The handle http://hdl.handle.net/1887/47933 holds various files of this Leiden University dissertation
Author: Janson, David
Title: Development of human skin equivalents mimicking skin aging : contrast between papillary and reticular fibroblasts as a lead
Issue Date: 2017-04-19
TGF- β 1 induces differentiation of papillary fibroblasts to reticular fibroblasts in monolayer
culture, but not in human skin equivalents
David Janson
1, Gaëlle Saintigny
2, Jeroen Zeypveld
1, Christian Mahé
2, Abdoelwaheb El Ghalbzouri
11
Department of Dermatology, Leiden University Medical Center, Leiden, The Netherlands
2
CHANEL Parfums Beauté, Paris, France
European Journal of Dermatology, 2014, 24(3):342-8
Abstract
Fibroblasts isolated from the papillary and reticular dermis are different from each other in vitro. If papillary fibroblasts are subjected to prolonged serial passaging they will differentiate into reticular fibroblasts. Reticular fibroblasts have been shown to resemble myofibroblasts in several ways. TGF-β1 is the most important factor involved in myofi- broblast differentiation. Therefore, we investigated if TGF-β1 can induce differentiation of papillary fibroblasts into reticular fibroblasts, in monolayer cultures and in human skin equivalents.
Monolayer cultures of and human skin equivalents generated with papillary fibrob- lasts were stimulated with TGF-β1. The expression of markers specific for reticular and papillary fibroblasts was measured by qPCR and immunohistochemical analysis in monolayer cultures. In human skin equivalents, the morphology and the expression of several markers was analysed and compared to untreated papillary and reticular human skin equivalents.
Monolayer cultures of papillary fibroblasts started to express a reticular marker profile after stimulation with TGF-β1. Human skin equivalents generated with papillary fibrob- last and stimulated with TGF-β1 were similar to papillary control equivalents and did not obtain reticular characteristics. Expression of reticular markers was only found in the lower layers of TGF-β1-stimulated papillary skin equivalents.
TGF-β1 can induce differentiation to reticular fibroblasts in monolayer cultures of papillary fibroblasts. In skin equivalents no such effects were found. The major difference between these experiments is the presence of extracellular matrix in skin equivalents.
Therefore, we hypothesize that the matrix secreted by papillary fibroblasts protects them from TGF-β1 induced differentiation.
Introduction
Based on its morphology, the dermis can be divided in two parts. The upper part, called papillary dermis, has loose connective tissue and a high cell density. The deeper part, called reticular dermis, has thick connective tissue and a low cell density (1). It has been known for quite some time that the fibroblasts isolated from these respective dermal compartments behave differently in monolayer culture and in humans skin equivalents (HSEs) (2-5). Recently, we have shown that papillary fibroblasts can differentiate into reticular fibroblasts in vitro after prolonged culture (6).
In vitro, reticular fibroblasts resemble myofibroblasts in several ways. Myofibroblasts are specialized contractile fibroblasts, which in the skin are known for their role in wound healing. An important step in wound healing is the differentiation of fibroblasts to myofibroblasts (7). Myofibroblasts provide contractile forces and generate large quantities of matrix to facilitate wound closure (8, 9). In healthy skin myofibroblasts are not present.
Staining with alpha smooth muscle actin (α-SMA), a marker of myofibroblasts and smooth muscle tissue, is present in several skin appendages, such as blood vessels and smooth muscle cells, but not in fibroblasts (10, 11). Therefore, fully differentiated myofibroblasts, that is myofibroblasts with a complete and functional contractile apparatus, are not present in a healthy dermal fibroblast population (9).
Like myofibroblasts, reticular fibroblasts have large cell bodies and cause increased contraction of collagen lattices in vitro (12, 13). Reticular fibroblasts do not show α- SMA expression in vivo and only minimally in vitro, but the number ofα-SMA positive fibroblasts is increased in reticular fibroblasts compared to papillary fibroblasts in vitro.
Several markers for reticular fibroblasts are related to myofibroblasts and contraction, most notably Calponin 1 (CNN1) (14).
The single most important stimulator of myofibroblast differentiation is TGF-β1 (15).
