Functions of the C/EBPβ isoforms in breast cancer
Sterken, Britt
DOI:
10.33612/diss.172465560
IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below.
Document Version
Publisher's PDF, also known as Version of record
Publication date: 2021
Link to publication in University of Groningen/UMCG research database
Citation for published version (APA):
Sterken, B. (2021). Functions of the C/EBPβ isoforms in breast cancer. University of Groningen. https://doi.org/10.33612/diss.172465560
Copyright
Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).
Take-down policy
If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.
Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum.
Chapter V
Generation of Cebpba
ΔuORFmice that are deficient in
C/EBPα-p30 expression
Britt A. Sterken1, Christine Müller1, Hidde R. Zuidhof1, J. Hartung1, Gertrud
Kortman1, Bart van de Sluis2, Jan van Deursen3, Cornelis Calkhoven1
1 European Institute for the Biology of Ageing, University Medical Center Groningen, University of
Groningen, Groningen, The Netherlands
2 Center for Liver, Digestive and Metabolic Diseases (CLDM), University Medical Center
Groningen, University of Groningen, Groningen, The Netherlands
Abstract
Upstream open reading frames (uORFs) are known cis-regulatory elements of translational control that are able to influence translation of downstream coding sequences. The transcription factor CCAAT/enhancer binding protein α (C/EBPα) contains a uORF that is required for the translation of the truncated isoform C/EBPα-p30. C/EBPα exerts functions in several biological processes such as proliferation, differentiation and metabolism and has been found to be deregulated in a number of cancers. However, much remains unknown about the isoform-specific functions of C/EBPα. Here, we report the generation of
CebpaΔuORF mice by genetic targeting of the Cebpa-uORF by CRISPR/Cas9 and homology directed repair (HDR) in zygotes. We show that CebpaΔuORF mice have a strongly reduced p30/p42 ratio and are viable. With this model we aim to study the effects of C/EBPα-p30 deficiency on metabolism, haematopoiesis and cancer development in the future.
Introduction
mRNA-translation in eukaryotic cells is regulated on the global and on the gene-specific level. While global mRNA translation follows the activation status of the translation machinery as a whole, gene-specific translational control involves cis-regulatory features in the mRNAs, translation signalling pathways and translation factors. Small upstream open reading frames (uORFs) located in the 5’ leader of mRNAs are known cis-regulatory elements of translational control. One or more uORFs are found in 44% of mouse and 49% of human transcripts 1.
Although their function is not always clear, they may serve as rapid response elements, adapting the translation of the coding sequences to environmental cues. Because eukaryotic ribosomes usually load onto the 5’-cap of mRNAs and scan towards the 3’ direction for initiation sites, uORFs are able to influence the translation of a downstream coding sequence (CDS). Before translation initation, the 40S ribosomal subunit has to bind the ternary complex that consists of eIF2,
methionine loaded initiator tRNA (Met-tRNAiMET) and GTP, thereby forming the
43S pre-initiation complex (43S PIC), which requires additional eIFs , 5, 1 and 1A. In order for the 43S complex to attach to the 5’ cap, eIF4F and eIF4B or eIF4H unwind the mRNA allowing ribosomal attachment and scanning. Availability of the cap binding eIF4E is rate limiting for the assembly of the eIF4F complex and is regulated by the phosphorylation of 4E-BP. The 43S complex then scans from the 5’ to the 3’ direction until it recognises a methionine codon in an appropriate Kozak-context. After codon recognition and 48S formation, eIF2-bound GTP is hydrolysed, the 60S large ribosomal subunit joins in and translation is initiated2,3.
