• No results found

University of Groningen Applications of DNA hybrids in biobased medicine and materials Liu, Qing

N/A
N/A
Protected

Academic year: 2021

Share "University of Groningen Applications of DNA hybrids in biobased medicine and materials Liu, Qing"

Copied!
19
0
0

Bezig met laden.... (Bekijk nu de volledige tekst)

Hele tekst

(1)

Applications of DNA hybrids in biobased medicine and materials

Liu, Qing

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below.

Document Version

Publisher's PDF, also known as Version of record

Publication date: 2018

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA):

Liu, Q. (2018). Applications of DNA hybrids in biobased medicine and materials. University of Groningen.

Copyright

Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

Take-down policy

If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum.

(2)

Chapter 2

Supramolecular Micelle-Based

Nucleoapzymes for the Catalytic

Oxidation of Dopamine to Aminochrome

Parts of this chapter have been published: Albada HB, de Vries JW, Liu Q, Golub E, Klement N, Herrmann A, Willner I, Chem. Commun., 2016, 52: 5561-5564.

(3)

30

2.1 Introduction

Catalytically active nucleic acids (DNAzymes) represent a novel class of bio-inspired catalysts that have attracted substantial research interest in recent years.1 Different applications of DNAzymes were reported, and these included their use as amplifying labels for sensing platforms,2, 3 functional units for triggering DNA devices,4 triggers for programmed synthesis,5 functional components for logic gates and computing circuits,6 catalysts for driving chemical transformations,7 and catalytic units for the controlled release of loads (e.g. drugs from nano-carriers).8 One of the most studied DNAzymes is the hemin/G-quadruplex (hGQ), a horseradish peroxidase (HRP)-mimicking DNAzyme.9 Similar to HRP, the hGQ DNAzyme catalyzes the H2O2 -mediated oxidation of organic substrates and the formation of chromophoric10 or fluorescent11 products, or the generation of chemiluminescence in the presence of luminol and H2O2.12

Also, the hGQ DNAzyme induces a variety of oxidation processes, such as the oxidation of phenols, thiols, NADH, or aniline.13-16 Furthermore, the hGQ catalyzed the growth of nanoparticles17 and was found to control the aggregation of Au nanoparticles.18 The catalytic functions of the hemin/G-quadruplex were extensively applied to develop amplified optical and electrochemical sensing platforms,19 to synthesize conducting polymers20 and assemble supramolecular DNA switches and machines.21

Furthermore, continuous efforts are directed to improve the catalytic functions of peroxidase-mimicking DNAzymes. For example, hemin/isoguanine pentaplexes were reported22 as new peroxidase-mimicking DNAzymes. These DNAzymes show, however, lower activities than native peroxidase and lack substrate selectivity. Recently, it was reported that the functions of the hGQ DNAzyme can be significantly enhanced by the conjugation of the hGQ to an aptamer that binds the substrate being oxidized by the hGQ catalytic site.23 The DNAzyme–aptamer conjugate was termed “nucleoapzyme”, and its improved catalytic properties were attributed to the concentration of the substrate, by means of the aptamer, in spatial proximity to the catalytic site. That is, the nucleoapzyme conjugates act as enzyme-mimicking structures. Specifically, the effective oxidation of dopamine and N-hydroxy-L-arginine by H2O2 to aminochrome and L-citrulline, respectively, using hGQ/anti-dopamine or hGQ/anti-L-arginine aptamer nucleoapzyme structures was demonstrated. Furthermore, it was shown that by a rational design of hGQ–aptamer conjugates, structural rigidification could be realized, resulting in nucleoapzymes with improved catalytic functions.24 It was realized, however, that other methods to assemble functional nucleoapzyme structures may be envisaged. Specifically, we

(4)

31

were intrigued by the possibility of using micelles formed by lipidated oligonucleotide sequences as functional nucleoapzyme catalytic nanostructures.25 That is, the integration of lipidated catalytic oligonucleotides and lipidated aptamers into micellar structures is anticipated to yield functional structures, where the substrate is concentrated in spatial proximity to the active sites, thus leading to enhanced catalytic functions of the supramolecular aggregate. Furthermore, dissociation of the micellar aggregate by means of surfactants allows us to inhibit the catalytic functions of the system. In the present study, we demonstrate the assembly of micellar nanostructures consisting of the lipidated hemin/G-quadruplex (hGQ) units and the lipidated dopamine binding aptamer (DBA) units. We reveal enhanced catalytic functions of the micellar aggregate toward the H2O2 -mediated oxidation of dopamine to aminochrome, as compared to the separated lipidated hGQ and DBA units. Also, we demonstrate that the hGQ DNAzyme catalytic units in the micellar structures can be substituted with an artificial catechol oxidase-mimicking lipidated dinuclear Cu(II)-complex that leads to the catalyzed H2O2 -mediated oxidation of dopamine to aminochrome.

