Diabetes Care 2001; 24: 516-521.
Hazelbag S, Gorter A, Kenter GG, van de Broek L, Fleuren G. Transforming Growth Factor-β1 induces 18.
tumor stroma and reduces tumor infiltrate in cervical cancer. Hum Pathol 2002; 33: 1193-1199.
Boyd S. Uveal melanoma and angiogenesis. In Eds. Jager M.J., Niederkorn J.Y., Ksander B.R. Uveal 19.
melanoma, a model for exploring fundamental cancer biology; Taylor & Francis 2004
Boyd SR, Tan DSW, de Souza L, Neale MH, Myatt NE, Alexander RA, Robb M, Hungerford JL, Cree IA.
20.
Uveal melanomas express vascular endothelial growth factor and basic fibroblast growth factor and support endothelial cell growth. Br J Ophthalmol 2002; 86: 440-447
Machein MR, Plate KH. Role of VEGF in developmental angiogenesis and in tunor angiogenesis in the 21.
Chapter 6 110
brain. Cancer Treat Res 2004;117:191-218
Gasparinr G. Prognostic value of VEGF in breast cancer. Oncologist 2000;5:37-44 22.
Gruba M, Seelinger H, Kleespier A, Jaugh KW, Bruns C. Vascular endothelial growth factor in colorectal 23.
cancer. Int J Colorectal Dis 2004;19:510-517
Sheidow TG, Hooper P, Crukley C, Young J, Heathcote JG. Expression of vascular endothelial growth 24.
factor in uveal melanoma and its correlation with metastasis. Br J Ophthalmology 2000; 84: 750-756.
Vinores SA, Kuchle M, Mahlow J, Chiu C, Green WR, Campochiaro PA. Blood-ocular barrier 25.
breakdown in eyes with ocular melanoma. A potential role for vascular endothelial growth factor/vascular permeability factor. Am J Pathol 1995; 147: 1289-1297
Stitt AW, Simpson DA, Boocock C, Gardiner TA, Murphy GM, Archer DB. Expression of vascular 26.
endothelial growth factor and its receptors is regulated in eyes with intra-ocular tumors. J Pathol 1998; 186: 306-312.
Kivela T, Eskelin S, Makitie T, Summanen P. Exsudative retinal detachment from malignant uveal 27.
melanoma : predictors and prognostic significance. Invest Ophth Vis Science 2001 ; 42: 2085-2093.
Chapt 112