The recognition of uORFs within the mRNA can either allow or inhibit downstream translation initiation at the main coding sequence 4. One example of
uORF-mediated translational control is the key transcriptional activator of amino acid biosynthesis genes, GCN4 in yeast, which is derepressed upon amino-acid deprivation 3. GCN4 contains four uORFs regulating the translation initiation at
the CDS 5. Whereas mutation of the start sites of the uORFs demonstrated all
uORFs to be repressing translation of the coding sequence of GCN4, the 3′ proximal AUG codons proved to be more inhibitory than the 5′ proximal AUG codons. Translation is dependent on the availability of the co-factors required for translation initiation and elongation. The phosphorylation of ternary complex component eIF2α inhibits the formation of the ternary complex that is required to initiate translation. Non-phosphorylated eIF2α under favourable translational conditions in yeast GCN4 allows rapid reloading of ribosomes that translated uORF 1, boosting the translation re-initiation at downstream inhibitory uORFs 2-4, thereby inhibiting translation initiation at the coding sequence of GCN4. Upon starvation conditions, eIF2α is phosphorylated causing leaky scanning over the uORFs 2-4 and an increase of translation re-initiation at the GCN4 initiation codon 6. By a similar mechanism, the phosphorylation of eIF2α
by activation of eIF2α-kinases under stress conditions increases the translation of ATF4, which was the first mammalian example by which eIF2α phosphorylation induces translation of amino acid biosynthesis control genes 7. In addition to the
established roles of uORFs regulating translation initiation of main coding sequences, uORF-mediated translational control has been demonstrated to be a
regulator of alternative isoform generation for the transcription factors the CCAAT/enhancer binding protein (C/EBP) α and β. Deregulated expression of the C/EBPα and C/EBPβ isoforms has been observed in a variety of cancers 8
(reviewed in Chapter II). The translation of the truncated isoforms is controlled by eIF4E and eIF2 activity which is sensed by a uORF on the CEBPBA and
CEBPB-mRNAs 9. C/EBPα and C/EBPβ are single exon genes, and from its
mRNAs three different isoforms are generated through translation initiation at distinct start codons, the extended isoforms (C/EBPα–extended and LAP*), long isoforms (p42 and LAP), and short isoforms (p30 and LIP) respectively. The translation into the extended isoforms C/EBPα–extended and C/EBPβ-LAP* and long isoforms C/EBPα–p42 and C/EBPβ–LAP is regulated via regular translation initiation at the CUG and AUG codons, although the translation initiation at the extended isoform has decreased recognition due to a weak Kozak sequence 9,10.
For translation into the small inhibitory isoforms C/EBPα-p30 and C/EBPβ-LIP recognition and translation of the uORF is required, after which the small ribosomal subunit remains attached and scanning until it reinitiates at the p30 or LIP start codon. All isoforms share a DNA binding domain and leucine zipper (bZIP) domain in the C-terminus, but differ greatly in the transactivation domains in the N-terminus (figure 1). C/EBPα-p30 lacks the 117 amino acids of the N-terminus of C/EBPα-p42 and thereby lacks transactivation domains (TAD1 and TAD2), which mediate the interaction of C/EBPα with TBP and TFIIB, two essential components of the RNA polymerase II basal transcriptional apparatus 11, and the expression of C/EBPα-p30 has been shown to reduce the
p42-transcriptional activity 12. Therefore, the ratio between p30/p42 expression is
essential for the transcriptional function of C/EBPα.
Previously, we have demonstrated that mTORC1 signalling regulates the translation of the C/EBPα and C/EBPβ in a uORF-dependent manner, where it was shown that phosphorylation of 4E binding protein (4E-BP) and consequent release of eIF4E favours translation into the truncated isoform vs long isoforms9,13. Decreasing mTORC1 signalling by mutations, pharmacological
treatment, restricted calorie intake or low protein:carbohydrate macronutrient ratio increases health and lifespan in a number of species 14,15,16,17,18. Moreover, we
showed that genetic ablation of C/EBPβ-LIP by mutation of the uORF results in improvements in metabolic health, increased lifespan and reduced tumour incidence, resembling the phenotype observed in animals upon caloric restriction or mTORC1 inhibition13,19. In addition, we showed that the C/EBPα and C/EBPβ
isoform ratios are affected by RNA-dependent protein kinase (PKR) and eIF2α signalling. PKR affects the translation initiation via the phosphorylation-induced inactivation of eIF2α. Constitutive activation of eIF2α by inhibition of phosphorylation was demonstrated to favour translation into the truncated isoforms 9, probably because the translation-re-initiation mechanism is
particularly sensitive for eIF2α functioning. A balanced expression of the C/EBPα and C/EBPβ isoforms was demonstrated to be important for liver regeneration, myeloid cell fate decisions and the development of leukaemias and lymphomas10,8.
Mice with a selective disruption of the p42 isoform, only expressing the competitive inhibitor p30, develop acute myeloid leukaemia (AML) with complete penetrance 8. Moreover, mutations in the CEBPA gene have been found
in ~15% of all AML patients, which are often found in the bZIP regions, preventing binding of C/EBPα to its target sites, or in the N-terminal regions resulting in ablation of the p42 isoform thereby obtaining selective expression of p30 12,20. C/EBPα-deficient mice die shortly after birth, due to hypoglycaemia and
they show defects in lung and liver development, and a lack of mature neutrophils and eosinophils 21,22,23. Furthermore, reduced levels of C/EBPα have been found
in solid tumours of breast, liver, skin, head and neck, lung, gastric, cervical, endometrial and liposarcoma, which correlated with tumour size and poor prognosis and survival outcomes 24,25,26,27,28,29,30,31,32,33. These findings suggest that
the p42 isoform of C/EBPα is a tumour suppressor. Based on these studies, we created a C/EBPα-translation control mouse model by genetic targeting of the C/EBPα-uORF and consequent ablation of p30 isoform expression. Here, we describe the successful generation of CebpaΔuORF mice. CebpaΔuORF mice are viable, have the same weight as wt mice and as expected show a strong decrease in p30 expression in liver. In the future we aim to use this model to study the isoform-specific effects on metabolism, haematopoiesis and cancer development.