Other factors such as mechanical tension, fibronectin and several growth factors can also contribute to myofibroblast differentiation, but TGF-β1 seems to be essential (7, 9, 16). Because TGF-β1 is so important for the differentiation of myofibroblasts, and because reticular fibroblasts resemble myofibroblasts, we investigated if TGF-β1 can also induce differentiation of papillary fibroblasts to reticular fibroblasts. For this purpose, we treated papillary fibroblasts with TGF-β1 in monolayer cultures and analysed changes in expression of reticular and papillary markers. In addition, we supplemented TGF-β1 to HSEs generated with papillary fibroblasts and analysed if these HSEs gained phenotypic characteristics of HSEs generated with reticular fibroblasts.
Materials and Methods
Isolation and cell culture
Isolation of reticular and papillary fibroblasts was performed as described before (14).
In short, skin obtained from plastic surgery was cleaned thoroughly and dermatomed at two different depths. First, skin was dermatomed at 300µm to obtain the epidermis and papillary dermis. For the reticular dermis the deep skin was removed with dermatome and scalpel, and the upper part was discarded. This deep dermis was then used for isolation. Fibroblasts were isolated by treatment with Collagenase (Invitrogen, Breda, The Netherlands) and Dispase (Roche Diagnostics, Almere, The Netherlands), mixed in a 3:1 ratio for 2 hours at 37°C.
Fibroblasts were cultured in DMEM medium (Gibco/Invitrogen, Breda, The Nether- lands) containing 5% Fetal Calf Serum (FCS, HyClone, Thermo Scientific, Etten-Leur) and 1% penicillin-streptomycin (Invitrogen). They were kept at 37°C at 5% CO2. From all donors both reticular and papillary fibroblasts were isolated, consequently all analyses were performed on a pairwise basis. When reaching confluence, fibroblasts were passaged at a 1:3 ratio. Fibroblasts used for experiments were in passage 3 – 6. All experiments were performed on at least three different donors (both papillary and reticular from same donor).
Normal human epidermal keratinocytes were isolated from skin obtained from plastic surgery. First the entire skin was treated with Dispase II to separate the dermis from the epidermis. Subsequently, the epidermis was incubated in trypsin to isolate the keratinocytes. After filtering with a cell strainer (70µm pore size), the keratinocytes were seeded and cultured at 37°C at 7,3 % CO2. Keratinocyte medium consisted of DMEM and Ham’s F12 medium (3:1) supplemented with 5% FCS, 0.5µM hydrocortisone, 1µM isoproterenol, 0.1µM insulin (Sigma-Aldrich, Zwijndrecht, The Netherlands), 100 U ml-1 penicillin and 100µg ml-1streptomycin (Invitrogen).
Generation of Human Skin Equivalents
Human fibroblast-derived matrix (FDM) equivalents were generated as described earlier (17). Briefly, 2 * 105 fibroblasts were seeded into 6-well filter inserts (0.4µm pore size Transwell inserts, Corning Incorporated, Schiphol-Rijk, The Netherlands) and cultured submerged for 3 weeks using CNT-05 medium (CELLnTEC, Huissen, The Netherlands) supplemented with 50µM ascorbic acid.
After generation of the dermal equivalents 5 * 105 keratinocytes were seeded on top. Cultures were incubated overnight in keratinocyte medium as described above.
After this the models were cultured for two days in keratinocyte medium with 1% FCS,
supplemented with 53µM selenious acid, 10mM L-serine, 10µM L-carnitine, 1µM dL- α-tocopherol-acetate, 250µM ascorbic acid phosphate, 24µM bovine serum albumin and a lipid supplement containing 25µM palmitic acid, 15µM linoleic acid and 7µM arachidonic acid (Sigma-Aldrich, Zwijndrecht, The Netherlands). Then, the cultures were air exposed and cultured in supplemented keratinocyte medium as described above, but without FCS and an increased concentration of linoleic acid (30µM). Medium was refreshed twice a week. After 17 days of air-exposed culture the FDM equivalents were harvested for analysis.
