Applications of DNA hybrids in biobased medicine and materials
Liu, Qing
IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below.
Document Version
Publisher's PDF, also known as Version of record
Publication date: 2018
Link to publication in University of Groningen/UMCG research database
Citation for published version (APA):
Liu, Q. (2018). Applications of DNA hybrids in biobased medicine and materials. University of Groningen.
Copyright
Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).
Take-down policy
If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.
Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum.
Applications of DNA hybrids in
biobased medicine and materials
Applications of DNA hybrids in biobased medicine and materials
Qing Liu
PhD thesis
University of Groningen
May 2018
Zernike Institute PhD thesis series 2018-17
ISSN: 1570-1530
ISBN: 978-94-034-0690-9
(printed version)
ISBN: 978-94-034-0689-3 (electronic version)
The research described in thesis was performed in Polymer Chemistry and
Bioengineering group at Zernike Institute for Advanced Materials, University of
Groningen, the Netherlands. This work was financially supported by Chinese
Scholarship Council (CSC), University of Groningen and Netherlands
Organization for Science Research (NWO).
Cover design by: Qing Liu & Zhuojun Meng
Printed by: Ridderprint BV
Applications of DNA hybrids in
biobased medicine and materials
PhD thesis
to obtain the degree of PhD at the University of Groningen
on the authority of the Rector Magnificus Prof. E. Sterken
and in accordance with the decision by the College of Deans. This thesis will be defended in public on
Friday 18 May 2018 at 11.00 hours
by
Qing Liu
born on 21 August 1986 in Hunan, China
Assessment committee
Prof. W. H. Roos Prof. J. G. Roelfes Prof. E. Weinhold
Dedicated to my beloved wife Zhuojun Meng
Chapter 1 Hydrophobic Modification of DNA
... 9
1.1 Introduction
... 10
1.2 Modification Methods
... 11
1.3 Applications
... 15
1.4 Thesis Motivation and Overview
... 22
Chapter 2
Supramolecular Micelle-Based
Nucleoapzymes for the Catalytic
Oxidation of Dopamine
to Aminochrome
... 29
2.1 Introduction
... 30
2.2 Result and Discussion
... 32
2.3 Conclusion
... 38
2.4 Experimental Section
... 39
Chapter 3 Lipid Modified Aptamers as Vehicles for
Ophthalmic Drug Delivery
... 47
3.1 Introduction
... 48
3.2 Result and Discussion
... 49
3.3 Conclusion
... 55
Chapter 4
Photoswitching of DNA Hybridization using a
Molecular Motor
... 67
4.1 Introduction
... 68
4.2 Result and Discussion
... 70
4.3 Conclusion
... 76
4.4 Experimental Section
... 77
Chapter 5 Highly Stiff and Stretchable DNA Liquid
Crystalline Organogels with Fast Self-Healing and
Magnetic Response Behaviors
... 83
5.1 Introduction
... 84
5.2 Result and Discussion
... 85
5.3 Conclusion
... 92
5.4 Experimental Section
... 93
Summary
... 107
Samenvatting
... 111
Chapter 1
10
1.1 Introduction
As one of the most studied biomacromolecules, deoxyribonucleic acid (DNA) has fascinated researchers not only by its role as a carrier for the genetic information but also its utilization as a structural motif for the assembly of nanostructures, which is termed DNA nanotechnology. Thanks to the introduction of automated solid phase synthesis, molecular cloning techniques and polymerase chain reaction, a greater range of studies involving oligonucleotides and long nucleic acid strands became possible at an affordable price and effort.
The profound interests upon DNA could be attributed to its unique properties, including self-recognition, sequence programmability, robustness and moderate resistance to degradation. In 1991, an artistic building strategy for artificial DNA structures using pristine DNA was introduced by Seeman.1 A series of DNA
architectures have been realized ever since, ranging from two-dimensional arrays 2-5 to well-defined three dimensional tubes,6 convex polyhedra7-11 and brick and
origami structures.12-15 The decisive factor behind all these designs is the proper
persistence length of a double-stranded (ds) DNA (50 nm). Due to their well-defined size and shape, significant progress has been made in various application areas employing such DNA nanostructures that range from nanoscale assembly line,16
drug delivery,17,18 nucleic acid detection,19 and DNA machines.20,21
Additionally, great efforts have been devoted to developing applications of DNA by combining its information-carrying capability with new functionalities introduced by new units. Thanks to the enormous development in DNA technology, a great range of tailor-made modifications are commercially available nowadays for daily laboratory usage, which in return promotes the advance of DNA technology. For example, when an acrydite is attached to DNA, DNA-based gels could be obtained upon polymerization, which show appealing performance in sensors,22 drug release
scaffolds23 or as matrices for the triggered activation of enzyme cascades.24 In
addition to the introduction of new functionalities to DNA, ongoing research has also been focusing on altering molecular structures, morphology, self-assembly properties or even solubility of DNA hybrids upon the introduction of tailored structural units. These can be materials being composed of small organic molecules,25 polymers,26-28 inorganic nanoparticles that are covalently attached to
DNA29-31 or surfactants that are combined through electrostatic interactions.32-33
The first class of DNA hybrids tends to assemble into nanoparticles with a hydrophilic DNA corona and an organic or inorganic core. Such hybrids have found use in DNA detection,34 gene regulation,35 template synthesis36 and
11
These DNA/surfactant complexes have also been extensively studied and found vast applications.38-41
In recent years, a range of hydrophobic structures have been applied to modify DNA. These DNA hybrid materials either tend to self-assemble into micellar systems with dimensions on the nanoscale in aqueous phase due to micro phase separation or precipitate from the aqueous phase. Their behaviors are very different from pristine DNA. Hence, these materials present appealing potential for applications in the fields of bionanotechnology and nanomedicine. In this chapter, the hydrophobic modification of DNA through small organic molecules, polymers and surfactants will be briefly reviewed.
1.2 Modification Methods
1.2.1 Solid-Phase synthesis (SPS) of nucleic acids
Figure. 1.1. Hydrophobic modification of (A) 5’- and (B) 3’- end of DNAs using solid-phase
synthesis. (a) deblocking of DMA; (b) coupling of activated CEPA to 5’-end; (c) standard synthesis with nucleoside phosphoramidite.
12
In 1955 the first dinucleotide was chemically synthesized.42 However, a universal
method for the chemical preparation of both DNA and RNA was not reported until 1980 in which 2’-deoxynucleoside-3’-phosphoramidites were used as synthons.43,44
The SPS technique now makes it possible to synthesize short fragments of DNA (up to 200 mers). At the same time, researchers also found it convenient to introduce functional groups to DNAs while the DNAs are still attached to the solid support. One classic method consists of using 2-cyanoethyl-N, N-diisopropylphosphoramidite (CEPA) groups to introduce hydrophobic structures to DNA.45 The hydrophobic
molecule is first activated with CEPA and then attached to the 5’-end of DNA on the solid supports (Figure 1.1 A). The coupling to the 3’-end of DNA could be achieved either through reverse synthesis employing special CEPA activated units and final attachment of the hydrophobic moiety (similar to coupling to 5’-end in Figure 1.1 A) or using custom solid supports, which already contain the desired hydrophobic moieties that is connected via a cleavable linker (e.g. carboxylic ester) (Figure 1.1 B).46
With SPS, the coupling of hydrophobic entities to DNA could be done either with or without a DNA synthesizer. With a DNA synthesizer, the full synthesis including the hydrophobe can be regarded as a fully automated process. The advantages of the fully automated synthesis are precise control and monitoring of the entire procedure, higher reproducibility and relatively large scales. A wide range of hydrophobic units have been successfully attached to DNAs within a DNA synthesizer.47-50 Very recently, the automated synthesis technique was employed to
prepare polymers and DNA-polymer conjugates through atom transfer radical polymerization (ATRP).51
The coupling of the hydrophobe without a DNA synthesizer is often used to circumvent the shortcomings of fully automated synthesis. In this way, the hydropbobe is often coupled using a syringe or in a flask with DNA on solid supports as synthesized.This method can be specifically tailored to satisfy the requirements of some synthesis, which cannot be achieved on a synthesizer, like incompatible solvents or catalysts, extreme reaction conditions or longer reaction time.