Results
Genetic targeting of the Cebpa-uORF results in successful ablation of C/EBPα-p30
To investigate the importance of uORF-mediated translational control of C/EBPα
in vivo, we introduced a point mutation in the start codon (ATG -> TTG) of the Cebpa-uORF by CRISPR/Cas9 gene targeting and homology directed repair
(HDR) in zygotes of mice from C57BL/6N background (figure 2a). In addition, a BamHI restriction site was introduced for genotyping and a point mutation in the PAM sequence was introduced (figure 2b). To assure production of a functional Extended-C/EBPα isoform, mutations were designed without altering the amino acid sequences of the Extended-C/EBPα isoform (Figure S1). Pronuclear injections with Cas9 and gRNA and single-stranded donor oligonucleotides (ssODN) were performed and embryos were implanted into pseudopregnant mice to generate mosaic mutants. Mosaic mutants were obtained (figure S2) with and without a PAM site mutation, and the line without mutation in the PAM sequence (GGCTCGCCATGCCGG ->GGATCCCCTTGCCGG) were bred for experiments due to less genomic changes. To confirm successful integration of the uORF mutation, mice were genotyped using two different PCRs to discriminate between heterozygous (Cebpa wt/ΔuORF) and homozygous (Cebpa ΔuORF /ΔuORF) animals (figure 2c). Immunoblot analysis revealed normal expression of the p42 isoform but strongly decreased expression of the p30 isoform in Cebpa ΔuORF /ΔuORF mice, demonstrating successful mutation of the uORF and consequent ablation of p30 expression (figure 2d, e). To check whether C/EBPα-p30 depletion might alter C/EBPβ-LIP/LAP expression, C/EBPβ expression was analysed by immunoblotting, showing no alterations in C/EBPβ-LIP/LAP in Cebpa ΔuORF /ΔuORF livers compared to Cebpawt/wt livers (figure S3).
Therefore, phenotypes observed upon p30 ablation are most likely not rescued by C/EBPβ-LIP upregulation.
Figure 1: a) Schematic overview of uORF-mediated translation of the CEBPA-mRNA into multiple protein isoforms. b) Translation initiation at the uORF is required for downstream initiation at p30. UTR (untranslated region), TAD (transactivation domain), BD (Basic Domain) and LZ (Leucine Zipper).
Homozygous C/EBPα-∆uORF mice are viable and reveal no differences in weight at young age
Previous studies showed that Cebpa-/- mice are postnatal lethal due to
hypoglycaemia, with observed defects in lung and liver development, and a lack of mature neutrophils and eosinophils 21–23. To obtain experimental cohorts and
to investigate whether uORF-mediated regulation of C/EBPα-p30 expression is essential for embryogenesis, Heterozygous mice (Cebpawt/ΔuORF) were bred and
a
Figure 2: a) Pronuclear injection strategy to generate mosaic mice containing the desired mutation in the Cebpa uORF (adapted from 34). b) Representation of gRNAs used to target the Cebpa-uORF
and sequence of the ssODN used as repair template with corresponding mutations marked. c) Schematic representation of detection of mutant uORF. Primers detecting the mutation marked as arrows (left) and genotyping of Cebpawt/wt and Cebpa ΔuORF /ΔuORF mice (right). d) Representative
immunoblots for C/EBPα of male and female livers obtained from Cebpawt/wt and Cebpa ΔuORF /ΔuORF
mice. β-actin is used for loading control. e) Corresponding quantifications of immunoblots from figure 2d and an additional immunoblot (not shown) per gender (n=8 for males and females).
a b 5’-TCTCCCGGCATGGCGAGCCT-3’ 5’-GGCCGCCGAGGCTCGCCATGC-3’ Cebpa wt/wt Cebpa wt /Δ uORF Cebpa ΔuO RF /Δ uORF water 565 bp 114 bp 100 b p lad der c d gRNAs Male liver p42 p30 β-actin Female liver e
Cebpawt/wtCebpaΔuORF /ΔuORF
Cebpawt/wt CebpaΔuORF /ΔuORF
358 bp 114 bp
Cebpawt/wt CebpaΔuORF /ΔuORF
p42 p30
Figure 3: Weights of Cebpawt/wt and Cebpa ΔuORF /ΔuORF mice at ages 5.5-6 months (wt n= 4, ∆uORF
n=4), 4-4.5 months (wt n= 4, ∆uORF n=4) and 3 months (wt n= 6, ∆uORF n=6), 2.5-2 months wt (n= 4, ∆uORF n=4) and 4-4.5 months (wt n= 4, ∆uORF n=4). T-test non significant (n.s.).