TGF-β1 stimulation
Recombinant TGF-β1 (Cell Signaling, Boston, MA, USA) was reconstituted as described in manufacturer’s protocol. For addition to monolayer cultures, cells were first cultured in starvation medium (1 % serum) before supplementing TGF-β1 (2 or 10 ng/mL) to the cells.
For stimulation of skin equivalents, TGF-β1 (2 ng/mL) was supplemented to the standard media as described above. Two timepoints were used to start with TGF-β1 supplementation; either one week after seeding the fibroblasts or from the air-exposure of the equivalent after seeding of keratinocytes.
Quantitative PCR
cDNA was generated of 1µg RNA using the iScript cDNA synthesis kit (BioRad, Veenen- daal, The Netherlands) according to manufacturer’s instructions. PCR reactions were based on the SYBR Green method (BioRad).The PCRs were run on the CFX384 system (BioRad). The PCR protocol was: 5 minutes at 95o C, 45 cycles of 20 sec 95o C and 40 sec 60o C, followed by the generation of a melt curve. Primers were checked beforehand on dilution series of normal fibroblasts cDNA. Expression analysis was performed with the BioRad Software (CFX Manager) and was based on the delta delta Ct method with the reference genes that were most stably expressed. The primers are listed in Table 1.
Immunohistochemistry
For immunohistochemical analyses on monolayer cell cultures, fibroblasts were grown on glass slides until nearly confluent, washed in PBS and fixed with 4% formaldehyde. Skin equivalents were processed and snap-frozen in liquid nitrogen or fixed in 4% formalde- hyde, dehydrated and embedded in paraffin. Sections were cut (5µm) and rehydrated in xylene and ethanol. For cryosections, 5µm were cut and fixed with acetone. Following in- cubation with the primary antibody, sections were stained with avidin-biotin-peroxidase system (GE Healthcare, Hoevelaken, The Netherlands), as described by manufacturer’s
Target Sequence Forward Sequence Reverse
CDH2 ATGTGCCGGATAGCGGGAGC ACAGACGCCTGAAGCAGGGC
CNN1 AGCGGAAATTCGAGCCGGGG GGTGCCCATCTGCAGCCCAA
EI24 TTCACCGCATCCGTCGCCTG GAGCGGGTCCTGCCTTCCCT
MGP GCCATCCTGGCCGCCTTAGC TTGGTCCCTCGGCGCTTCCT
NTN1 CCAACGAGTGCGTGGCCTGT CCGGTGGGTGATGGGCTTGC
PDPN GCCACCAGTCACTCCACGGAGAA TTGGCAGCAGGGCGTAACCC
SND1 CGTGCAGCGGGGCATCATCA TGCCCAGGGCTCATCAGGGG
TGF-β1 CACCGGAGTTGTGCGGCAGT GGCCGGTAGTGAACCCGTTGATG
TGM2 GGTGTCCCTGCAGAACCCGC CGGGGTCTGGGATCTCCACCG
Table 1: Primers used for qPCR analysis. EI24 and SND1 were used as reference genes for normalization of expression.
instructions. Staining was visualized with AEC (3-amino-9-ethylcarbazole) and sections were counterstained with haematoxylin.
Global morphologic analysis was performed on 5µm thick paraffin sections stained with haematoxylin and eosin (HE).
Antibodies
The antibodies used in this study were: α-SMA (1A4, Sigma-Aldrich) 1:1000, Calponin (CALP, Abcam, Cambridge, UK) 1:50, Podoplanin (18H5, Abcam) 1:250, TGM2 (CUB7402, Abcam) 1:75.
Results
Reticular fibroblasts show increased expression of TGF-β1 compared to papillary fi- broblasts
To investigate whether reticular and papillary fibroblasts express TGF-β1, qPCR analysis was performed on RNA isolated from monolayer cultures of both fibroblast populations.
As shown in figure 1, in five donors the average expression of TGF-β1 was higher in reticular fibroblasts than in papillary fibroblasts (1.31 and 0.64 respectively).