(5)

32

2.2 Result and Discussion

Figure. 2.1. Schematic depictions of: (A) the lipidated G-quadruplexes (1) and (2), and

(B) the tetra-lipidated dopamine binding aptamer (DBA) sequence (3). The five residues that form the dopamine binding pocket are highlighted by the colored circles; these are replaced with thymine residues in the mutated sequence, lipoDBAm (4). (C) Schematic depiction of the DNAzyme/DBA–aptamer micelle structures composed of hemin/2lipoGQ

(1) and lipoDBA (3). (D) Schematic depiction of the hemin/4lipoGQ (2) and lipoDBA (3).

The H2O2-mediated micellar nucleoapzyme-catalyzed oxidation of dopamine (1) to

aminochrome (2) and the structure of hemin are also depicted in panel C.

To assemble the desired catalytic nucleoapzyme micellar nanostructures, we prepared various lipidated DNAzyme sequences. Specifically, we synthesized two versions of lipidated G-quadruplexes, i.e. di- and tetra-lipidated G-quadruplexes (2lipoGQ, 1, and 4lipoGQ, 2, respectively, Figure 2.1A). We also prepared a lipidated dopamine binding aptamer, DBA, sequence that contained four lapidated 2’-deoxyuridines in the linker-region of the aptamer (lipoDBA, 3, Figure 2.1B). In order to assess the effect of the five residues that were previously determined to form the dopamine binding site,26 we prepared a mutated version of lipoDBA (3) in which these bases were substituted with thymines, resulting in the formation of lipoDBAm (4). All lipidated DNAs were prepared by previously described procedures,27

(6)

33

purified by HPLC, and characterized by MALDI-TOF mass spectrometry (Figure 2.6-2.8).

Figure. 2.2. CMC determination of the lipoDNA mixtures.

The critical micelle concentrations, CMCs, for the different lipidated G-quadruplex-functionalized DNAzymes and lipidated DBA aptamer were evaluated using 1,6-diphenyl-1,3,5-hexatriene (DPH) as a fluorescent probe.28 The CMC values for the isolated components 1, 2, or 3, as well as for various ratios of the two components, i.e. 1 and 3, and 2 and 3 (Figure 2.1C and D for a schematic depiction) were evaluated. We find that the CMC values correspond to 8–9 μM for the isolated components (2lipoGQ, 1, 4lipoGQ, 2, and lipoDBA, 3), as well as for various combinations of 1 and 3, or 2 and 3 (Figure 2.2). We note that the CMC values were not significantly affected by the number of lipids attached to the G-quadruplex sequences: both the di- and tetra-lipidated G-quadruplex structures, and their mixture with the tetra-lipidated DBA sequence, revealed similar CMC-values of 8–9 μM. Accordingly, we applied a concentration that corresponded to 10μM of the various micelle constituents in our subsequent dopamine oxidation studies so that the lipidated components were retained in the micellar structures.

(7)

34

Figure. 2.3. (A and B) Saturation curves for the various ratios of 2lipoGQ (1) (A) or 4lipoGQ (2) (B) with lipoDBA (3). Ratios of hemin/lipoGQ (1, for A) or (2, for B) : lipoDBA

present in the different systems: (a) 20%:80%, (b) 40%:60%, (c) 60%:40%, and (d) 80%: 20%.

Figure 2.3A depicts the rates of oxidation of dopamine (5) to aminochrome (6) at different concentrations of dopamine by micelles composed of hemin/2lipoGQ (1) and lipoDBA (3) at variable ratios of components (1) and (3). One may realize that the maximum efficiency is observed at a (1) : (3) ratio corresponding to 40% : 60%. The maximum saturation rate of this system corresponds to Vmax = 62±7 nM s-1. Figure 2.3B shows the rates of oxidation at different concentrations of dopamine, using variable ratios of hemin/4lipoGQ (2) and lipoDBA (3) as constituents of the micellar structures. We also observe, in this case, a maximum rate for the oxidation of (5) to (6) at a (2) : (3) ratio that corresponds to 40% : 60%, yet with a lower Vmax = 38±5 nM s-1 value. Here we note that the concentration of hemin introduced into different systems was equimolar to the concentration of the lipidated