offspring were closely monitored. Analysis of offspring genotypes revealed a normal distribution in Mendelian ratio (Table 1), indicating no embryonic or postnatal lethality for Cebpawt/ΔuORF and Cebpa ΔuORF/ΔuORF mice. Previous studies illustrated the role of C/EBPα in adipogenesis, carbohydrate and lipid metabolism and proliferation, however, Cebpa ΔuORF/ΔuORF mice displayed normal weight (figure 3) and no apparent developmental defects or premature death.
Discussion
Previous studies have shown the importance of C/EBPα and C/EBPβ in metabolism, tissue homeostasis and ageing. A number of studies show a regulation of lifespan, metabolic health and disease development by the C/EBPα and C/EBPβ isoforms 8,13,19,35. However, so far, the effects of p30 depletion on
health-and lifespan remain unknown. For this study, we successfully generated the CebpaΔuORF model to investigate the importance of uORF-mediated translational control of C/EBPα in vivo and study its effects on metabolism and the development of age-related pathologies.
Previous studies have illustrated the importance of C/EBPs in fertility and embryonic development. One of the phenotypes observed in Cebpb-/- female mice
is reduced fertility due to deficient differentiation of Granulosa cells 36. Whereas
the knockout of Cebpb and Cebpa alone in granulosa cells only reduces fertility, double knockout of Cebpb and Cebpa in granulosa cells renders females infertile37. Cebpa-/- mice die shortly after birth due to hypoglyemia, and show
additional defective postnatal phenotypes such as defects in lung and liver development, a lack of mature neutrophils and eosinophils 21–23. However,
breeding of heterozygous mice (Cebpawt/ΔuORF) reveals successful heterozygous and homozygous offspring generation and regular Mendelian ratios, showing that p30-deficient mice are viable and that the heterozygeous mice are fertile. Previously several mouse models have demonstrated the importance of translational control of the different isoforms of C/EBPβ in vivo. In previous analyses using the CebpbΔuORF mouse model we have demonstrated the importance of the C/EBPβ isoform ratio on health-and lifespan, which resembles the phenotypes observed upon caloric restriction 13,38. We observed enhanced fat
metabolism and decreased adipose tissue mass, increased physical activity and improved glucose clearance and enhanced insulin sensitivity upon depletion of C/EBPβ-LIP in vivo 13. C/EBPα has a key role in the transcription of metabolic
genes. In vivo deficiency of C/EBPα affects gluconeogenesis, glycogen synthesis, altered liver tissue structure, bilirubin clearance, and fat storage in white adipose tissue (WAT) 23,39,40,41,42,43,44. Moreover, C/EBPα and peroxisome
proliferator-activated receptor gamma (PPARγ) are key factors in the differentiation of adipocyte differentiation45,46,47. To test the involvement of the C/EBPα
uORF-mediated translational control in the regulation of energy homeostasis, mice will be subjected to a series of tests to measure insulin sensitivity, glucose tolerance, leptin sensitivity, and energy expenditure and body weight and composition will
be monitored. Preliminary data of the weight of young mice display no significant differences in the accumulation of weight in homozygous CebpaΔuORF mice in cohorts between 2.5-6 months of age, which is similar to what is observed at younger ages in the CebpbΔuORF mice. At older age, there might be gender-based influences since we previously showed larger weight differences between old female CebpbΔuORF mice and Cebpbwt mice compared to differences between male
CebpbΔuORF and Cebpbwt mice.
The expression of the short isoform C/EBPβ-LIP is known to increase upon ageing 48,49,50 , and increased lifespan in the existing CebpbΔuORF model can in part be explained by a later onset of overall tumour development 38. Systemic
mono-or biallelic replacement of the wt Cebpb gene locus with a locus only expressing LIP increases overall tumour incidence in mice and predisposes to development of B non-Hodgkin lymphoma and T-cell lymphomas 35. C/EBPα is a master
regulator of hematopoietic differentiation and regulates the expression of a variety of myeloid genes such as granulocyte colony-stimulating factor, macrophage colony-stimulating factor, granulocyte-macrophage colony stimulating factor and lactoferrin22,51,52,53. Cebpa-/- mice have normal numbers of
Common Myeloid Progenitors (CMPs) but lack Granulocyte and Monocyte Progenitors (GMPs) and subsequent differentiated cell types 54. Moreover, they
show that hematopoietic stem cells (HSCs) isolated from Cebpa-/- mice have
increased stem cell renewal capacity and that the bone marrow of Cebpa-/- mice is
filled with myeloblasts which is also observed frequently in Acute Myeloid Leukemia (AML) patients. Mutations in CEBPA have been reported in approximately 15% of all AML patients 12,20. However, the observed mutations are
often found in the bZIP regions or in the N-terminal regions, the latter specifically abolishing the expression of the p42 isoform while maintaining p30 expression. Moreover, p42-deficient mice develop AML with complete penetrance 8.