TGF-β1 stimulation reduces papillary marker- and induces reticular marker expression in papillary fibroblasts
Because TGF-β1 expression is increased in reticular fibroblasts, we wondered if TGF- β1 stimulation can induce differentiation of papillary fibroblasts to reticular fibroblasts.
Therefore, papillary fibroblasts were stimulated with TGF-β1 and the expression of several papillary and reticular markers was measured by qPCR. A representative experiment is
Figure 1: The expression of TGF-β1, measured by qPCR, in reticular and papillary fibroblasts. Each point represent the average of two qPCRs. Samples from the same donor are connected by a line. The difference between reticular and papillary fibroblasts was significantly different according to a paired t-test (P < 0.05).
described and shown in figure 2. Papillary fibroblasts were stimulated with TGF-β1 for 24 or 48 hours, at 2 or 10 ng/mL. The expression of collagen type Iα1 was measured by qPCR as a positive control for the TGF-β1 stimulation. As expected, the expression of collagen type Iα1 was increased after TGF-β1 stimulation (not shown). After stimulation with TGF-β1 the expression of papillary markers PDPN and NTN1 decreased and the expression of reticular markers CDH2, CNN1 and TGM2 increased compared to untreated control papillary fibroblasts. Expression of reticular marker MGP was not affected.
When combining both papillary markers and all reticular markers (including MGP) the differences were statistically significant for each TGF-β1 treatment condition compared to untreated controls (paired t-test, P < 0.05).
To verify the changes in marker expression and to investigate myofibroblast differen- tiation, papillary fibroblasts were stimulated with TGF-β1, 10 ng/mL for 48 or 96 hours.
First, the morphology of the cells was inspected. Normally papillary fibroblasts have lean, spindle-shaped cell bodies. TGF-β1 stimulation increased cell size and the morphology became squarer and flat, comparable to reticular- and myofibroblasts. The cells were then stained with myofibroblast markerα-SMA, papillary marker PDPN, and reticular markers CNN1 and TGM2. The expression of CNN1 and TGM2 increased in TGF-β1 treated fibroblasts, while expression of PDPN was lost. In untreated conditions there were very fewα-SMA positive fibroblasts. However, the number was slightly higher in untreated
Figure 2: Expression of papillary (NTN1 and PDPN) and reticular (CDH2, CNN1, MGP and TGM2) markers after TGF-β1 stimulation of papillary fibroblasts. Bars represent the average of three donors, error bars represent the SD. Combining both papillary markers and all reticular markers (including MGP) the differences were statistically significant for each TGF-β1 treatment condition compared to untreated controls (paired t-test, P < 0.05).
reticular fibroblasts compared with untreated papillary fibroblasts. After 96 hours of TGF- β1 stimulation the majority of papillary fibroblasts became positive forα-SMA. The results of this analysis are shown in figure 3.
Papillary fibroblasts in FDMs do not differentiate after TGF-β1 stimulation
To study if differentiation can also occur in an environment more representative of in vivo skin, we investigated the effect of TGF-β1 stimulation on FDM skin equivalents generated with papillary fibroblasts (papFDM). This also allowed us to study the functional conse- quences of TGF-β1 treatment. FDMs were generated with papillary fibroblasts (of four different donors) and treated with TGF-β1 at 2 ng/mL, starting one week after seeding the fibroblasts or after seeding keratinocytes (air-exposure). TGF-β1 was added to the medium at each refreshment. As a control, FDM skin equivalents were generated with reticular fibroblasts (retFDM).
TGF-β1 had only a minimal effect on the morphology of the papFDMs, matrix deposition was slightly increased in papFDMs treated with TGF-β1 from week 1. Keratin 16 (an epidermal activation associated marker) was weakly stained in papillary control and TGF-β1 treated papFDMs, while in retFDMs keratin 16 was stained intensely throughout the epidermis. Expression of reticular marker CNN1 was not detected in papFDMs stimulated with TGF-β1, except in fibroblasts in the lowest layers of the FDM. In untreated papFDMs fibroblasts showed no expression of CNN1 at all and in retFDMs fibroblasts stained positive directly underneath the epidermis. TGM2 was used as a reticular marker in the dermis, but was also expressed in the epidermis. TGM2 showed no dermal staining in papFDMs, both in control and TGF-β1 treated HSEs. In retFDMs several fibroblasts were positive for TGM2. In the epidermis TGM2 was expressed in the deepest 2-3 layers in all papFDMs and throughout the entire epidermis in retFDMs (figure 4).