(8)

G-35

quadruplexes. This ensured that thse catalytic oxidation rates originate from the hemin/G-quadruplex catalytic units in the respective structures. Evidently, as the relative concentrations of (1) to (3) or (2) to (3) increase up to 40% : 60%, the rates of oxidation of (5) to (6) are enhanced. A further increase of the content of (1) or (2) beyond this ratio results in a decrease in the rates of oxidation of (5) to (6) by the DNAzyme/aptamer micelles.

Table 2.1. Kinetic parameters of the various dopamine oxidizing micelles having

different ratios of 2lipoGQ (1) or 4lipoGQ (2) and lipoDBA (3)

Entry Ratio lipoGQ : lipoDBA

Vmax

nM s

-1 kcat (10-3 s-1) KM (μM) 1 2lipoGQ (1) 2:8 19.8 ± 0.1 13.4 5.9 ± 0.4 2 4:6 61.9 ± 6.8 20.9 24.2 ± 12.3 3 6:4 56.7 ± 8.3 12.8 64.2 ± 30.5 4 8:2 52.8 ± 10.5 8.9 35.0 ± 10.5 5 4lipoGQ (2) 2:8 17.9 ± 1.6 12.1 22.1 ± 9.4 6 4:6 38.4 ± 5.1 13.0 47.6 ± 22.7 7 6:4 30.7 ± 5.3 6.9 64.1 ± 35.9 8 8:2 32.5 ± 5.3 5.5 78.7 ± 38.6

Conditions: 20, 40, 80, 150, 250, and 500 μM dopamine (5), 1 mM H2O2. The micelles were

composed of 10 μM lipoDNA, which contain 2, 4, 6, or 8 μM lipoGQ, either 2lipoGQ (1) or 4lipoGQ (2), which formed 1.48, 2.96, 4.44, or 5.92 μM catalytically active hGQ units

(equals [catalyst]). Buffer: 5 mM MES, pH = 5.5, 200 mM KCl, 2 mM MgCl2. Note: kcat =

Vmax/[catalyst].

The detailed catalytic parameters corresponding to the kinetic curves of the two micellar systems shown in Figure 2.3A and B are summarized in Table 2.1. Evidently, the Vmax values in the two systems increase up to a ratio of 4 : 6 of (1) : (3) or (2) : (3), and then at higher contents of (1) or (2) the rates decrease. That is, even though the content of the catalytic sites increases, the overall catalytic oxidation rate of (5) to (6) is retarded. This is reflected by a substantial drop in the kcat value of the systems that contain increased contents of (1) or (2) beyond the ratio of 4 : 6. We attribute the maximum catalytic performance of the micellar structures at this ratio to the optimal concentration of the dopamine substrate, using the aptamer units, close to the catalytic sites present in the micelles. Furthermore, the fact that the maximum rates for the oxidation of (5) to (6) are observed at a ratio, where the aptamer concentration in the micelles slightly exceeds the concentration of the hemin/G-quadruplex units implies that binding of the substrate and release of the product from the DBA sites are the rate-limiting steps in the oxidation process. Also,

(9)

36

we note that the oxidation of (5) to (6) by the hemin/2lipoGQ (1) is ca. 2-fold more efficient than in the hemin/4lipoGQ (2) containing system (particularly visible at a 4 : 6 ratio). Presumably, the hemin/2lipoGQ unit is more flexible in the micellar structure, allowing the positioning of the catalytic center in a favored spatial organization with respect to the dopamine binding site of the aptamer, leading to enhanced catalytic functions of these micelles.

Figure. 2.4. Corrected rate of oxidation of 500 μM dopamine (5) to aminochrome (6) in

the presence of nucleoapzyme micelle systems composed of different ratios 2lipoGQ (1)

and lipoDBA (3) (open circles, curve a). When 0.1% of triton X-100 was added, the corrected rates dropped significantly, up to 3.8-fold (closed circles, curve b).