Therefore, we speculate that the CebpaΔuORF mice are less prone to develop AML. Our mice are bred in C57BL/6 background that is relatively prone to develop hematopoietic malignancies, which might be decreased upon depleting C/EBPα-p30. Blood and bone marrow analysis of young CebpaΔuORF mice by sorting of the
different stem-, progenitor-, and differentiated lineages will reveal potential deficiencies in stem cell renewal and depletion or in the accumulation of certain subtypes. Moreover, ageing cohorts will be analysed for the development of cancer. In addition to its established role in AML, C/EBPα is known to display decreased expression levels in solid tumours of breast, liver, skin, head and neck, lung, prostate, pancreatic, gastric, bladder, cervical, endometrial cancers and liposarcoma 24,25,26,27,28,29,30,31,32,33. It is known that C/EBPα is downregulated by
hypoxia in mammary epithelial cells 55 and that the expression of C/EBPα is
strongly reduced in high grade breast tumours 25. Moreover, a recent study
demonstrated an essential role for C/EBPα as an epithelial gatekeeper in the mammary epithelium, where re-expression of C/EBPα after TGFβ-induced Epithelial to Mesenchymal Transition (EMT) could revert the cells to an epithelial phenotype 56. Therefore, CebpaΔuORF mice from lifespan cohorts will be analysed for tumour development upon necropsy and histologically analysed. Moreover,
in vivo EdU incorporation assays will be performed in young mice to reveal
potential differences in proliferation within target tissues.
In summary, we have generated a CebpaΔuORF mouse model to genetically ablate the expression of the short isoform C/EBPα-p30 in vivo. In the future, we aim to investigate the importance of uORF-mediated translational control of C/EBPα in
Materials and methods
Mouse modelTwo CebpaΔuORF knock-in mouse lines (one with and one without PAM site mutation) were generated using CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/clustered regularly interspaced short palindromic repeat– associated 9) technology as described previously (figure S2) 57. Mice
carrying the mutation GGCTCGCCATGCCGG ->GGATCCCCTTGCCGG in the uORF start codon were bred and used for experiments. Briefly, female C57BL/6NHsd mice were super ovulated by injection with 5 IU Folligonan (0.2 ml i.p.) and 48 h later with 5 IU Chorulon (0.2 ml i.p.). The next day, zygotes were isolated from the infundibulum and injected with 100 ng/µl Cas9 RNA, 50 ng/µl sgRNA (either 5’-GGCCGCCGAGGCTCGCCATGC-3’ or 5’-TCTCCCGGCATGGCGAGCCT-3’) and 100 nt ssODN (100 ng/µl) repair template (NN-30nt-TGGAGGCCGCCGAGGATCCCCTTGCCGTGAGAACT CTAACT-(30nt)NNN. Injected zygotes were incubated overnight at 37°C under 5% C02 in air and transferred to the infundibulum of pseudopregnant female B6CBAF1/J mice. Off springs were genotyped by sequencing the amplicons amplified with the following primers, sense
5’-AAAGTCACAGGAGAAGGCGG-3’ and 5’- TCGATGTAGGCGCTGATGTC-3’. Mosaic mice carrying the mutations
were subsequently crossed with C57BL/6NHsd and the genotypes were confirmed as described above. In addition, the oligo targeting the Cebpa-uORF was designed to change four base pairs and creating a BamHI site, which was used to validate the genotype of the mice.
Mice
CebpaΔuORF (C57BL/6N) mice were once crossed with wt C57BL/6J mice. Mice were kept in IVC cages for the first 3 postnatal months, and then placed in conventional cages. Mice were kept at standard 12 hr light/dark cycle at 22˚C on a standard mouse diet (V1554-703 Ssniff). For breeding, the mice were fed V1154-703 from Ssniff. Young mice (3-6 month old) were monitored once weekly and weights were reported. Genotyping was performed using the primers
presented in Table 2. For the genotyping reaction, ear clips were digested with proteinase K digestion. For genotyping PCR, the FastStart™ Taq DNA Polymerase (Roche) was used. Reactions were performed at 34 cycles of 30s at 95 °C, 30s at 58 °C, and 1 min at 72 °C. Per reaction the following dilutions were used: 1x PCR buffer + MgCl2, 1x GC enhancer, 0.5 µM primers, 100 µM dNTPs, 1 unit FastStart Taq Roche Polymerase in a 25 µl volume.