13
1.2.2 Solution coupling
Figure. 1.2. Illustration of the organic phase synthesis of hydrophobic molecules modified DNAs.
Solution-phase coupling of DNA with hydrophilic molecules in an aqueous environment has been demonstrated to be highly versatile and efficient at various positions of the DNA molecule. It is a very widely used method to functionalize DNA with groups like amines or thiols and to attach those to specific complementary functionalities like carboxylic acid, thiols or maleimides. Modification of DNA with hydrophobic molecules in aqueous phase, however, is less efficient due to solvent incompatibility of the two components i.e. the nucleic acid is soluble in water while the hydrophobe is not.52
Recently it was reported in our group that with the help of positively charged surfactants, hydrophobic molecules could be attached to DNA even in organic phase, as shown in Figure 1.2.53 In short, terminal functionalized DNAs (e.g. amine) were
first complexed with positively charged surfactants, precipitated and freeze-dried. The resultant DNA/surfactant complexes are not soluble in aqueous phase but can be dissolved in organic solvents like DMF, CHCl3 and THF while the surfactants do
not compromise the reactivity of the functional group on the DNA. Therefore, the coupling of hydrophobic molecules to DNA could be carried out in organic phase with high efficiency. After the reaction, the surfactants were removed by simply washing the solutions with brine, yielding the desired products. Pyrene, hydrophobic alkyl chains and polystyrene were attached to the terminals of DNA in high yields.
14
1.2.3 Complexation with surfactants
Figure. 1.3. Schematic representation of four representative LLC structures of dsDNA-lipid
complexes: (a) lamellar phase; (b) and (c) hexagonal phase; (d) cubic phase.
Hydrophobic modification of DNA could be realized by complexation with positively charged surfactants through electrostatic interactions, yielding water-insoluble DNA/surfactant complexes. Their properties are different from the ones from DNA amphiphiles. These complexes consist of a DNA backbone from which surfactants protrude as non-covalently bonded side chains. Their formation is electrostatically driven and they form bulk films, lyotropic as well as thermotropic liquid crystals and hydrogels. Owing to their molecular shape and weak intermolecular interactions, such as van der Waals and dipolar forces,54-56 these complexes tend to
spontaneously form highly organized assemblies like ordered lamellar, hexagonal and cubic structures as well as disordered isotropic phases,57,58 as shown in Figure
15
1.3 Applications
DNA modified with hydrophobic molecules tends to self-assemble into micellar systems with nanometer dimensions because of micro phase separation (except for DNA/surfactant complexes). These nano-sized particles are composed of a soft hydrophobic core and a hydrophilic shell, which has made them very promising candidates in fields like drug delivery, DNA detection and template reactions. On the other hand, DNA/surfactant complexes are mainly investigated in bulk film or as liquid crystals. In both states the respective materials exhibit well-defined structures, high structural stability and easy processability, thereby allowing diverse applications ranging from optoelectronics to biomedicine and therapeutics.
1.3.1 Drug delivery
Figure. 1.4. (a) Schematic representation of PPO-b-DNA copolymer micelle: folic acid (red dots)
modified complementary oligonucleotides are hybridized to functionalize the surface of the nanoparticle with targeting units and drugs (green dots) are introduced to the core of the nanoparticle through mixing. (b) Schematic representation of PPO-b-DNA copolymer and Pluronics hybrid micelle. (A) PEG block of Pluronic; (B) DNA block of DBC; (C) PPO blocks of Pluronic and DBC; (D, E) Probes at 5’- and 3’- ends of the cDNA, respectively. (F) Hydrophobic compound loaded into the hydrophobic core. (G) Cross-linked nanodomains of PETA in the core.
Due to the self-recognition properties of the DNA part and the presence of a hydrophobic core to serve as a carrier unit, DNA amphiphiles have been extensively
16
studied for drug delivery. With polypropylene oxide-DNA block copolymer (PPO-b-DNA) micelles, researchers in our group exploited it in cancer therapy.59 It was
found that the shell functionality of the nanoparticles could be easily introduced through hybridization with functionalized complementary oligonucleotide (in this case, folic acid) while the hydrophobic interior could be loaded with hydrophobic anticancer drugs through simple mixing (Figure 1.4 a). Cell culture experiments with Caco 2 cells showed that these nanoparticles could be taken up through receptor mediated endocytosis and resulted in efficient cytotoxicity and high mortality. Later a more sophisticated design was proposed in our group (Figure 1.4 b).60 In this design, Pluronics, a triblock copolymer with a PEG–b-PPO–b-PEG
architecture, was blended with PPO-b-DNA copolymer. As a result, the PPO from both DNA copolymer and Pluronics formed the core of micelles while DNA from copolymers and PEG from Pluronics were located in the corona. The PEG part did not undermine the hybridization of DNAs while the hydrophobic core could be loaded with hydrophobic drugs or cross-linked to prevent dissociation upon dilution.
17
Figure. 1.5. Schematic representation of expected structure change of ethidium bromide
intercalated DNA-DDAB film between dry and wet states.
Changing the environment from water to bulk materials, DNA-surfactant complexes are characterized by long term in vivo stability of the DNA component and subsequently can recover biological activity once wetted.61 These structures contain
a high local concentration of the therapeutic nucleic acid agent and hence the study of bulk DNA-surfactant structures is developing into an exciting field for drug delivery applications. Tirrell and co-workers recently simulated a drug release system by employing an ethidium bromide-labelled DNA-didodecyldimethylammonium bromide (DNA-DDAB) film.62 When exposed to a
buffer solution, such as PBS, electrostatic screening of the DNA-complex charges led to disassembly of the film in a layer-by-layer fashion releasing ethidium bromide (Figure 1.5). It is thus reasonable to expect the film to disassemble easily in vivo and to act as a drug delivery vehicle or DNA depot. Similarly to ethidium bromide, anticancer drug molecules, such as daunorubicin and doxorubicin, also intercalate into DNA inhibiting the enzyme topoisomerase II and preventing the DNAs from
18
duplication in fast-replicating cells.63 These drugs are potentially useful in
DNA-surfactant films as they could be incorporated into the complex and then locally elute after implantation upon film degradation, either through nuclease action or ion replacement. In this fashion, a drug delivery system was realized by blending the DNA-surfactant complex with poly (lactide-co-glycolide) and the drug daunorubicin.64 The complex was obtained by casting a film from DMSO/CHCl3
solution and subsequent incubation into an aqueous solution of daunorubicin with drug loading being controlled by the immersion time. The pharmaceutically active payload was released from the films after introduction into PBS and the release rate was dependent on the chemical structure of the surfactants. These results clearly indicate that a film of the three components – DNA, surfactant and PLGA – is a promising matrix for anticancer drug delivery.
1.3.2 Liposome decoration
Liposomes are a class of nanocontainers which are able to encapsulate and protect both small molecules and bio-macromolecules, such as protein and DNA. They are made of two layers of amphiphilic lipid molecules of which the hydrophilic heads face to the aqueous solution while the hydrophobic tails point inwards towards each other.65 Liposomes play an important role in the physiology and pathophysiology of
living systems and they have been intensively studied to understand and manipulate biological events and processes.66-68 Considering the similarity between liposomes
and DNA amphiphiles, it is reasonable to predict that DNA amphiphiles can play a role in decorating liposomes.
A. R. Pulido designed a selective cargo-release system with the help of PPO-b-DNA,69
as shown in Figure 1.6. In this design, PPO-b-DNA was first inserted into the surface of vesicles with DNA pointing to the aqueous phase, tagging these nanocontainers with sequence information. Next, a BODIPY monoiodine (BMI) photosensitizer modified complementary DNA was used to hybridize with the DNA on the vesicle surface, which subsequently induced the generation of singlet oxygen close to the lipid membrane under light irradiation. The resulting oxidation of the PPO chains or highly unsaturated phospholipids effectively mediates liberation of the vesicle payload.