In further experiments, we evaluated the catalytic functions of the lipidated hemin/G-quadruplex and lipidated DBA micelles at a high concentration of dopamine, i.e. 500 μM at which saturation of the dopamine binding sites occurred (see Figure 2.3), and compared the catalytic efficiencies to the separated non-micellar constituents. Figure 2.4, curve a, shows the Vcorr values of the micelles containing hemin/2lipoGQ (1) and lipoDBA (3) at different ratios (Vcorr corresponds to Vmax values that were corrected for the increase in activity caused by the increasing percentage of hemin/lipoGQ in the micelles, see Figure 2.9). Clearly, the rate of oxidation of (5) to (6) reaches an optimal value at a ratio of 4 : 6. Similar results were observed for the hemin/4lipoGQ (2) and lipoDBA (3) micelles (see Figure 2.9). Treatment of all micellar compositions with 0.1% triton X-100 separated the components and led to similar inefficient rates for the oxidation of (5) to (6) (Figure 2.4, curve b). Furthermore, integration of the lipidated mutated

(10)

37

DBA sequence, lipoDBAm (4), which has reduced affinity for the dopamine substrate, into the micellar structure that includes any of the lipidated hemin/G-quadruplexes, (1) or (2), yielded catalytic rates similar to those observed for the surfactant-induced separated components (Figure 2.9). These results highlight the significance of the DBA units in concentrating the substrate in spatial proximity to the active site within the micellar structure to yield the most active oxidation catalyst.

Furthermore, we explored the possibility of substituting the lipidated hemin/GQ catalytic sites in the micelles with a fully synthetic lipidated catechol oxidase-mimicking dinuclear Cu(II)–BPMP complex (BPMP = 2,6-bis[(bis(2-pyridylmethyl)amino)-methyl]-4-carboxylmethylphenol).29 The dinuclear Cu2+– BPMP complex was covalently anchored to 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine to yield the lipidated lipo-BPMP (Cu)2 complex, (7) (Figure 2.5A). In order to compare the activity of this complex with that of the hGQ DNAzyme, we applied a ratio of (7) : (3) that corresponds to 40%: 60%. Figure 2.5B, curve (a), depicts the time-dependent absorbance changes at λ = 480 nm observed upon the H2O2-mediated oxidation of 500 μM dopamine (5) to (6) by the catalytic micelles. The rate of oxidation for this system corresponds to 15.4 ± 0.4 nM s-1. Figure 2.5B, curve (b), depicts the rate of oxidation of (5) to (6) by H2O2 in the presence of micelles of the same constituents but now treated with 0.1% triton X-100, leading to the separation of the micellar components and a drop in the rate to 6.2 ± 0.3 nM s-1. Furthermore, micelles composed of only lipo-BPMPCu2, i.e. which lack the dopamine binding site, displayed a rate of 7.8 ± 0.5 nM s-1 (Figurre 2.5(B), curve c), whereas micelles composed of only lipoDBA (3) in the presence of 10 μM non-complexed Cu(II) displayed a rate of 4.1 ± 0.8 nM s-1 (Figure 2.5B, curve d). We note, however, that the rate of oxidation of dopamine (5) to aminochrome (6) by the (7)/(3) micelles is substantially lower compared to that of the hemin/2lipoGQ (1)/(3) micelles (15.4 ± 0.4 nM s-1 vs. 57 ± 6 nM s-1, respectively). Nevertheless, the results demonstrate the successful catalytic oxidation of dopamine by micelles composed of the catechol oxidase-mimicking catalyst (7) and the dopamine binding aptamer, DBA.

(11)

38

Figure. 2.5. (A) Structural formula of the lipidated catechol oxidase-mimicking

dinuclear Cu(II)–BPMP complex (7). (B) Schematic depiction of the catalytic oxidation of dopamine to aminochrome by means of micelles composed of 60% lipoDBA (3) and 40% lipo-BPMPCu2 (7). The curves show the time dependent formation of aminochrome by

various systems (50 mM HEPES, pH = 7.0, 200 mM KCl, 2 mM MgCl2, see the text for

further details).

2.3 Conclusion

The present study has introduced a novel approach to construct organized nucleoapzyme nanostructures consisting of micelles composed of lipidated hemin/GQ or lipidated dinuclear Cu2+-complexes as catalytic units and the lipidated dopamine binding aptamer. The association between the substrate and aptamer with the catalytic micelles led to the concentration of the substrate at a close spatial position with respect to the catalytic sites, resulting in enhanced oxidation of the substrate. We observe, however, only moderate catalytic enhancement for the oxidation processes. This may originate from non-optimal positioning of the catalytic site with respect to the substrate–ligand site and/or due to the flexibilities of the micellar structures. By further optimization of the lengths of the lipidated chains, and eventually by rigidification of the micelles by crosslinking, the catalytic performance of the micellar nucleoapzymes could be improved.