Immunoblot analysis
Cells and tissues were lysed using RIPA buffer. Equal amounts of protein were separated via SDS-PAGE and transferred to a methanol activated PVDF membrane using Trans-Blot Turbo System (Bio-rad). The following antibodies were used for detection: C/EBPαD56F10 monoclonal from Cell signaling (1:1000 in TBST + 5% BSA), C/EBPβ (E299) from Abcam (1:1000 in TBST+ 5% milk) and β-actin (clone C4) (#691001) from MP Biomedicals (1:5000 in TBST+ 5% milk). For detection, HRP-conjugated secondary antibodies (Amersham Life Technologies) were used. The signals were visualised by chemiluminescence (ECL, Amersham Life Technologies) using ImageQuant LAS 4000 mini imaging machine (GE Healthcare Bioscience AB) and the supplied software was used for the quantification of the bands.
Authorship contributions
B.A.S., H.R.Z. and C.M. performed the experiments, J.D. generated the mouse model and C.F.C. supervised the project. B.A.S. and C.F.C. wrote the manuscript.
Table 1: Mendelian distribution offspring of Cebpawt/ΔuORF x
Cebpawt/ΔuORF breedings
Total 147 (100%)
wt/wt 35 (23.81%)
wt/ki 78 (53.06%)
ki/ki 34 (23,13%)
Table 2: Sequences of genotyping primers
Primer name 5’-> 3’sequence
Fw1 ATTCGCGACCCGAAGCTGC
Rv duORF GTTCTCACGGCAAGGGGATCC
Rv2 GGAACTCGTCGTTGAAGGCGG
Rv3 GCTCGTACAGGGGCTCCAGC
References
1. Calvo, S. E., Pagliarini, D. J. & Mootha, V. K. Upstream open reading frames cause
widespread reduction of protein expression and are polymorphic among humans.
Proc. Natl. Acad. Sci. U. S. A. 106, 7507–7512 (2009).
2. Dever, T. E. Gene-specific regulation by general translation factors. Cell 108, 545–
556 (2002).
3. Calkhoven, C. F., Christine, M. & Leutz, A. Calkhoven et al 2002 TMM. 8, 577–
583 (2002).
4. Wethmar, K. The regulatory potential of upstream open reading frames in
eukaryotic gene expression. Wiley Interdiscip. Rev. RNA 5, 765–778 (2014).
5. Mueller, P. P. & Hinnebusch, A. G. Multiple upstream AUG codons mediate
translational control of GCN4. Cell 45, 201–207 (1986).
6. Hinnebusch, A. G. Translational Regulation of Gcn4 and the General Amino
Acid Control of Yeast . Annu. Rev. Microbiol. 59, 407–450 (2005).
7. Harding, H. P. et al. Regulated translation initiation controls stress-induced gene
expression in mammalian cells. Mol. Cell 6, 1099–1108 (2000).
8. Kirstetter, P. et al. Modeling of C/EBPα Mutant Acute Myeloid Leukemia Reveals
a Common Expression Signature of Committed Myeloid Leukemia-Initiating Cells. Cancer Cell 13, 299–310 (2008).
9. Calkhoven, C. F., Müller, C. & Leutz, A. Translational control of C/EBPalpha and
C/EBPbeta isoform expression. Genes Dev. 14, 1920–32 (2000).
10. Wethmar, K., Calkhoven, C. F. & Leutz, A. RESEARCH COMMUNICATION C
/ EBPb DuORF mice — a genetic model for uORF-mediated translational control in mammals. Genes Dev. 15–20 (2010). doi:10.1101/gad.557910.Freely
11. Nerlov, C. & Ziff, E. B. CCAAT/enhancer binding protein-α amino acid motifs
with dual TBP and TFIIB binding ability co-operate to activate transcription in both yeast and mammalian cells. EMBO J. 14, 4318–4328 (1995).
12. Pabst, T. et al. Dominant-negative mutations of CEBPA, encoding
CCAAT/enhancer binding protein-α (C/EBPα), in acute myeloid leukemia. Nat.
Genet. 27, 263–270 (2001).
13. Zidek, L. M. et al. Deficiency in mTORC1-controlled C/EBPβ-mRNA translation
improves metabolic health in mice. EMBO Rep. 16, 1022–36 (2015).
14. Hansen, M. et al. Lifespan extension by conditions that inhibit translation in
Caenorhabditis elegans. Aging Cell 6, 95–110 (2007).
15. Johnson, S. C., Rabinovitch, P. S. & Kaeberlein, M. mTOR is a key modulator of
ageing and age-related disease. Nature 493, 338–45 (2013).