Discussion
In this study we investigated the effect of TGF-β1 stimulation on the differentiation of papillary fibroblasts. Earlier, we have shown that papillary fibroblasts differentiate into reticular fibroblasts during serial passaging (6). The distinct phenotype of the fibroblasts was based on two criteria. First, markers specific for papillary and reticular fibroblasts in vitro were measured. A decrease in papillary markers and an increase in reticular markers were interpreted as differentiation to reticular fibroblasts. Second, papillary and reticular fibroblasts have different effects on the morphogenesis of FDM skin equivalents.
Therefore, the morphology and the expression of several markers in these HSEs allows to distinguish between papillary and reticular fibroblasts. The same criteria were used to evaluate the effect of TGF-β1 on the differentiation of papillary to reticular fibroblasts.
Figure 3: Immunohistochemical analyses of monolayer fibroblast cultures treated with TGF-β1. Supplementation of 10 ng/ml of TGF-b to monocultures of papillary fibroblasts resulted in an increased expression of the myofibroblast markerα-SMA after 96 hours. In addition, expression of the papillary marker PDPN was lost already at 48 hours, while the reticular proteins CNN1 and TGM2 showed an increased expression. Scale bars: 50µm.
In monolayer cultures of papillary fibroblasts supplementation of TGF-β1 induced reticular marker expression and reduced expression of papillary markers. This indicates that TGF-β1 causes differentiation of papillary to reticular fibroblasts. Interestingly, the reticular marker MGP was not affected by TGF-β1 stimulation. It is possible that the TGF-β1 stimulation needs to be performed longer or other (additional) stimuli are needed before changes in MGP can be detected.
To show that TGF-β1 not only changes the expression of papillary- and reticular markers, but also the functionality of the cells, FDM skin equivalents were generated with papillary fibroblasts and treated with TGF-β1. In FDMs, fibroblasts are stimulated to produce their own extracellular matrix, after which the keratinocytes are seeded on the generated dermis. We hypothesized that FDMs generated with papillary fibroblasts and stimulated with TGF-β1 will obtain a morphology and marker profile more similar to HSEs generated with reticular fibroblasts. Surprisingly, this was not the case. The differences between TGF-β1-stimulated and control papillary equivalents were minimal. TGF-β1 stimulation caused a slight increase in dermal thickness, probably by stimulating matrix production (18, 19).
In the experiments described above, TGF-β1 was not able to induce differentiation of papillary fibroblasts in FDM skin equivalents. A possible explanation can be inferred from the immunohistochemical analysis of CNN1, a reticular marker, in the HSEs. In reticular HSEs, CNN1-positive fibroblasts are predominantly found underneath the epidermis, whereas in papillary HSEs no CNN1-positive fibroblasts are found. However, in TGF- β1- stimulated papillary HSEs some positive fibroblasts are detected at the very bottom of the dermal compartment. This suggests that papillary matrix prevents fibroblasts from differentiation or that the matrix repulses (differentiated) reticular fibroblasts from migrating to the epidermis. The HSEs were grown for one week before addition of TGF-β1, ensuring that some matrix was already present.
In the monolayer experiments, no significant differences were found between 2- and 10 ng/mL of TGF-β1. However, the FDM skin equivalents were supplemented just with 2 ng/mL TGF-β1. The rationale was that 2 ng/mL of TGF-β1 readily induces differentiation in monolayer, it should also be sufficient to induce differentiation in FDM skin equivalents. Especially since the skin equivalents were supplemented for several weeks. Another reason was the fact that TGF-β1 can induce contraction of dermal matrices. In the case of the FDM type dermal equivalent, contraction makes the matrix unusable for seeding of keratinocytes and the development of the epidermis. This is in contrast with artificial type I collagen matrices, which can resist contraction better.