(12)

39

2.4

Experimental Section

2.4.1 Materials

All chemicals and reagents were purchased from commercial suppliers and were used without further purification, unless otherwise noted. The tetrakis(triphenylphosiphine)palladium(0), 1-dodecyne, copper(I) iodide, and diisopropylamine were purchased from Sigma-Aldrich and used as received; 5’-DMT-5-iodo deoxy uridine was obtained from Chemgenes. All lipidated oligonucleotides (ODNs) were synthesized using standard automated solid-phase phosphoramidite coupling methods on an ÄKTA Oligopilot Plus (GE Healthcare) DNA synthesizer. All solvents and reagents for oligonucleotide synthesis were purchased from Novabiochem (Merck, UK) and SAFC (Sigma-Aldrich, Netherlands). Solid supports (Primer SupportTM, 40 μmol/g) from GE Healthcare were used for the synthesis of DNA. The oligonucleotides were characterized by MALDI-TOF mass spectrometry using a 3-hydroxypicolinic acid matrix. Spectra were recorded on an ABI Voyager DE-PRO MALDI TOF (delayed extraction reflector) Biospectrometry Workstation mass spectrometer. The concentrations of the DNA were measured on a SpectraMax M2 spectrophotometer (Molecular Devices, USA) using 1 cm light-path quartz cuvette. Fluorescently labeled and unmodified oligonucleotides were purchased from Biomers.net in HPLC purification grade. 1H-NMR and 31P-NMR spectra were recorded on a Varian Mercury (400 MHz) NMR spectrometer at 25 °C. High-resolution mass spectra (HRMS) were recorded on an AEI MS-902 (EI+) instrument. Column chromatography was performed using silica gel 60 Å (200–400 Mesh).

2.4.2 Sequences

The following sequences were prepared manually, using a C12-lipid modified 2’-deoxyuridine (T*) residue as lipid anchor. In the lipoGQ sequences, the lipidated nucleotides were separated from the G-quadruplex by means of a spacer consisting of two thymine (T) units. The sequences were purified using RPC HPLC (column: Jupiter C4, 5 µm column, 4.6 × 250 mm, Phenomenex. Gradient: 0–75% in 30 min from buffer A to B; buffer A: 100 mM Et3NH•OAc (pH 7.5) in ultrapure water and 5% MeCN, buffer B: 100% iso-propanol).

(13)

40

5’-T*T*TTGGGTAGGGCGGGTTGGG Tetra-lipidated PS2.M (4lipoGQ, 2):

5’-T*T*TTGGGTAGGGCGGGTTGGGTTT*T* Tetra-lipidated native DBA (lipoDBA, 3):

5’-GTCTCTGTGTGCGCCAGAGACACTGT*T*T*T*CAGATATGGGCCAGCACAG AATGAGGCCC

Tetra-lipidated mutated DBA (lipoDBAm, 4):

5’-GTCTCTGTGTGCTTCAGAGACACTGT*T*T*T*CAGATATGGGCCTGCACAG AATTTGGCCC

2.4.3 Synthesis and characterization of the lipoDNA sequences

Figure. 2.6. Synthesis of 5-(dode-1-cynyl) uracil phosphoramidite (T*).

Figure. 2.7. MALDI-TOF spectra of: (a) lipoDBA (3) (calc. 18444 g/mol), and (b)

lipoDBAm (4) (calc. 18391 g/mol).

16000 18000 20000 22000 Mass (m/z)

a

16000 18000 20000 22000 Mass (m/z)

b

(14)

41

Figure. 2.8. RP-HPLC chromatograms of: (a) lipoDBA (3), and (b) lipoDBAm (4). A linear

gradient to 100 %B in 62.5 mL was used. Numbers beside the elution peaks represent the buffer B contents when lipidated nucleotides were eluted.