16. Kaeberlein, M. et al. Cell biology: Regulation of yeast replicative life span by TOR
17. Zid, B. M. et al. 4E-BP Extends Lifespan upon Dietary Restriction by Enhancing Mitochondrial Activity in Drosophila. Cell 139, 149–160 (2009).
18. Selman, C. et al. Europe PMC Funders Group Ribosomal protein S6 kinase 1
signaling regulates mammalian lifespan. 326, 140–144 (2016).
19. Müller, C. et al. Reduced expression of C/EBPβ-LIP extends health and lifespan
in mice. Elife 7, e34985 (2018).
20. Snaddon, J. et al. Mutations of CEBPA in acute myeloid leukemia FAB types M1
and M2. Genes, Chromosom. Cancer 37, 72–78 (2003).
21. Flodby, P., Barlow, C., Kylefjord, H., Ährlund-Richter, L. & Xanthopoulos, K. G.
Increased hepatic cell proliferation and lung abnormalities in mice deficient in CCAAT/enhancer binding protein α. J. Biol. Chem. 271, 24753–24760 (1996).
22. Zhang, D. E. et al. Absence of granulocyte colony-stimulating factor signaling and
neutrophil development in CCAAT enhancer binding protein alpha-deficient mice. Proc. Natl. Acad. Sci. U. S. A. 94, 569–574 (1997).
23. Wang, N. D. et al. Impaired energy homeostasis in C/EBP alpha knockout mice.
Science (80-. ). 269, 1108–1112 (1995).
24. Bennett, K. L. et al. Tumor suppressor activity of CCAAT/enhancer binding
protein a is epigenetically down-regulated in head and neck squamous cell carcinoma. Cancer Res. 67, 4657–4664 (2007).
25. Gery, S. et al. Down-regulation and growth inhibitory role of C/EBPα in breast
cancer. Clin. Cancer Res. 11, 3184–3190 (2005).
26. Wu, Y. V. et al. Restoration of C/EBPα in dedifferentiated liposarcoma induces
G2/M cell cycle arrest and apoptosis. Genes Chromosom. Cancer 51, 313–327 (2012).
27. Tseng, H. H. et al. Reduced expression of C/EBPα protein in hepatocellular
carcinoma is associated with advanced tumor stage and shortened patient survival. J. Cancer Res. Clin. Oncol. 135, 241–247 (2009).
28. Shim, M., Powers, K. L., Ewing, S. J., Zhu, S. & Smart, R. C. Diminished
expression of C/EBPα in skin carcinomas is linked to oncogenic ras and reexpression of C/EBPα in carcinoma cells inhibits proliferation. Cancer Res. 65, 861–867 (2005).
29. Costa, D. B. et al. tumors : a correlative study of E3590. 56, 97–103 (2012).
30. Pan, Z. et al. Down-regulation of the expression of CCAAT/enhancer binding
protein α gene in cervical squamous cell carcinoma. BMC Cancer 14, 1–9 (2014).
31. Shi, D.-B. et al. C/EBPα-induced miR-100 expression suppresses tumor
metastasis and growth by targeting ZBTB7A in gastric cancer. Cancer Lett. 369, 376–385 (2015).
32. Takai, N. et al. Discovery of epigenetically masked tumor suppressor genes in
endometrial cancer. Mol. Cancer Res. 3, 261–269 (2005).
Down-regulated expression of the CCAAT/enhancer binding protein alpha and beta genes in human hepatocellular carcinoma: a possible prognostic marker.
Anticancer Res. 23, 351–354 (2003).
34. Huijbers, I. J. et al. Using the GEMM-ESC strategy to study gene function in
mouse models. Nat. Protoc. 10, 1755–1785 (2015).
35. Begay, V. et al. Deregulation of the endogenous C/EBPβ LIP isoform predisposes
to tumorigenesis. J. Mol. Med. 93, 39–49 (2014).
36. Sterneck, E., Tessarollo, L. & Johnson, P. F. An essential role for C/EBPβ in female
reproduction. Genes Dev. 11, 2153–2162 (1997).
37. Fan, H.-Y., Liu, Z., Johnson, P. F. & Richards, J. S. CCAAT/enhancer-binding
proteins (C/EBP)-α and -β are essential for ovulation, luteinization, and the expression of key target genes. Mol. Endocrinol. 25, 253–268 (2011).
38. Müller, C. et al. Reduced expression of C/EBPβ-LIP extends health and lifespan
in mice. Elife 7, (2018).
39. Darlington, G. J., Wang, N. & Hanson, R. W. C/EBPα: a critical regulator of genes
governing integrative metabolic processes. Curr. Opin. Genet. Dev. 5, 565–570 (1995).