19
Figure. 1.6. Schematic representation of selective cargo release from PPO-b-DNA decorated
lipid vesicles. 1). Anchoring of PPO-b-DNA; 2) Hybridization with photosensitizer-modified complementary DNA; 3) Generation of singlet oxygen upon light irradiation; 4) selective cargo release induced by the oxidative effect of singlet oxygen.
Recently, it was reported by our group that hydrophobicity could be imparted to DNA through the introduction of a dodec-1-yne chain at the 5-position of a uracil base, which was subsequently coupled to DNA by solid phase synthesis, termed lipid-DNA.70With this method, the position and number of hydrophobic uracils
could be chosen with a similar efficiency as normal bases. The lipid-DNA was successfully utilized to induce vesicle fusion.71 This current work deals with a
strategy for anchoring oligonucleotides on a membrane by lipid-modified nucleobases rather than by attaching hydrophobic units to the 3’- or 5’-termini. Single-stranded DNAs functionalized with four lipid-modified nucleobases were stably grafted onto the membrane of lipid vesicles. The orientation of DNA hybridization and the number of anchoring units played a crucial role in liposomal fusion, which in the most efficient system reached remarkable 29% content mixing without notable leakage.
Besides, DNA amphiphiles have been employed to realize the assembly of larger containers,72 mimicking cellular systems73 and gene silencing.74
20
1.3.3 Nanoscience
DNA amphiphiles are not only suitable for the construction of nanoscopic structures like spherical or cylindrical micelle aggregates or vesicles but they can be manipulated using DNA.
With PPO-b-DNA, scientists were able to control the size and geometry of the structures.75 As shown in Figure 1.7 a, 22mer DNA coupled with PPO (Mw=6800
g/mol) self-assembled into spherical particles with a hydrodynamic radius of 10nm. When the number of bases was enzymatically extended to 84, particles with radius of 23nm were obtained. The geometry of the particles can be modulated through hybridization with a long complementary DNA template, which resulted in rod-like micelles.
Figure. 1.7. (a) Schematic representation and AFM images of the morphology change of
PPO-b-DNA amphiphiles upon hybridization with short PPO-b-DNAs (top) and long PPO-b-DNAs (bottom). (b) Schematic representation and TEM images of (i) spherical particles from initial DNA-brush copolymers, (ii) rod-like structure formation after the addition of phosphodiesterase enzyme and (iii) morphology change of aggregates upon the addition of different DNA sequences.
Another elegant design involved phosphodiesterase enzyme.76 DNA-brush
copolymer amphiphiles were obtained by grafting DNAs to a hydrophobic copolymer. Long DNA side chains gave the copolymers higher surface curvature, which resulted in spherical aggregates. When the DNA was cut by an enzyme, a rod-like morphology was formed. Later, upon hybridization with partial complementary DNA to the side chains, spherical particles were formed again because of the increased surface curvature caused by elongated DNA chains. The partial complementary DNA could be removed by adding a DNA which is fully complementary to it, resulting in amphiphiles with short DNAs hence rod-like aggregates. Upon changing DNA sequences, a reversible control over the morphology of the aggregates was realized. (Figure 1.7 b)
21
Figure. 1.8. Schematic representation of DNA cubes with polymer decoration.
In a different design, hydrophilic moieties were attached to the outside of DNA nanostructure. Thereby, a DNA cube scaffold was preassembled with single-stranded regions, which were further hybridized with four polymer modified DNA strands, as shown in Figure 1.8.77 The polymer was located at various corners of the
cube, which increased the nuclease resistance comparing to DNA cubes without polymers.
1.3.4 DNA detection
Similar DNA side chain polymers that were described in the previous paragraph were employed also for DNA detection. When several DNA strands are grafted along one polymer chain the melting curves are sharper and higher when hybridized with complementary DNA compared to pristine DNA.78 This characteristic melting
behavior was exploited for DNA detection. In one study, DNA as well as ferrocene units were grafted to a polymer backbone and the resulting hybrids were used in a sandwich-type electrochemical detection strategy (Figure 1.9).79 A probe sequence
was first immobilized on the surface of a gold electrode. After that, the hybrids and target DNA were added and the redox signal was measured. The sensitivity of this strategy reached 100 pM. DNA-grafted polymer based DNA detection has also be exploited in several other studies.80-82
22
Figure. 1.9. Schematic representation of DNA detection employing a DNA and ferrocene grafted
polymer.
1.4 Thesis Motivation and Overview
Tremendous efforts have been devoted to the development of DNA functionalization methods over the last decades, including chemical modification and physical complexation. With specific modification, tailored functionalization and potential applications could be realized. For example, when coupled with a fluorophore, DNA could be used to detect particular sequences. When a hydrophobic structure was coupled to DNA, it is possible to yield either DNA amphiphiles or hydrophobic DNA hybrids. Nevertheless, both DNA architectures present some unique properties that pristine DNA does not have. These features were important to successfully realize potential applications in the context of dynamic DNA assemblies, drug delivery and DNA detection. With a great advancement already existing in DNA functionalization techniques, we are seeking easier and more applicable ways as supplements to current ones and exploiting new applications out of it. This thesis focuses on new properties and potential applications of hydrophobically functionalized DNA. The first Chapter briefly introduced the development of hydrophobic modification of DNA, including chemical coupling and physical complexation. Their self-assembly properties and applications were highlighted. Despite the many examples that have been listed, new exciting discoveries in DNA functionalization are awaiting to be exploited.
Dodec-1-yne chain-modified DNA (lipid-DNA) was one of the DNA amphiphiles that were developed in our group and found vast applications. In Chapter 2 a new class of lipidated aptmer based functional structure were used for the catalytic oxidation of dopamine to aminochrome, which expanded the application of lipid-DNA. Lipidated hemin/G-quadruplex (hGQ) units and the lipidated dopamine binding aptamer (DBA) units were first synthesized and assembled into micellar
23
different ratio of lipid-DNA were measured. Subsequently, the catalytic functions of the micelles toward the H2O2-mediated oxidation of dopamine to
aminochrome were evaluated. Besides, a fully synthetic lipidated catechol oxidase-mimicking dinuclear Cu(II)–BPMP complex was also synthesized and employed to explored the possibility of substituting the lipidated hemin/GQ catalytic sites in the micelles.
In the following chapter, lipid-DNA was tested in the context of ophthalmic drug delivery. Nowadays, low efficiency of topical drug delivery formulations is an acknowledged problem in ophthalmology. To address this challenge, in Chapter 3, we introduced lipidated aptamers (lApts) nanoparticles (NP) as a new class of vehicles for ophthalmic drug delivery. The generality of this approach was demonstrated employing three aptamers selected for the ophthalmic therapeutics: travoprost, brimonidin and kanamycin B. In aqueous solution the synthesized lApts formed nanosized micelles with a hydrophobic core and a hydrophilic aptamer corona. The loading capacity of aptameric corona of the NP and the effect of the lipid modification on aptamer ligand binding characteristic were tested. Subsequently, the cornea binding properties and toxicity of the lApts were evaluated ex vivo and in
vivo. Finally, the efficacy of lApt NPs in antibiotic delivery to animal tissue is
investigated.
Externally regulated biomacromolecules are now considered as particularly attractive tools in nanoscience and the design of smart materials, due to their highly programmable nature and complex functionality. Incorporation of photoswitches into biomolecules, such as peptides, antibiotics and nucleic acids, has generated exciting results in the past few years. Molecular motors offer the potential for new and more precise methods of photoregulation due to their multistate switching cycle, unidirectionality of rotation, and helicity inversion during the rotational steps. In
Chapter 4, we designed and synthesized a photoswitchable DNA hairpin, in which
a molecular motor serves as the bridgehead unit. With the photoswitchable bridgehead in place, hairpin formation was checked and photochemical properties of the motor part in this advanced biohybrid system were evaluated. Rotation of the motor generates large changes in structure, and as a consequence the duplex stability of the oligonucleotide could be regulated by UV light irradiation. The results presented herein establish molecular motors as powerful multistate switches for application in biological environments.