The modified 5-(dodec-1-ynyl) uracilphosphoramidite 3 was synthesized in two steps as previously reported in our group starting from 1 (Figure 2.6).The modified uracil phosphoramidite was dissolved in CH3CN to adjust the concentration to 0.15

M, in the presence of 3 Å molecular sieves. The prepared solution was directly connected to the DNA synthesizer. All oligonucleotides were synthesized in 10 μmol scale on a DNA synthesizer using standard β-cyanoethylphosphoramidite coupling chemistry. Deprotection and cleavage from the PS support was carried out by incubation in concentrated aqueous ammonium hydroxide solution overnight at 60 °C. Following deprotection, the oligonucleotides were purified by reverse-phase chromatography, using a C15 RESOURCE RPCTM 1 mL reverse phase column (GE Healthcare) through a custom gradient elution (A: 100 Mm triethylammonium acetate (TEAAc) and 2.5% acetonitrile, B: 100 mMTEAAc and 65% acetonitrile). Fractions were desalted using centrifugal dialysis membranes (MWCO 3000, Sartorius Stedim). Oligonucleotide concentrations were determined by UV absorbance using extinction coefficients. Finally, the identity and purity of the oligonucleotides were confirmed by MALDI-TOF mass spectrometry and analytical anion exchange chromatography using a linear gradient elution, respectively (Figure 2.7 and 2.8).

(15)

42

2.4.4 Critical micelle concentration (CMC) determination

From a 1 µM solution of 1, 6-diphenyl-1, 3, 5-hexatriene (DPH) in acetone, 10 µL (10 pmol) was placed in a black 96-well plate. The solvent was allowed to evaporate overnight. Meanwhile, the solutions containing various ratios of 2lipoGQ or 4lipoGQ and lipoDBA were prepared. The following ratios of GQ and DBA were used: 25 : 75, 50 : 50, 75 : 25 (%, n/n), with the following concentrations: 0.25, 0.5, 1, 2, 4, 8, 16, 32 µM. The solutions containing these ratios and concentrations of lipoDNA were thermally cycled (90 oC, 30 min, –1 oC/2 min until RT) to ensure proper micellization, and 100 µL of each of the solutions was added to different wells containing dried DPH. The plate was incubated overnight, and the fluorescence spectra (375–500 nm, λex = 350 nm) were recorded in a microtiterplate reader (monochromator). The fluorescence maximum is plotted for each mixture and concentration; from this plot, another plot is prepared containing the concentration and fluorescence intensity at 425 nm. The concentration of lipoDNA at the intersection of the low fluorescence region with the high fluorescence region corresponds to the CMC. For all systems, a CMC of approximately 8 µM was found; this was not significantly affected by the different ratios of GQ and DBA. Therefore, all catalytic studies were performed using 10 µM of lipoDNA mixtures.

(16)

43

2.4.5 Oxidation of dopamine (1) to aminochrome (2) by means of lipoDNA

micelles

Figure. 2.9. Rate of oxidation of dopamine to aminochrome in the presence of

nucleoapzyme micelles that were composed of different ratios of lipoGQ and lipoDBA. The green points show the rates obtained for the micelles that contained the native aptamer, i.e. lipoDBA (3); the red points correspond to the rates obtained for the micelles that contained the mutated aptamer, i.e. lipoDBAm (4).

Micelles with the appropriate ratios of the two different lipidated DNA sequences were prepared as follows. Stock solutions of lipoDNA (100 µM) were prepared in the MES buffer (pH 5.5, 200 mM KCl, 2 mM MgCl2). From these stock solutions, a

(17)

44

total of 10 µL of lipoDNA from the two stock solutions was added to 69 µL of the buffer; the total amount of lipoDNA was composed of the lipoGQ and lipoDBA sequences in order to reach the desired ratios. The resulting solution with 12.7 µM lipoDNA was annealed as described above. Then, 1 µL of a solution of hemin in DMSO was added (stock concentrations: 200, 400, 600, 800 µM for the experiments of Figure 2.3, and 100, 200, 300, 400, 500, 600, 700, 800, 900 µM or 1 mM for the experiments of Figure 2.4), formation of the hGQ unit was allowed to proceed for 1 hr. Correct formation of the hGQ DNAzyme unit was inferred from the presence of the Soret-band at 405 nm. Saturation kinetic curves were determined using micelles composed of lipoGQ : lipoDBA = 2 : 8, 4 : 6, 6 : 4, and 8 : 2 (%, n/n). For this, to the solution of hemin/lipoDNA (80 µL, 12.7 µM) was added dopamine (10 µL of dopamine stock solutions: 0.2, 0.4, 0.8, 1.5, 2.5, 5 mM). For determination of the optimal ratio of lipoGQ and lipoDBA, 10 µL of dopamine (5 mM) was added. After this, H2O2 (10 µL from a stock-solution with a concentration of H2O2 of 10 mM) was added, and formation of aminochrome (2) was determined by measuring the absorbance each well at 480 nm (values were corrected for baseline drifting by subtracting the absorbance at 800 nm; pathlength corrections were applied). For determination of the optimal ratio of lipoGQ and lipoDBA, the rates were determined at the saturation point, i.e. with 500 µM dopamine (1).