40. Croniger, C. et al. Role of the isoforms of CCAAT/enhancer-binding protein in
the initiation of phosphoenolpyruvate carboxykinase (GTP) gene transcription at birth. J. Biol. Chem. 272, 26306–26312 (1997).
41. Inoue, Y., Inoue, J., Lambert, G., Yim, S. H. & Gonzalez, F. J. Disruption of hepatic
C/EBPα results in impaired glucose tolerance and age-dependent hepatosteatosis.
J. Biol. Chem. 279, 44740–44748 (2004).
42. Kwon, Y.-W. et al. Role of Zscan4 in secondary murine iPSC derivation mediated
by protein extracts of ESC or iPSC. Biomaterials 59, 102–115 (2015).
43. Lee, Y. H., Sauer, B., Johnson, P. F. & Gonzalez, F. J. Disruption of the c/ebp alpha
gene in adult mouse liver. Mol. Cell. Biol. 17, 6014–6022 (1997).
44. Yang, J. et al. Metabolic response of mice to a postnatal ablation of
CCAAT/enhancer- binding protein α. J. Biol. Chem. 280, 38689–38699 (2005).
45. Lefterova, M. I. et al. PPARγ and C/EBP factors orchestrate adipocyte biology via
adjacent binding on a genome-wide scale. Genes Dev. 22, 2941–2952 (2008).
46. Rosen, E. D. et al. RESEARCH COMMUNICATION C / EBPα induces
adipogenesis through PPARγ : a unified pathway. Genes Dev. 16, 22–26 (2002).
47. Siersbæk, R. & Mandrup, S. Transcriptional networks controlling adipocyte
differentiation. Cold Spring Harb. Symp. Quant. Biol. 76, 247–255 (2011).
48. Hsieh, C. C. et al. Effects of age on the posttranscriptional regulation of
CCAAT/enhancer binding protein α and CCAAT/enhancer binding protein β isoform synthesis in control and LPS-treated livers. Mol. Biol. Cell 9, 1479–1494 (1998).
decreased adipogenesis with aging. Am. J. Physiol. - Regul. Integr. Comp. Physiol.
280, 1772–1780 (2001).
50. Timchenko, L. T. et al. Age-specific CUGBP1-eIF2 complex increases translation
of CCAAT/enhancer-binding protein β in old liver. J. Biol. Chem. 281, 32806– 32819 (2006).
51. Zhang, L., Zhou, F. & ten Dijke, P. Signaling interplay between transforming
growth factor-β receptor and PI3K/AKT pathways in cancer. Trends Biochem. Sci.
38, 612–620 (2013).
52. Zhang, B. P. et al. Upregulation of Interleukin 6 and Granulocyte Factor CCAAT
Enhancer Binding Protein α ( C / EBPα ) Is Critical for Granulopoiesis. 188, (1998).
53. Radomska, H. S. et al. CCAAT/Enhancer Binding Protein α Is a Regulatory
Switch Sufficient for Induction of Granulocytic Development from Bipotential Myeloid Progenitors. Mol. Cell. Biol. 18, 4301–4314 (1998).
54. Zhang, P. et al. Enhancement of hematopoietic stem cell repopulating capacity
and self-renewal in the absence of the transcription factor C/EBPα. Immunity 21, 853–863 (2004).
55. Seifeddine, R. et al. Hypoxia down-regulates CCAAT/enhancer binding
protein-α expression in breast cancer cells. Cancer Res. 68, 2158–2165 (2008).
56. Lourenço, A. R. & Coffer, P. J. A tumor suppressor role for C/EBPα in solid
tumors: more than fat and blood. Oncogene 1–10 (2017). doi:10.1038/onc.2017.151
57. Wang, H. et al. One-step generation of mice carrying mutations in multiple genes
Figure S1
Figure S1: DNA sequences of Cebpa wt and Cebpa ∆uORF and corresponding amino acid sequences after introduction of point mutations.
WT Cebpa
Mutant Cebpa Point mutations
AA sequence DNA sequence
AA sequence DNA sequence
Figure S2
Figure S2: Sequencing of founder lines. Point mutations were generated to mutate the uORF ATG, introduce a BamH1 site and mutate the PAM site. Mutants were obtained with with 4 point mutations (mut) or ¾ mutations (3 point mutations, without mutant PAM site).
Figure S3
Figure S3: Representative immunoblot for C/EBPβ with β-actin as loading control of male liver obtained from Cebpawt/wt and Cebpa ΔuORF /ΔuORF mice.
C/EBPβ-LAP C/EBPβ-LIP
Male liver
β-actin
Cebpawt/wtCebpaΔuORF /ΔuORF Cebpawt/wtCebpaΔuORF /ΔuORF