In Chapter 5 hydrophobic modification of DNA was extended to physical complexation with positively charged surfactants. A new class of DNA-surfactant
24
based organogels by simply mixing DNA with cationic surfactants and subsequent immersion in organic phases. It was found that these organogels showed excellent absorbability of organic solvents. POM and SAXS tests demonstrated a liquid crystalline state of these organogels. Additionally, mechanical properties, processability and self-healing property of these organogels were evaluated. Upon with the introduction of iron oxide nanoparticles, the liquid crystal phase of DNA-surfactant organogels were not compromised but a magnetic response to the organogels was endowed. Hence, with these properties, DNA-surfactant LC organogels may expand the application of organogels to new potential applications.
25
References
1. J. H. Chen and N. C. Seeman, Nature, 1991, 350, 631–633.
2. A. Chworos, I. Severcan, A. Y. Koyfman, P. Weinkam, E. Oroudjev, H. G. H. L. Jaeger, Science, 2004, 306, 2068-2072.
3. S. H. Park, C. Pistol, S. J. Ahn, J. H. Reif, A. R. Lebeck, C. Dwyer, T. H. LaBean, Angew. Chem. Int. Ed., 2006, 45, 735-739.
4. P. W. K. Rothemund, Nature, 2006, 440, 297-302. 5. B. Wei, M. Dai, P. Yin, Nature, 2012, 485, 623–626. 6. N. C. Seeman, Nature, 2003, 421, 427-431.
7. R. P. Goodman, A. J. Turberfield, Chem. Commun., 2004, 12, 1372-1373.
8. R. P. Goodman, I. A. T. Schaap, C. F. Tardin, C. M. Erben, R. M. Berry, C. F. Schmidt, A. J. Turberfield, Science, 2005, 310, 1661-1665.
9. W. M. Shih, J. D. Quispe, G. F. Joyce, Nature, 2004, 427, 618-621.
10. D. Bhatia, S. Mehtab, R. Krishnan, S.S. Indi, A. Basu, Y. Krishnan, Angew. Chem. Int. Ed., 2009,
48, 4134–4137.
11. Y. He, T. Ye, M. Su, C. Zhang, A. E. Ribbe, W. Jiang, C. D. Mao. Nature, 2008, 452, 198–201. 12. Y. Ke, L. L. Ong, W. M. Shih, P. Yin, Science, 2012, 338, 1177-1183.
13. S. M. Douglas, H. Dietz, T. Liedl, B. Högberg, F. Graf, W. M. Shih, Nature, 2009, 459, 414– 418.
14. H. Dietz, S. M. Douglas, W. M. Shih, Science, 2009, 325, 725–730. 15. D. Han, S. Pal, J. Nangreave, Z. Deng, Y. Liu, Science, 2011, 332, 342–346. 16. H. Gu, J. Chao, S. J. Xiao, N. C. Seeman, Nature, 2010, 465, 202-205.
17. X. Liu, Y. Xu, T. Yu, C. Clifford, Y. Liu, H. Yan, Y. Chang, Nano Lett., 2012, 12, 4254–4259. 18. M. Chang, C. S. Yang, D. M. Huang, ACS Nano., 2011, 5, 6156–6163.
19. Y. Ke, S. Lindsay, Y. Chang, Y. Liu, H. Yan, Science, 2008, 319, 180–183. 20. C. Mao, W. Sun, Z. Shen, N. C. Seeman, Nature, 1999, 397, 144-146.
21. B. Yurke, A. J. Turberfield, A. P. Mills Jr., F. C. Simmel, J. L. Neumann, Nature., 2000, 406, 605–608.
22. K. A. Joseph, N. Dave, J. Liu, ACS Appl. Mater. Interfaces, 2011, 3, 733-739.
23. B. Soontornworajit, J. Zhou, Z. Zhang, Y. Wang, Biomacromolecules, 2010, 11, 2724-2730. 24. S. Lilienthal, Z. Shpilt, F. Wang, R. Orbach, I. Willner, ACS Appl. Mater. Interfaces, 2015, 7, 8923-8931.
26
26. M. Kwak, A. Herrmann, Angew. Chem. Int. Ed., 2010, 49, 8574-8587. 27. F. E. Alemdaroglu, A. Herrmann, Org. Biomol. Chem., 2007, 5, 1311–1320. 28. M. Kwak, A. Herrmann, Chem. Soc. Rev., 2011, 40, 5745-5755.
29. D. A. Giljohann, D. S. Seferos, W. L. Daniel, M. D. Massich, P. C. Patel, C. A. Mirkin, Angew. Chem. Int. Ed., 2010, 49, 3280-3294.
30. J. S. Lee, A. K. R. Lytton-Jean, S. J. Hurst, C. A. Mirkin, Nano Lett., 2007, 7, 2112–2115. 31. J. I. Cutler, D. Zheng, X. Xu, D. A. Giljohann, C. A. Mirkin, Nano Lett., 2010, 10, 1477–1480. 32. J. O. Rädler, I. Koltover, T. Salditt, C. R. Safinya, Science, 1997, 275, 810-814.
33. K. K. Ewert, H. M. Evans, A. Zidovska, N. F. Bouxsein, A. Ahmad, C. R. Safinya, J. Am. Chem. Soc., 2006, 128, 3998–4006.
34. J. J. Storhoff, R. Elghanian, R. C. Mucic, C. A. Mirkin, R. L. Letsinger, J. Am. Chem. Soc., 1998,
120, 1959–1964.
35. J. Dobson, Gene Ther., 2006, 13, 283–287.
36. F. E. Alemdaroglu, K. Ding, R. Berger, A. Herrmann, Angew. Chem. Int. Ed., 2006, 45, 4206– 4210.
37. M. Kwak, J. Gao, D. K. Prusty, A. J. Musser, V. A. Markov, N. Tombros, M. C. A. Stuart, W. R. Browne, E. J. Boekema, G. ten Brinke, H. T. Jonkman, B. J. van Wees, M. A. Loi, A. Herrmann, Angew. Chem. Int. Ed., 2011, 50, 3206–3210.
38. M. Ganguli, K. N. Jayachandran, S. Maiti, J. Am. Chem. Soc., 2004, 26, 26-27.
39. N. J. Caplen, E. W. Alton, P. G. Middleton, J. R. Dorin, B. J. Stevenson, X. Gao, S. R. Durham, P. K. Jeffery, M. E. Hodson, C. Coutelle, et al, Nat. Med., 1995, 1, 39-46.
40. K. Liu, D. Chen, A. Marcozzi, L. Zheng, J. Su, D. Pesce, W. Zajaczkowski, A. Kolbe, W. Pisula, K. Müllen, N. A. Clark, A. Herrmann, Proc. Natl. Acad. Sci. U. S. A., 2014, 111, 18596-18600. 41. K. Liu, J. Varghese, J. Z. Gerasimov, A. O. Polyakov, M. Shuai, J. Su, D. Chen, W. Zajaczkowski, M. Marcozzi, W. Pisula, B. Noheda, T. T. M. Palstra, N. A. Clark, A. Herrmann, Nat. Commun., 2016, 7, 11467.
42. A. M. Michelson, A. R. Todd, J. Chem. Soc., 1955, 0, 2632–2638. 43. M. H. Caruthers, Science, 1985, 230, 281–285.
44. M. D. Matteucci, M. H. Caruthers, J. Am. Chem. Soc., 1981, 103, 3185–3191. 45. S. L. Beaucage, M. H. Caruthers, Tetrahedron Lett., 1981, 22, 1859–1862. 46. E. Defrancq, Y. Singh, N. Spinelli, Curr. Org. Chem., 2008, 12, 263–290.
47. H. Liu, Z. Zhu, H. Kang, Y. Wu, K. Sefan, W. Tan, Chem. Eur. J., 2010, 16, 3791–3797. 48. H. Liu, Z. Zhu, H. Kang, Y. Wu, K. Sefan, W. Tan, Chem. Eur. J., 2010, 16, 3791–3797. 49. F. Alemdaroglu, K. Ding, R. Berger, A. Herrmann, Angew. Chem., Int. Ed., 2006, 45, 4206– 4210.