Author Contribution

In this chapter, H. Bauke Albada and Itamar Willner designed the catalytic micelle system consisting of lipidated apamers. H. Bauke Albada carried out the kinetic measurements to monitor the catalytic oxidization of dopamine to aminochrome. Qing Liu performed the synthesis of the phosphoramidite building block of lipidated 2’-deoxyuridine and the synthesis, purification and characterization of lipidated aptmer oligonucleotides. Moreover, Qing Liu determined the critical micelle concentrations. Jan Willem de Vries and Niels Klement supported the DNA synthesis and purification.

(18)

45

Reference

1. (a) M. Famulok, J. S. Hartig and G. Mayer, Chem. Rev., 2007, 107, 3715; (b) G. F. Joyce,

Annu. Rev. Biochem., 2004, 73, 791; (c) G. F. Joyce, Angew. Chem., Int. Ed., 2007, 46, 6420.

2. F. Wang, C. H. Lu and I. Willner, Chem. Rev., 2014, 114, 2881.

3. (a) D. Sen and L. C. Poon, Crit. Rev. Biochem. Mol. Biol., 2011, 46, 478; (b) Z. Cheglakov, Y. Weizmann, B. Basnar and I. Willner, Org. Biomol. Chem., 2007, 5, 223; (c) F. Wang, J. Elbaz, R. Orbach, N. Magen and I. Willner, J. Am. Chem. Soc., 2011, 133, 17149; (d) Y. Tian, Y. He and C. Mao, ChemBioChem, 2006, 7, 1862.

4. (a) Y. Tian, T. He, Y. Chen, P. Yin and C. Mao, Angew. Chem., Int. Ed., 2005, 44, 4355; (b) S. Shimron, J. Elbaz, A. Henning and I. Willner, Chem. Commun., 2010, 46, 3250; (c) J. Elbaz, S. Shimron and I. Willner, Chem. Commun., 2010, 46, 1209.

5. D. Balogh, M. A. Aleman-Garcia, H. B. Albada and I. Willner, Angew. Chem., Int. Ed., 2015, 54, 11652.

6. (a) M. N. Stojanovic, Prog. Nucleic Acid Res. Mol. Biol., 2008, 82, 199; (b) R. Orbach, B. Willner and I. Willner, Chem. Commun., 2015, 51, 4144.

7. (a) A. J. Boersma, R. P. Megens, B. L. Feringa and G. Roelfes, Chem. Soc. Rev., 2010, 39, 2083; (b) M. Wilking and U. Hennecke, Org. Biomol. Chem., 2013, 11, 6940; (c) R. P. Megens and G. Roelfes, Chem. Commun., 2012, 48, 6366; (d) S. Walsh, M. A. Sachdeva and S. K. Silverman, J. Am. Chem. Soc., 2013, 135, 14928.

8. Z. Zhang, D. Balogh, F. Wang and I. Willner, J. Am. Chem. Soc., 2013, 135, 1934. 9. (a) E. Golub, C.-H. Lu and I. Willner, J. Porphyrins Phthalocyanines, 2015, 19, 65; (b) Y. Li, C. R. Geyer and D. Sen, Biochemistry, 1996, 35, 6911; (c) P. Travascio, A. J. Bennet, D. Y. Wang and D. Sen, Chem. Biol., 1999, 6, 779; (d) P. Travascio, P. K. Witting, A. G. Mauk and D. Sen, J. Am. Chem. Soc., 2001, 123, 1337.

10. P. Travascio, A. J. Bennet, D. Y. Wang and D. Sen, Chem. Biol., 1998, 6, 779. 11. S. Nakayama and H. O. Sintim, Mol. BioSyst., 2011, 6, 89.

12. V. Pavlov, Y. Xiao, R. Gill, A. Dishon, M. Kotler and I. Willner, Anal. Chem., 2004, 76, 2152.

13. S. Nakayama and H. O. Sintim, Anal. Chim. Acta, 2012, 747, 1. 14. E. Golub, R. Freeman and I. Willner, Anal. Chem., 2013, 85, 12126. 15. E. Golub, R. Freeman and I. Willner, Angew. Chem., Int. Ed., 2011, 50, 11710. 16. Z. G. Wang, P. Zhan and B. Ding, ACS Nano, 2013, 7, 1591.