Based on the effectiveness with which TGF-β1 induces differentiation of papillary to reticular fibroblasts in monolayer cultures and the ubiquitous presence of TGF-β1 in the skin, one would not expect to see such a high number of papillary fibroblasts in
Figure 4: IHC analysis of FDM skin equivalents generated with papillary fibroblasts and treated with TGF-β1 either from 1 week after fibroblast seeding or from keratinocyte seeding. TGF-β1 had minimal effect on the HSEs; matrix deposition was slightly increased. Expression of CNN1, a reticular marker, was only detected in the fibroblasts at the very bottom of TGF-β1-stimulated HSEs (arrows). In untreated papFDMs no CNN1 positive were detected, in reticular control HSEs a band of CNN1 positive fibroblasts was located underneath the epidermis. Keratin 16 was diffusely expressed in all papFDMs, re- gardless of TGF-β1 stimulation. In retFDMs keratin 16 stained intensely in the epidermis.
TGM2 was not expressed in the fibroblasts of papFDMs and only in the first, deep layers of the epidermis. In retFDMs some TGM2 positive fibroblasts were detected (arrows) and the entire epidermis stained positive. Scale bars: 50µm.
vivo. Results obtained in the HSEs indicate most likely that the papillary matrix can protect papillary fibroblasts from differentiation. For example, one component that is predominantly expressed in the papillary dermal layer, decorin, is known to inhibit TGF- β1 (20, 21). Decorin, and other matrix molecules expressed in the papillary dermis, are probably implicated in the maintenance of the papillary population in vivo.
Besides inducing differentiation of papillary fibroblasts to reticular fibroblasts, TGF- β1 also efficiently induces differentiation of fibroblasts to myofibroblasts. The question now is: what is the relation between reticular fibroblasts and myofibroblasts? There are obvious similarities, such as the cell morphology and contraction capacity. However, there are also some notable distinctions, such as the expression of α-SMA, which is always expressed in myofibroblasts, but not at all in in vivo reticular dermis and only sporadically in in vitro reticular fibroblasts. Tomasek et al. coined the term proto-myofibroblast, which describes a contractile fibroblast that does not expressα-SMA, as opposed to the fully differentiated,α-SMA-expressing myofibroblast (22). In vitro reticular fibroblasts are, according to these definitions, proto-myofibroblasts. It is possible that during the isolation of fibroblasts, a damaging and wound-like process, reticular fibroblasts are primed for differentiation to myofibroblasts. However, the central, and still unsolved, issue remains the same: why do reticular fibroblasts resemble proto-myofibroblasts in culture and papillary fibroblasts do not?
All in all, we have shown that TGF-β1 can induce differentiation of papillary fibroblasts to reticular fibroblasts in monolayer culture, but not in HSEs. It appears that the matrix secreted by papillary fibroblasts protects them from TGF-β1 induced differentiation.
The exact role of the papillary matrix in the maintenance of papillary fibroblasts is an interesting subject for further study.
Conflict of interest
GS and CM are employees of CHANEL Parfum Beauté. AEG declares the receipt of a grant from CHANEL. The other authors declare no conflict of interest.
Acknowledgements
We would like to thank Prof. Rein Willemze, Dr. Frank de Gruijl and Dr. Nelleke Gruis of the Department of Dermatology, Leiden University Medical Center (LUMC), Leiden, The Netherlands for carefully reading the manuscript. The work was supported by CHANEL Parfum Beauté, Paris, France.
References
1. Ross MH, Pawlina W. Histology: A Text and Atlas. 6th ed. Baltimore, MD: Lippincott Williams &
Wilkins, 2011.
2. Azzarone B, Macieira-Coelho A. Heterogeneity of the kinetics of proliferation within human skin fibroblastic cell populations. J Cell Sci 1982: 57:177-187.
3. Harper JM, Salmon AB, Leiser SF, Galecki AT, Miller RA. Skin-derived fibroblasts from long-lived species are resistant to some, but not all, lethal stresses and to the mitochondrial inhibitor rotenone. Aging Cell 2007: 6:1-13.
4. Pageon H, Zucchi H, Asselineau D. Distinct and complementary roles of papillary and reticular fibroblasts in skin morphogenesis and homeostasis. Eur J Dermatol 2012.
5. Sorrell JM, Caplan AI. Fibroblast heterogeneity: more than skin deep. J Cell Sci 2004: 117:667- 675.
6. Janson D, Saintigny G, Mahe C, Ghalbzouri AE. Papillary fibroblasts differentiate into reticular fibroblasts after prolonged in vitro culture. Exp Dermatol 2013: 22:48-53.
7. Hinz B. Formation and function of the myofibroblast during tissue repair. J Invest Dermatol 2007: 127:526-537.
8. Darby IA, Hewitson TD. Fibroblast differentiation in wound healing and fibrosis. Int Rev Cytol 2007: 257:143-179.
9. Gabbiani G. The myofibroblast in wound healing and fibrocontractive diseases. J Pathol 2003:
200:500-503.
10. Darby I, Skalli O, Gabbiani G. Alpha-smooth muscle actin is transiently expressed by myofibrob- lasts during experimental wound healing. Lab Invest 1990: 63:21-29.
11. Rajkumar VS, Howell K, Csiszar K, Denton CP, Black CM, Abraham DJ. Shared expression of phenotypic markers in systemic sclerosis indicates a convergence of pericytes and fibroblasts to a myofibroblast lineage in fibrosis. Arthritis Res Ther 2005: 7:R1113-R1123.
12. Schafer IA, Shapiro A, Kovach M, Lang C, Fratianne RB. The interaction of human papillary and reticular fibroblasts and human keratinocytes in the contraction of three-dimensional floating collagen lattices. Exp Cell Res 1989: 183:112-125.
13. Schafer IA, Pandy M, Ferguson R, Davis BR. Comparative observation of fibroblasts derived from the papillary and reticular dermis of infants and adults: growth kinetics, packing density at confluence and surface morphology. Mech Ageing Dev 1985: 31:275-293.
14. Janson DG, Saintigny G, van AA, Mahe C, El GA. Different Gene Expression Patterns in Human Papillary and Reticular Fibroblasts. J Invest Dermatol 2012: 132:2565-2572.
15. Desmouliere A, Geinoz A, Gabbiani F, Gabbiani G. Transforming growth factor-beta 1 induces alpha-smooth muscle actin expression in granulation tissue myofibroblasts and in quiescent and growing cultured fibroblasts. J Cell Biol 1993: 122:103-111.
16. Shephard P, Hinz B, Smola-Hess S, Meister JJ, Krieg T, Smola H. Dissecting the roles of endothelin, TGF-beta and GM-CSF on myofibroblast differentiation by keratinocytes. Thromb Haemost 2004: 92:262-274.
17. El Ghalbzouri A, Commandeur S, Rietveld MH, Mulder AA, Willemze R. Replacement of animal- derived collagen matrix by human fibroblast-derived dermal matrix for human skin equivalent products. Biomaterials 2008: 30:71-78.
18. Moses HL, Coffey RJ, Jr., Leof EB, Lyons RM, Keski-Oja J. Transforming growth factor beta regulation of cell proliferation. J Cell Physiol Suppl 1987: Suppl 5:1-7.
19. Zeng G, McCue HM, Mastrangelo L, Millis AJ. Endogenous TGF-beta activity is modified during cellular aging: effects on metalloproteinase and TIMP-1 expression. Exp Cell Res 1996: 228:271- 276.
20. Schonherr E, Beavan LA, Hausser H, Kresse H, Culp LA. Differences in decorin expression by papillary and reticular fibroblasts in vivo and in vitro. Biochem J 1993: 290 ( Pt 3):893-899.
21. Zhang Z, Garron TM, Li XJ et al. Recombinant human decorin inhibits TGF-beta(1)-induced contraction of collagen lattice by hypertrophic scar fibroblasts. Burns 2009.
22. Tomasek JJ, Gabbiani G, Hinz B, Chaponnier C, Brown RA. Myofibroblasts and mechano- regulation of connective tissue remodelling. Nat Rev Mol Cell Biol 2002: 3:349-363.