50. M. Kwak, J. Gao, D. K. Prusty, A. J. Musser, V. A. Markov, N. Tombros, M. C. A. Stuart, W. R. Browne, E. J. Boekema, G. ten Brinke, H. T. Jonkman, B. J. van Wees, M. A. Loi, A. Herrmann, Angew. Chem., Int. Ed., 2011, 50, 3206–3210.
27
56, 2740 –2743.52. S. H. Weisbrod, A. Marx, Chem. Commun., 2008, 5675-5685.
53. K. Liu, L. Zheng, Q. Liu, J. W. de Vries, J. Y. Gerasimov, A. Herrmann, J. Am. Chem. Soc., 2014,
40,14255-14262.
54. S. Zhou, B. Chu, Adv. Mater., 2000, 12, 545-556.
55. M. Rosa, R. Dias, M. D. G. Miguel, B. Lindman, Biomacromolecules, 2005, 6, 2164-2171. 56. D. Langevin, Adv. Colloid Interface Sci., 2009, 147-148, 170-177.
57. I. Koltover, T. Salditt, J. O. Rädler, C. R. Safinya, Science, 1998, 281, 78-81.
58. K. K. Ewert, H. M. Evans, A. Zidovska, N. F. Bouxsein, A. Ahmad, C. R. Safinya, J. Am. Chem. Soc., 2006, 128, 3998-4006.
59. F. E. Alemdaroglu, C. N. Alemdaroglu, P. Langguth, A. Herrmann, Adv. Mater., 2008, 20, 899–902.
60. M. Kwak, A. J. Musser, J. Lee, A. Herrmann, Chem. Commun., 2010, 46, 4935–4937. 61. S. Gajria, T. Neumann, M. Tirrell, WIREs Nanomed. Nanobiotechnol., 2011, 3, 479-500. 62. T. Neumann, S. Gajria, N. F. Bouxsein, L. Jaeger, M. Tirrell, J. Am. Chem. Soc., 2010, 132, 7025-7037.
63. A. Bodley, L. F. Liu, M. Israel, R. Seshadri, Y. Koseki, F. C. Giuliani, S. Kirschenbaum, R. Silber, M. Potmesil, Cancer Res., 1989, 49, 5969-5978.
64. T. Fukushima, M. Kawaguchi T., Hayakawa, S. Takeda, Y. Inoue, J. Ohno, K. Taniguchi, Dent. Mater. J., 2007, 26, 854-860.
65. D. G. Margineanu, Arch. Int. Physiol. Biochim., 1987, 95, 381-422.
66. J. Liu, X. Jiang, C. Ashley, C. J. Brinker, J. Am. Chem. Soc., 2009, 131, 7567-7569.
67. S. F. M. van Dongen, H.-P. M. de Hoog, R. J. R. W. Peters, M. Nallani, R. J. M. Nolte, J. C. M. van Hest, Chem. Rev., 2009, 109, 6212–6274.
68. J. Voskuhl, B. J. Ravoo, Chem. Soc. Rev., 2009, 38, 495–505.
69. A. Rodriguez-Pulido, A. Kondrachuk, D. K. Prusty, J. Gao, M. Loi, A. Herrmann, Angew. Chem. Int. Ed., 2013, 52, 1008-1012.
70. M. Anaya, M. Kwak, A. J. Musser, K. Müllen, A. Herrmann, Chem. Eur. J., 2010, 16, 12852-12859.
71. Z. Meng, J. Yang, Q. Liu, J. W. de Vries, A. Gruszka, A. Rodrίguez-Pulido, B. Crielaard, A. Kros, A. Herrmann, Chem. Eur. J., 2017, doi: 10.1002/chem.201701379.
72. M. Loew, L. Kang, L. Daehne, R. Hendus-Altenburger, O. Kaczmarek, J. Liebscher, D. Huster, K. Ludwig, C. Boettcher, A. Herrmann, A. Arbuzova, Small, 2009, 5, 320–323.
73. U. Jakobsen, A. C. Simonsen, S. Vogel, J. Am. Chem. Soc., 2008, 130, 10462–10463. 74. C. Wolfrum, S. Shi, K. N. Jayaprakash, M. Jayaraman, G. Wang, R. K. Pandey, K. G. Rajeev, T. Nakayama, K. Charrise, E. M. Ndungo, T. Zimmermann, V. Koteliansky, M. Manoharan, M. Stoffel, Nat. Biotechnol., 2007, 25, 1149–1157.
28
75. K. Ding, F. E. Alemdaroglu, M. Boersch, R. Berger, A. Herrmann, Angew. Chem. Int. Ed., 2007,
46, 1172–1175.
76. M.P. Chien, A. M. Rush, M. P. Thompson, N. C. Gianneschi, Angew. Chem., Int. Ed., 2010, 49, 5076–5080.
77. C. K. McLaughlin, G. D. Hamblin, K. D. Hanni, J. W. Conway, M. K. Nayak, K. M. Carneiro, H. S. Bazzi, H. F. Sleiman, J. Am. Chem. Soc., 2012, 1344, 4280–4286.
78. K. J. Watson, S. -J. Park , J. –H. Im, S. T. Nguyen, C. A. Mirkin. J. Am. Chem. Soc., 2001, 123, 5592–5593.
79. J. M. Gibbs, S. J. Park, D. R. Anderson, K. J. Watson, C. A. Mirkin, S. T. Nguyen, J. Am. Chem. Soc., 2005, 127, 1170-1178.
80. T. Mori, M. Maeda, Polym. J., 2002, 34, 624-628.
81. C. Minard-Basquin, C. Chaix, C. Pichot, B. Mandrand, Bioconjugate Chem., 2000, 11, 795-804.
82. C. Minard-Basquin, C. Chaix, F. D’Agosto, M. T. Charreyre, C. Pichot, J. Appl. Polym. Sci., 2004,
Chapter 2
Supramolecular Micelle-Based
Nucleoapzymes for the Catalytic
Oxidation of Dopamine to Aminochrome
Parts of this chapter have been published: Albada HB, de Vries JW, Liu Q, Golub E, Klement N, Herrmann A, Willner I, Chem. Commun., 2016, 52: 5561-5564.
30
2.1 Introduction
Catalytically active nucleic acids (DNAzymes) represent a novel class of bio-inspired catalysts that have attracted substantial research interest in recent years.1 Different
applications of DNAzymes were reported, and these included their use as amplifying labels for sensing platforms,2, 3 functional units for triggering DNA devices,4 triggers
for programmed synthesis,5 functional components for logic gates and computing
circuits,6 catalysts for driving chemical transformations,7 and catalytic units for the
controlled release of loads (e.g. drugs from nano-carriers).8 One of the most studied
DNAzymes is the hemin/G-quadruplex (hGQ), a horseradish peroxidase (HRP)-mimicking DNAzyme.9 Similar to HRP, the hGQ DNAzyme catalyzes the H2O2
-mediated oxidation of organic substrates and the formation of chromophoric10 or
fluorescent11 products, or the generation of chemiluminescence in the presence of
luminol and H2O2.12
Also, the hGQ DNAzyme induces a variety of oxidation processes, such as the oxidation of phenols, thiols, NADH, or aniline.13-16 Furthermore, the hGQ catalyzed
the growth of nanoparticles17 and was found to control the aggregation of Au
nanoparticles.18 The catalytic functions of the hemin/G-quadruplex were
extensively applied to develop amplified optical and electrochemical sensing platforms,19 to synthesize conducting polymers20 and assemble supramolecular
DNA switches and machines.21
Furthermore, continuous efforts are directed to improve the catalytic functions of peroxidase-mimicking DNAzymes. For example, hemin/isoguanine pentaplexes were reported22 as new peroxidase-mimicking DNAzymes. These DNAzymes show,
however, lower activities than native peroxidase and lack substrate selectivity. Recently, it was reported that the functions of the hGQ DNAzyme can be significantly enhanced by the conjugation of the hGQ to an aptamer that binds the substrate being oxidized by the hGQ catalytic site.23 The DNAzyme–aptamer conjugate was termed
“nucleoapzyme”, and its improved catalytic properties were attributed to the concentration of the substrate, by means of the aptamer, in spatial proximity to the catalytic site. That is, the nucleoapzyme conjugates act as enzyme-mimicking structures. Specifically, the effective oxidation of dopamine and N-hydroxy-L-arginine by H2O2 to aminochrome and L-citrulline, respectively, using
hGQ/anti-dopamine or hGQ/anti-L-arginine aptamer nucleoapzyme structures was demonstrated. Furthermore, it was shown that by a rational design of hGQ–aptamer conjugates, structural rigidification could be realized, resulting in nucleoapzymes with improved catalytic functions.24 It was realized, however, that other methods to
31
were intrigued by the possibility of using micelles formed by lipidated oligonucleotide sequences as functional nucleoapzyme catalytic nanostructures.25
That is, the integration of lipidated catalytic oligonucleotides and lipidated aptamers into micellar structures is anticipated to yield functional structures, where the substrate is concentrated in spatial proximity to the active sites, thus leading to enhanced catalytic functions of the supramolecular aggregate. Furthermore, dissociation of the micellar aggregate by means of surfactants allows us to inhibit the catalytic functions of the system. In the present study, we demonstrate the assembly of micellar nanostructures consisting of the lipidated hemin/G-quadruplex (hGQ) units and the lipidated dopamine binding aptamer (DBA) units. We reveal enhanced catalytic functions of the micellar aggregate toward the H2O2
-mediated oxidation of dopamine to aminochrome, as compared to the separated lipidated hGQ and DBA units. Also, we demonstrate that the hGQ DNAzyme catalytic units in the micellar structures can be substituted with an artificial catechol oxidase-mimicking lipidated dinuclear Cu(II)-complex that leads to the catalyzed H2O2
32
2.2 Result and Discussion
Figure. 2.1. Schematic depictions of: (A) the lipidated G-quadruplexes (1) and (2), and
(B) the tetra-lipidated dopamine binding aptamer (DBA) sequence (3). The five residues that form the dopamine binding pocket are highlighted by the colored circles; these are replaced with thymine residues in the mutated sequence, lipoDBAm (4). (C) Schematic
depiction of the DNAzyme/DBA–aptamer micelle structures composed of hemin/2lipoGQ
(1) and lipoDBA (3). (D) Schematic depiction of the hemin/4lipoGQ (2) and lipoDBA (3).
The H2O2-mediated micellar nucleoapzyme-catalyzed oxidation of dopamine (1) to
aminochrome (2) and the structure of hemin are also depicted in panel C.
To assemble the desired catalytic nucleoapzyme micellar nanostructures, we prepared various lipidated DNAzyme sequences. Specifically, we synthesized two versions of lipidated G-quadruplexes, i.e. di- and tetra-lipidated G-quadruplexes (2lipoGQ, 1, and 4lipoGQ, 2, respectively, Figure 2.1A). We also prepared a lipidated dopamine binding aptamer, DBA, sequence that contained four lapidated 2’-deoxyuridines in the linker-region of the aptamer (lipoDBA, 3, Figure 2.1B). In order to assess the effect of the five residues that were previously determined to form the dopamine binding site,26 we prepared a mutated version of lipoDBA (3) in which
these bases were substituted with thymines, resulting in the formation of lipoDBAm (4). All lipidated DNAs were prepared by previously described procedures,27
33
purified by HPLC, and characterized by MALDI-TOF mass spectrometry (Figure 2.6-2.8).
Figure. 2.2. CMC determination of the lipoDNA mixtures.
The critical micelle concentrations, CMCs, for the different lipidated G-quadruplex-functionalized DNAzymes and lipidated DBA aptamer were evaluated using 1,6-diphenyl-1,3,5-hexatriene (DPH) as a fluorescent probe.28 The CMC values for the isolated components 1, 2, or 3, as well as for various ratios of the two components, i.e. 1 and 3, and 2 and 3 (Figure 2.1C and D for a schematic depiction) were evaluated. We find that the CMC values correspond to 8–9 μM for the isolated components (2lipoGQ, 1, 4lipoGQ, 2, and lipoDBA, 3), as well as for various
combinations of 1 and 3, or 2 and 3 (Figure 2.2). We note that the CMC values were not significantly affected by the number of lipids attached to the G-quadruplex sequences: both the di- and tetra-lipidated G-quadruplex structures, and their mixture with the tetra-lipidated DBA sequence, revealed similar CMC-values of 8–9 μM. Accordingly, we applied a concentration that corresponded to 10μM of the various micelle constituents in our subsequent dopamine oxidation studies so that the lipidated components were retained in the micellar structures.
34
Figure. 2.3. (A and B) Saturation curves for the various ratios of 2lipoGQ (1) (A) or
4lipoGQ (2) (B) with lipoDBA (3). Ratios of hemin/lipoGQ (1, for A) or (2, for B) : lipoDBA
present in the different systems: (a) 20%:80%, (b) 40%:60%, (c) 60%:40%, and (d) 80%: 20%.
Figure 2.3A depicts the rates of oxidation of dopamine (5) to aminochrome (6) at different concentrations of dopamine by micelles composed of hemin/2lipoGQ (1)
and lipoDBA (3) at variable ratios of components (1) and (3). One may realize that the maximum efficiency is observed at a (1) : (3) ratio corresponding to 40% : 60%. The maximum saturation rate of this system corresponds to Vmax = 62±7 nM s-1.
Figure 2.3B shows the rates of oxidation at different concentrations of dopamine, using variable ratios of hemin/4lipoGQ (2) and lipoDBA (3) as constituents of the
micellar structures. We also observe, in this case, a maximum rate for the oxidation of (5) to (6) at a (2) : (3) ratio that corresponds to 40% : 60%, yet with a lower Vmax = 38±5 nM s-1 value. Here we note that the concentration of hemin introduced
G-35
quadruplexes. This ensured that thse catalytic oxidation rates originate from the hemin/G-quadruplex catalytic units in the respective structures. Evidently, as the relative concentrations of (1) to (3) or (2) to (3) increase up to 40% : 60%, the rates of oxidation of (5) to (6) are enhanced. A further increase of the content of (1) or (2) beyond this ratio results in a decrease in the rates of oxidation of (5) to (6) by the DNAzyme/aptamer micelles.
Table 2.1. Kinetic parameters of the various dopamine oxidizing micelles having
different ratios of 2lipoGQ (1) or 4lipoGQ (2) and lipoDBA (3)
Entry Ratio lipoGQ : lipoDBA
Vmax
nM s
-1 kcat (10-3 s-1) KM (μM) 1 2lipoGQ (1) 2:8 19.8 ± 0.1 13.4 5.9 ± 0.4 2 4:6 61.9 ± 6.8 20.9 24.2 ± 12.3 3 6:4 56.7 ± 8.3 12.8 64.2 ± 30.5 4 8:2 52.8 ± 10.5 8.9 35.0 ± 10.5 5 4lipoGQ (2) 2:8 17.9 ± 1.6 12.1 22.1 ± 9.4 6 4:6 38.4 ± 5.1 13.0 47.6 ± 22.7 7 6:4 30.7 ± 5.3 6.9 64.1 ± 35.9 8 8:2 32.5 ± 5.3 5.5 78.7 ± 38.6Conditions: 20, 40, 80, 150, 250, and 500 μM dopamine (5), 1 mM H2O2. The micelles were
composed of 10 μM lipoDNA, which contain 2, 4, 6, or 8 μM lipoGQ, either 2lipoGQ (1) or
4lipoGQ (2), which formed 1.48, 2.96, 4.44, or 5.92 μM catalytically active hGQ units
(equals [catalyst]). Buffer: 5 mM MES, pH = 5.5, 200 mM KCl, 2 mM MgCl2. Note: kcat =
Vmax/[catalyst].
The detailed catalytic parameters corresponding to the kinetic curves of the two micellar systems shown in Figure 2.3A and B are summarized in Table 2.1. Evidently, the Vmax values in the two systems increase up to a ratio of 4 : 6 of (1) : (3) or (2) :
(3), and then at higher contents of (1) or (2) the rates decrease. That is, even though the content of the catalytic sites increases, the overall catalytic oxidation rate of (5) to (6) is retarded. This is reflected by a substantial drop in the kcat value of
the systems that contain increased contents of (1) or (2) beyond the ratio of 4 : 6. We attribute the maximum catalytic performance of the micellar structures at this ratio to the optimal concentration of the dopamine substrate, using the aptamer units, close to the catalytic sites present in the micelles. Furthermore, the fact that the maximum rates for the oxidation of (5) to (6) are observed at a ratio, where the aptamer concentration in the micelles slightly exceeds the concentration of the hemin/G-quadruplex units implies that binding of the substrate and release of the product from the DBA sites are the rate-limiting steps in the oxidation process. Also,
36
we note that the oxidation of (5) to (6) by the hemin/2lipoGQ (1) is ca. 2-fold more
efficient than in the hemin/4lipoGQ (2) containing system (particularly visible at
a 4 : 6 ratio). Presumably, the hemin/2lipoGQ unit is more flexible in the micellar
structure, allowing the positioning of the catalytic center in a favored spatial organization with respect to the dopamine binding site of the aptamer, leading to enhanced catalytic functions of these micelles.
Figure. 2.4. Corrected rate of oxidation of 500 μM dopamine (5) to aminochrome (6) in
the presence of nucleoapzyme micelle systems composed of different ratios 2lipoGQ (1)
and lipoDBA (3) (open circles, curve a). When 0.1% of triton X-100 was added, the corrected rates dropped significantly, up to 3.8-fold (closed circles, curve b).
In further experiments, we evaluated the catalytic functions of the lipidated hemin/G-quadruplex and lipidated DBA micelles at a high concentration of dopamine, i.e. 500 μM at which saturation of the dopamine binding sites occurred (see Figure 2.3), and compared the catalytic efficiencies to the separated non-micellar constituents. Figure 2.4, curve a, shows the Vcorr values of the micelles
containing hemin/2lipoGQ (1) and lipoDBA (3) at different ratios (Vcorr
corresponds to Vmax values that were corrected for the increase in activity caused
by the increasing percentage of hemin/lipoGQ in the micelles, see Figure 2.9). Clearly, the rate of oxidation of (5) to (6) reaches an optimal value at a ratio of 4 : 6. Similar results were observed for the hemin/4lipoGQ (2) and lipoDBA (3)
micelles (see Figure 2.9). Treatment of all micellar compositions with 0.1% triton X-100 separated the components and led to similar inefficient rates for the oxidation of (5) to (6) (Figure 2.4, curve b). Furthermore, integration of the lipidated mutated
37
DBA sequence, lipoDBAm (4), which has reduced affinity for the dopamine substrate, into the micellar structure that includes any of the lipidated hemin/G-quadruplexes, (1) or (2), yielded catalytic rates similar to those observed for the surfactant-induced separated components (Figure 2.9). These results highlight the significance of the DBA units in concentrating the substrate in spatial proximity to the active site within the micellar structure to yield the most active oxidation catalyst.
Furthermore, we explored the possibility of substituting the lipidated hemin/GQ catalytic sites in the micelles with a fully synthetic lipidated catechol oxidase-mimicking dinuclear Cu(II)–BPMP complex (BPMP = 2,6-bis[(bis(2-pyridylmethyl)amino)-methyl]-4-carboxylmethylphenol).29 The dinuclear Cu2+–
BPMP complex was covalently anchored to 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine to yield the lipidated lipo-BPMP (Cu)2 complex, (7) (Figure
2.5A). In order to compare the activity of this complex with that of the hGQ DNAzyme, we applied a ratio of (7) : (3) that corresponds to 40%: 60%. Figure 2.5B, curve (a), depicts the time-dependent absorbance changes at λ = 480 nm observed upon the H2O2-mediated oxidation of 500 μM dopamine (5) to (6) by the catalytic micelles. The rate of oxidation for this system corresponds to 15.4 ± 0.4 nM s-1.
Figure 2.5B, curve (b), depicts the rate of oxidation of (5) to (6) by H2O2 in the
presence of micelles of the same constituents but now treated with 0.1% triton X-100, leading to the separation of the micellar components and a drop in the rate to 6.2 ± 0.3 nM s-1. Furthermore, micelles composed of only lipo-BPMPCu2, i.e. which
lack the dopamine binding site, displayed a rate of 7.8 ± 0.5 nM s-1 (Figurre 2.5(B),
curve c), whereas micelles composed of only lipoDBA (3) in the presence of 10 μM non-complexed Cu(II) displayed a rate of 4.1 ± 0.8 nM s-1 (Figure 2.5B, curve d). We
note, however, that the rate of oxidation of dopamine (5) to aminochrome (6) by the (7)/(3) micelles is substantially lower compared to that of the hemin/2lipoGQ (1)/(3) micelles (15.4 ± 0.4 nM s-1 vs. 57 ± 6 nM s-1, respectively).
Nevertheless, the results demonstrate the successful catalytic oxidation of dopamine by micelles composed of the catechol oxidase-mimicking catalyst (7) and the dopamine binding aptamer, DBA.
38
Figure. 2.5. (A) Structural formula of the lipidated catechol oxidase-mimicking
dinuclear Cu(II)–BPMP complex (7). (B) Schematic depiction of the catalytic oxidation of dopamine to aminochrome by means of micelles composed of 60% lipoDBA (3) and 40%
lipo-BPMPCu2 (7). The curves show the time dependent formation of aminochrome by
various systems (50 mM HEPES, pH = 7.0, 200 mM KCl, 2 mM MgCl2, see the text for
further details).
2.3 Conclusion
The present study has introduced a novel approach to construct organized nucleoapzyme nanostructures consisting of micelles composed of lipidated hemin/GQ or lipidated dinuclear Cu2+-complexes as catalytic units and the lipidated
dopamine binding aptamer. The association between the substrate and aptamer with the catalytic micelles led to the concentration of the substrate at a close spatial position with respect to the catalytic sites, resulting in enhanced oxidation of the substrate. We observe, however, only moderate catalytic enhancement for the oxidation processes. This may originate from non-optimal positioning of the catalytic site with respect to the substrate–ligand site and/or due to the flexibilities of the micellar structures. By further optimization of the lengths of the lipidated chains, and eventually by rigidification of the micelles by crosslinking, the catalytic performance of the micellar nucleoapzymes could be improved.
39
2.4
Experimental Section
2.4.1 Materials
All chemicals and reagents were purchased from commercial suppliers and were used without further purification, unless otherwise noted. The tetrakis(triphenylphosiphine)palladium(0), 1-dodecyne, copper(I) iodide, and diisopropylamine were purchased from Sigma-Aldrich and used as received; 5’-DMT-5-iodo deoxy uridine was obtained from Chemgenes. All lipidated oligonucleotides (ODNs) were synthesized using standard automated solid-phase phosphoramidite coupling methods on an ÄKTA Oligopilot Plus (GE Healthcare) DNA synthesizer. All solvents and reagents for oligonucleotide synthesis were purchased from Novabiochem (Merck, UK) and SAFC (Sigma-Aldrich, Netherlands). Solid supports (Primer SupportTM, 40 μmol/g) from GE Healthcare were used for the synthesis of DNA. The oligonucleotides were characterized by MALDI-TOF mass spectrometry using a 3-hydroxypicolinic acid matrix. Spectra were recorded on an ABI Voyager DE-PRO MALDI TOF (delayed extraction reflector) Biospectrometry Workstation mass spectrometer. The concentrations of the DNA were measured on a SpectraMax M2 spectrophotometer (Molecular Devices, USA) using 1 cm light-path quartz cuvette. Fluorescently labeled and unmodified oligonucleotides were purchased from Biomers.net in HPLC purification grade. 1H-NMR and 31P-NMR spectra were recorded on a Varian Mercury (400 MHz) NMR spectrometer at 25 °C. High-resolution mass spectra (HRMS) were recorded on an AEI MS-902 (EI+) instrument. Column chromatography was performed using silica gel 60 Å (200–400 Mesh).
2.4.2 Sequences
The following sequences were prepared manually, using a C12-lipid modified
2’-deoxyuridine (T*) residue as lipid anchor. In the lipoGQ sequences, the lipidated nucleotides were separated from the G-quadruplex by means of a spacer consisting of two thymine (T) units. The sequences were purified using RPC HPLC (column: Jupiter C4, 5 µm column, 4.6 × 250 mm, Phenomenex. Gradient: 0–75% in 30 min from buffer A to B; buffer A: 100 mM Et3NH•OAc (pH 7.5) in ultrapure water and 5%
MeCN, buffer B: 100% iso-propanol). Bis-lipidated PS2.M (2lipoGQ, 1):
40
5’-T*T*TTGGGTAGGGCGGGTTGGG Tetra-lipidated PS2.M (4lipoGQ, 2):
5’-T*T*TTGGGTAGGGCGGGTTGGGTTT*T* Tetra-lipidated native DBA (lipoDBA, 3):
5’-GTCTCTGTGTGCGCCAGAGACACTGT*T*T*T*CAGATATGGGCCAGCACAG AATGAGGCCC
Tetra-lipidated mutated DBA (lipoDBAm, 4):
5’-GTCTCTGTGTGCTTCAGAGACACTGT*T*T*T*CAGATATGGGCCTGCACAG AATTTGGCCC
2.4.3 Synthesis and characterization of the lipoDNA sequences
Figure. 2.6. Synthesis of 5-(dode-1-cynyl) uracil phosphoramidite (T*).
Figure. 2.7. MALDI-TOF spectra of: (a) lipoDBA (3) (calc. 18444 g/mol), and (b)
lipoDBAm (4) (calc. 18391 g/mol). 16000 18000 20000 22000 Mass (m/z)
a
16000 18000 20000 22000 Mass (m/z)b
41
Figure. 2.8. RP-HPLC chromatograms of: (a) lipoDBA (3), and (b) lipoDBAm (4). A linear
gradient to 100 %B in 62.5 mL was used. Numbers beside the elution peaks represent the buffer B contents when lipidated nucleotides were eluted.
The modified 5-(dodec-1-ynyl) uracilphosphoramidite 3 was synthesized in two steps as previously reported in our group starting from 1 (Figure 2.6).The modified uracil phosphoramidite was dissolved in CH3CN to adjust the concentration to 0.15
M, in the presence of 3 Å molecular sieves. The prepared solution was directly connected to the DNA synthesizer. All oligonucleotides were synthesized in 10 μmol scale on a DNA synthesizer using standard β-cyanoethylphosphoramidite coupling chemistry. Deprotection and cleavage from the PS support was carried out by incubation in concentrated aqueous ammonium hydroxide solution overnight at 60 °C. Following deprotection, the oligonucleotides were purified by reverse-phase chromatography, using a C15 RESOURCE RPCTM 1 mL reverse phase column (GE
Healthcare) through a custom gradient elution (A: 100 Mm triethylammonium acetate (TEAAc) and 2.5% acetonitrile, B: 100 mMTEAAc and 65% acetonitrile). Fractions were desalted using centrifugal dialysis membranes (MWCO 3000, Sartorius Stedim). Oligonucleotide concentrations were determined by UV absorbance using extinction coefficients. Finally, the identity and purity of the oligonucleotides were confirmed by MALDI-TOF mass spectrometry and analytical anion exchange chromatography using a linear gradient elution, respectively (Figure 2.7 and 2.8).
42
2.4.4 Critical micelle concentration (CMC) determination
From a 1 µM solution of 1, 6-diphenyl-1, 3, 5-hexatriene (DPH) in acetone, 10 µL (10 pmol) was placed in a black 96-well plate. The solvent was allowed to evaporate overnight. Meanwhile, the solutions containing various ratios of 2lipoGQ or 4lipoGQ
and lipoDBA were prepared. The following ratios of GQ and DBA were used: 25 : 75, 50 : 50, 75 : 25 (%, n/n), with the following concentrations: 0.25, 0.5, 1, 2, 4, 8, 16, 32 µM. The solutions containing these ratios and concentrations of lipoDNA were thermally cycled (90 oC, 30 min, –1 oC/2 min until RT) to ensure proper micellization,
and 100 µL of each of the solutions was added to different wells containing dried DPH. The plate was incubated overnight, and the fluorescence spectra (375–500 nm, λex = 350 nm) were recorded in a microtiterplate reader (monochromator). The
fluorescence maximum is plotted for each mixture and concentration; from this plot, another plot is prepared containing the concentration and fluorescence intensity at 425 nm. The concentration of lipoDNA at the intersection of the low fluorescence region with the high fluorescence region corresponds to the CMC. For all systems, a CMC of approximately 8 µM was found; this was not significantly affected by the different ratios of GQ and DBA. Therefore, all catalytic studies were performed using 10 µM of lipoDNA mixtures.
43
2.4.5 Oxidation of dopamine (1) to aminochrome (2) by means of lipoDNA
micelles
Figure. 2.9. Rate of oxidation of dopamine to aminochrome in the presence of
nucleoapzyme micelles that were composed of different ratios of lipoGQ and lipoDBA. The green points show the rates obtained for the micelles that contained the native aptamer, i.e. lipoDBA (3); the red points correspond to the rates obtained for the micelles that contained the mutated aptamer, i.e. lipoDBAm (4).
Micelles with the appropriate ratios of the two different lipidated DNA sequences were prepared as follows. Stock solutions of lipoDNA (100 µM) were prepared in the MES buffer (pH 5.5, 200 mM KCl, 2 mM MgCl2). From these stock solutions, a
44
total of 10 µL of lipoDNA from the two stock solutions was added to 69 µL of the buffer; the total amount of lipoDNA was composed of the lipoGQ and lipoDBA sequences in order to reach the desired ratios. The resulting solution with 12.7 µM lipoDNA was annealed as described above. Then, 1 µL of a solution of hemin in DMSO was added (stock concentrations: 200, 400, 600, 800 µM for the experiments of Figure 2.3, and 100, 200, 300, 400, 500, 600, 700, 800, 900 µM or 1 mM for the experiments of Figure 2.4), formation of the hGQ unit was allowed to proceed for 1 hr. Correct formation of the hGQ DNAzyme unit was inferred from the presence of the Soret-band at 405 nm. Saturation kinetic curves were determined using micelles composed of lipoGQ : lipoDBA = 2 : 8, 4 : 6, 6 : 4, and 8 : 2 (%, n/n). For this, to the solution of hemin/lipoDNA (80 µL, 12.7 µM) was added dopamine (10 µL of dopamine stock solutions: 0.2, 0.4, 0.8, 1.5, 2.5, 5 mM). For determination of the optimal ratio of lipoGQ and lipoDBA, 10 µL of dopamine (5 mM) was added. After this, H2O2 (10 µL from a stock-solution with a concentration of H2O2 of 10 mM) was
added, and formation of aminochrome (2) was determined by measuring the absorbance each well at 480 nm (values were corrected for baseline drifting by subtracting the absorbance at 800 nm; pathlength corrections were applied). For determination of the optimal ratio of lipoGQ and lipoDBA, the rates were determined at the saturation point, i.e. with 500 µM dopamine (1).
Author Contribution
In this chapter, H. Bauke Albada and Itamar Willner designed the catalytic micelle system consisting of lipidated apamers. H. Bauke Albada carried out the kinetic measurements to monitor the catalytic oxidization of dopamine to aminochrome. Qing Liu performed the synthesis of the phosphoramidite building block of lipidated 2’-deoxyuridine and the synthesis, purification and characterization of lipidated aptmer oligonucleotides. Moreover, Qing Liu determined the critical micelle concentrations. Jan Willem de Vries and Niels Klement supported the DNA synthesis and purification.