17. G. Garai-Ibabe, M. Möller, L. Saa, R. Grinyte and V. Pavlov, Anal. Chem., 2014, 86, 10059. 18. (a) A. Niazov-Elkan, E. Golub, E. Sharon, D. Balogh and I. Willner, Small, 2014, 10, 2883; (b) E. Sharon, E. Golub, A. Niazov-Elkan, D. Balogh and I. Willner, Anal. Chem., 2014, 86, 3153. 19. (a) S. Shimron, F. Wang, R. Orbach and I. Willner, Anal. Chem., 2012, 84, 1042; (b) G. Pelossof, R. Tel-Vered, J. Elbaz and I. Willner, Anal. Chem., 2010, 82, 4396.

(19)

46

20. C.-H. Lu, W. Guo, X.-J. Qi, A. Neubauer and Y. Paltiel, Chem. Sci., 2015, 6, 6659. 21. M. A. Aleman-Garcia, R. Orbach and I. Willner, Chem. – Eur. J., 2014, 20, 5619. 22. N. Shumayrikh, Y. Chuan Huang and D. Sen, Nucleic Acids Res., 2015, 43, 4191.

23. E. Golub, H. B. Albada, W.-C. Liao, Y. Biniuri and I. Willner, J. Am. Chem. Soc., 2016, 138, 164. 24. H. B. Albada, E. Golub and I. Willner, Chem. Sci., 2016, DOI: 10.1039/C5SC04832J. 25. (a) T. Dwars, E. Paetzold and G. Oehme, Angew. Chem., Int. Ed., 2005, 44, 7174; (b) G. Savelli, R. Germani and L. Brinchi, in Reactions and Synthesis in Surfactant Systems, ed. J. Texter, Marcel Dekker, New York, 2001, p. 175, 184.

26. (a) C. Mannironi, A. Di Nardo, P. Fruscoloni and G. P. Tocchini-Valentini, Biochemistry, 1997, 36, 9726; (b) R. Walsh and M. C. DeRosa, Biochem. Biophys. Res. Commun., 2009, 388, 732.

27. (a) M. Anaya, M. Kwak, A. J. Musser, K. Müllen and A. Herrmann, Chem. – Eur. J., 2010, 16, 12852; (b) M. Kwak and A. Herrmann, Chem. Soc. Rev., 2011, 40, 5745; (c) T. Schnitzler and A. Herrmann, Acc. Chem. Res., 2012, 45, 1419.

28. (a) X. Zhang, J. K. Jackson and H. M. Burt, J. Biochem. Biophys. Methods, 1996, 31, 145; (b) A. Chattopadhyay and E. London, Anal. Biochem., 1984, 139, 408.

29. (a) I. A. Koval, P. Gamez, C. Belle, K. Selmeczi and J. Reedijk, Chem. Soc. Rev., 2006, 35, 814; (b) C. Belle, C. Beguin, I. Gautier-Luneau, S. Hamman, C. Philouze, J. L. Pierre, F. Thomas, S. Torelli, E. Saint-Aman and M. Bonin, Inorg. Chem., 2002, 41, 479.

Referenties

GERELATEERDE DOCUMENTEN

This PhD thesis is the result of an effort started 4 years ago and carried out at the "Ceramics and Composites Laboratory", of Materials Science and Engineering

In this PhD thesis the Langmuir-Blodgett (LB) technique was used to form novel low dimensional films based on layered materials, namely graphene and germanane in order

Layer-by-layer assembly is an easy and inexpensive technique for the development of multilayer films. Nevertheless, simplicity and low cost are not the only reasons why

Representative AFM images of hybrid graphene oxide sheets (ODA-GO) deposited on Si-wafer with the LS method (at surface pressure 20 mN m -1 ) during the first dip into the

Bovendien werd gevonden dat het isomerisatieproces van de motor niet gehinderd werd in niet-hybridisatieomstandigheden alsmede niet werkt afgebroken, maar het werd enigszins

Five years ago, I stepped out of the train at Groningen Noord station in a late autumn night and my feelings to the coming doctoral career was like the way I tried to find

We attribute the maximum catalytic performance of the micellar structures at this ratio to the optimal concentration of the dopamine substrate, using the aptamer

Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright