Cover Page
The handle http://hdl.handle.net/1887/56253 holds various files of this Leiden University dissertation
Author: Kosmidis, Georgios
Title: Coming of age of human stem cell derived cardiomyocytes : towards functional maturation of human pluripotent stem cell derived cardiomyocytes and their use in understanding inherited arrhythmia syndromes
Date: 2017-10-11
CHAPTER 6
Readthrough promoting drugs gentamicin and PTC124 fail to rescue Na
v1.5 function of hiPSC-derived cardiomyocytes carrying nonsense mutations in the sodium channel gene SCN5A
Georgios Kosmidis, MSc1; Christiaan C. Veerman, MD1; Simona Casini, PhD1; Arie O. Verkerk, PhD3; Simone van de Pas, MSc1; Milena Bellin, PhD1; Arthur A.M. Wilde, MD, PhD2; Christine L. Mummery, PhD1; Connie R. Bezzina, PhD 2
1: Department of Anatomy and Embryology, Leiden University Medical Center, Leiden, The Netherlands 2: Heart Center, Department of Experimental and Clinical Cardiology, Academic Medical Center, , Amsterdam, The Netherlands.
3: Department of Anatomy and Embryology, Academic Medical Center, Amsterdam, The Netherlands Published in Circulation: Arrhythmia and Electrophysiology, November 2016;9(11). pii: e004227.
Abstract
Background: Several compounds have been reported to induce translational readthrough of premature stop codons and as a result in the production of full- length protein by interfering with ribosomal proofreading. Here we examined the effect of 2 of these compounds, gentamicin and PTC124, in human-induced pluripotent stem cell (hiPSC)-derived cardiomyocytes bearing nonsense muta- tions in the sodium channel gene SCN5A, which are associated with conduction disease and potential lethal arrhythmias.
Methods and results: We generated hiPSC from 2 patients carrying the muta- tions R1638X and W156X. hiPSC-derived cardiomyocytes from both patients re- capitulated the expected electrophysiological phenotype, as evidenced by reduced Na+-currents and action potential upstroke velocities compared to hiPSC-derived cardiomyocytes from 2 unrelated control individuals. While we were able to confirm the readthrough efficacy of the two drugs in Human Embryonic Kidney 293 cells, we did not observe rescue of the electrophysiological phenotype in hiPSC-derived cardiomyocytes from the patients.
Conclusions: We conclude that these drugs are unlikely to present an effective treatment for patients carrying the loss-of-function SCN5A gene mutations ex- amined in this study.
Introduction
The cardiac voltage-gated sodium channel Nav1.5, encoded by the gene SCN5A, is a key player in cardiac conduction in the human heart.1 Channel dysfunction caused by mutations in SCN5A or by Nav1.5 channel-blocking drugs impact conduction or repolarization and are associated with sudden cardiac death. Loss- of-function mutations in particular are associated with isolated (progressive) con- duction disease, sick sinus syndrome, atrial arrhythmias and Brugada Syndrome, a disease characterized by signature ECG features arising from the right ventricle which is associated with ventricular fibrillation and sudden death.2 To date, no cures exist for these diseases. Instead, preventative measures including pacemakers or cardioverter defribillator implants, can be taken.
A subset of patients with conduction disease or Brugada Syndrome have nonsense mutations in SCN5A which lead to haploinsufficiency by premature termination of translation and production of truncated proteins. Several compounds have been described as inducing translational readthrough of premature stop codons and production of full-length protein by interfering with ribosomal proofread- ing. Gentamycin, an aminoglycoside antibiotic, for example, has been shown to promote readthrough in several different genetic diseases,3, 4 but just as with other promoting aminoglycosides, toxicity is a complicating issue.5 Recently, however, a non-aminoglycoside drug called PTC124 was described as being effective in suppressing nonsense mutations in vitro and in vivo in different disease models,6 while this drug was well-tolerated in a phase I clinical trial.7
With respect to nonsense mutations in cardiac ion channel genes, including SCN5A, both gentamycin and PTC124 have been shown to restore protein expression significantly,8-11 although to date this has only been evaluated in heter- ologous expression systems, in which expression of the SCN5A gene was realized by expressing the cDNA in a non-cardiac cell. However, heterologous systems lack the complete architecture and components of native cardiomyocytes. Also expres- sion is not driven by regulatory elements in the genome and lacks, for example, non-coding, functional regions. Furthermore, degradation of mutant RNA by nonsense mediated mRNA-decay (NMD), cannot take place because it depends on exon-junction complexes, which are not present in transfected cDNA.12 Suc- cess of readthrough drugs in the native context depends among others on the rate of NMD.13
Human induced pluripotent stem cells (hiPSCs), derived from patients carrying nonsense mutations, are a potential in vitro model to evaluate the efficiency of
readthrough promoting drugs. hiPSCs can self-renew but also differentiate into cardiomyocytes (hiPSC-CMs) using a variety of methods based on recapitulat- ing developmental signals.14 These cardiomyocytes should possess the noncod- ing genomic information necessary for NMD to occur. hiPSC-CMs have been shown in multiple studies to recapitulate the phenotype of patients with various inherited cardiac disorders,15 including patients carrying SCN5A mutations, as reflected by their electrophysiological properties.16 Here, we generated and char- acterized hiPSC-CMs from individuals carrying the nonsense mutations R1638X and W156X in SCN5A and evaluated the effects of gentamycin and PTC124 in restoring protein function.
Materials and Methods
Generation of Patient-Specific hiPSCs
Skin fibroblasts were isolated from dermal biopsies, which were obtained according to the protocol approved by the medical ethical committee of the Academic Medi- cal Center and Leiden University Medical Center. Skin biopsies were obtained from two male mutation carriers (mutation R1638X and W156X in SCN5A) and from unrelated (sex-matched) healthy control individual after informed consent was secured. Reprogramming of the skin fibroblasts was performed as described previously.17 In brief, skin fibroblasts derived from a donated biopsy were infected with Sendai virus encoding OCT4, SOX2, KLF4, and MYC and cultured on mouse embryonic feeder cells until hiPSC colonies appeared and could be picked for further expansion and characterization for pluripotency in culture and cryopreserved. A second, non-sex matched, control hiPSC-line was generated previously and characterized in detail. 17
hiPSC culture and cardiac differentiation
All hiPSC lines were maintained in mTeSR1 medium (Stem Cell Technologies, Vancouver, Canada) and mechanically passaged on Matrigel- (BD Biosciences, San Jose, CA) coated tissue culture plates according to the suppliers protocol. Dif- ferentiation was induced in a monolayer culture using timed addition of growth factors BMP4, Activin A, CHIR-99021 (a small molecular activator of Wnt signaling) and Xav939 (inhibitor of Wnt signaling) in BPEL medium as previ- ously described.18 For electrophysiological recordings and immunofluorescence measurements the cultures were dissociated to single cells with 10x Tryple Select (Gibco Life Technologies, Waltham, MA) at day 20 of differentiation and seeded
on Matrigel coated glass coverslips. Electrophysiological properties were measured 8 to 12 days after dissociation from at least 3 independent differentiations.
DNA sequencing
Genomic DNA was isolated from hiPSCs using the Gentra PureGene Cell Kit (Qiagen, Germantown, MD). A genomic region surrounding each mutation was amplified by polymerase chain reaction (PCR) using SilverStar DNA polymerase (Eurogentec, Maastricht, Netherlands) and specific primer sets (Supplementary table S1). The PCR products were purified using the QIAquick PCR Purification kit (Qiagen, Germantown, MD) and sequenced.
Human Embryonic Kidney 293 Cell transfections with H2B-GFP plasmids
Human embryonic kidney 293 (HEK293) cells, used to confirm readthrough capacity of gentamicin and PTC124, were cultured in medium containing mini- mal essential medium, supplemented with 10% fetal bovine serum, penicillin, streptomycin and non-essential amino acids. The H2B-GFP wildtype (WT)19 and H2B-GFP opal20 plasmids were transfected into the cells when they had reached 70% confluence in 24-well plates using Fugene HD (Promega, Madison, WI) according to the manufacturer’s protocol. For transfection, 1 μg of DNA and 3 μL of Fugene HD was used for each well.
Immunofluorescence analysis
Single cell hiPSC-CMs were fixed in 4% paraformaldehyde, permeabilized with phosphate buffer saline (PBS)/0.1% Triton X‐100 (Sigma‐Aldrich, St. Louis, MO), and blocked with 10% FCS (Life Technologies, Waltham, MA). The samples were incubated overnight at 4°C with primary antibodies specific for troponin I (TNNI) (rabbit polyclonal, Santa Cruz Biotechnology, Dallas, Texas) and α‐
ACTININ (mouse monoclonal, Sigma‐Aldrich, St. Louis, MO) or for 2 hours at 37°C with anti-Nav1.5 (rabbit polyclonal, Alomone labs, Jerusalem, Israel).
Primary antibodies were detected with either Alexa‐Fluor 488 or Cy3‐conjugated antibodies. Nuclei were visualized with DAPI (Invitrogen, Waltham, MA) and F‐actin with Phalloidin‐Alexa‐Fluor‐594‐conjugate (Invitrogen, Waltham, MA).
Images were acquired using a Leica DMI6000‐AF6000 fluorescence microscope (Leica Microsystems, Wetzlar, Germany).
hiPSCs were also fixed and treated as above but incubated overnight at 4°C with primary antibodies for NANOG (rabbit polyclonal, Peprotech, London, UK), SSEA4 (mouse monoclonal, Biolegend, San Diego, CA), TRA-1-81 (mouse polyclonal, Biolegend, San Diego, CA) and OCT-3/4 (mouse monoclonal, Santa
Cruz, Dallas, Texas) and detected with Alexa-Fluor 488-, Alexa 568- or Cy3‐con- jugated antibodies.
HEK 293 cells were fixed and permeabilized as above, blocked with 0.1 M Tris- HCl, 0.15 M NaCl containing 0.5% blocking powder (Roche, Basil, Switzerland), pH 7.5. The cells were incubated overnight at 40C with a primary antibody for GFP (sc-5384, goat polyclonal, Santa Cruz, Dallas, Texas, dilution 1:100) then secondary antibody conjugated with Alexa-Fluor 488 for 2 hours. Nuclei were stained with Sytox Orange (Thermo Fisher, Waltham, MA).
Gene Expression analysis
Total RNA was isolated from hiPSCs and hiPSC-CMs using the RNeasy Mini (Qiagen). RNA was reverse transcribed using the iScript-cDNA Synthesis kit (Bio-Rad, Hercules, CA). Transcript abundance of selected genes was determined by quantitative PCR using the iQ Universal SYBR Green Supermix (Bio-Rad).
Gene expression was normalized to GAPDH and results were analysed using the ΔΔCt method. The GENE-E analysis platform (http://www.broadinstitute.org) was used to illustrate the results as a heat map. The primer sets used are listed in supplementary table S1.
Electrophysiology
Sodium current measurements
The sodium current (INa) was measured with the ruptured patch clamp technique using an Axopatch 200B amplifier (Molecular Devices Corporation, Sunnyvale, CA, USA). Voltage control, data acquisition and analysis were realized with custom software. Data were low-pass filtered and digitized at 5 and 20 kHz, respectively. The liquid junction potential, calculated using Clampex 10.2 (Axon Instruments, Sunnyvale, CA), was 2.5 mV and corrected accordingly. For proper voltage control, INa wasrecorded at room temperature, using a reduced extracel- lular sodium concentration, and series resistance compensation by ≥80%. Bath solution contained (in mM): 20 NaCl, 120 CsCl, 1.8 CaCl2, 1.2 MgCl2, 11.0 glu- cose, 5.0 HEPES; nifedipine 0.01; pH 7.4 (CsOH). Borosilicate pipettes ( 2-2.5 MΩ) were filled with (in mM): 3.0 NaCl, 133 CsCl, 2.0 MgCl2, 2.0 Na2ATP, 2.0 TEACl, 10 EGTA, 5.0 HEPES; pH 7.2 (CsOH). INa was characterized by voltage clamp protocols as depicted in figure 3B with cycle lengths of 5 seconds. INa was measured as the difference between peak current and steady-state current during a test pulse. Current densities were calculated by dividing the measured current by the cell capacitance (Cm). Cm was determined using a -5 mV hyperpolarizing
step from -50 mV and equals the decay time constant of the capacitative transient, divided by access resistance. To determine the voltage dependence of activation, current-voltage curves were corrected for the driving force. Voltage dependence of inactivation curves were created by normalization of the currents to the maxi- mum peak current and plotted against the test potential. Curves were fitted with a Boltzmann equation (I/Imax=A/{ 1.0+exp[(V1/2−V)/k]}, to determine the V1/2
(membrane potential for the half-maximal (in)activation) and the slope factor k.
Action potential measurements
Action potentials (APs) were measured at 37°C with the perforated patch clamp technique using an Axopatch 200B amplifier and pClamp10.2 software (Axon Instruments). Analysis of the APs was performed with custom-made software. APs were filtered and digitized at 5 and 40 kHz, respectively, and the potentials were corrected for the calculated liquid junction potential of 15 mV.
Bath contained (in mM): 140 NaCl, 5.4 KCl, 1.8 CaCl2, 1.0 MgCl2, 5.5 glucose, 5.0 HEPES; pH 7.4 (NaOH). The pipette solution contained (in mM): 125 K- gluconate, 20 KCl, 5 NaCl, 0.22 amphotericin-B, 10 HEPES; pH 7.2 (KOH).
APs were elicited at the stimulation frequency of 1 Hz by 3 ms, 1.2x threshold current pulses through the patch pipette. Maximal diastolic potential (MDP), maximal upstroke velocity (Vmax), AP amplitude (APA), and AP duration (APD) at 50% and 90% repolarization (APD50 and APD90, respectively) were analysed.
Data from 10 consecutive APs were averaged.
Drug treatment
PTC124 (Selleckchem, Houston TX) and gentamicin (Sigma, St. Louis, MO) were dissolved as 17 mM and 20 mM stock solutions in dimethyl sulfoxide and water, respectively, and were diluted accordingly. During incubation, medium contain- ing PTC124 or gentamicin was replaced daily. In HEK293 cells, readthrough was evaluated by immunofluorescence after 48 hours of drug treatment. In hiPSC- CMs, drug efficiency was assessed by measuring peak INa. To take into account any variation between different differentiation experiments, drug-treated cells were compared with untreated or vehicle treated cells measured on the same day.
NMD evaluation
To assess the presence of NMD we calculated the relative amount of WT and mutant SCN5A transcripts by means of a cloning approach as follows. We first isolated RNA from the mutant hiPSC-CMs lines (R1638X and W156X) and re- versed transcribed it to cDNA as described earlier. Using primer sets that flanked
each mutation (listed in supplementary table S1), we generated PCR products that were subsequently cloned into the TOPO vector using the TOPO® TA cloning sequencing kit (Invitrogen). The ligation products were used to transform One Shot® TOP10 Chemically Competent Escherichia coli (Invitrogen) from which we subsequently isolated plasmids using the PureLink® Quick Plasmid Miniprep Kit (Invitrogen). The plasmids thus isolated were sequenced by conventional Sanger sequencing to assess how many were WT and how many were mutant.
Statistical analysis
Results are expressed as mean ± standard error of the mean (SEM). Normal dis- tribution of the data was confirmed with the Shapiro-Wilk test. Comparisons of AP parameters, INa voltage dependence of (in)activation and drug treatment were performed with One-Way ANOVA, followed by posthoc Bonferroni test, while INa density was compared with Two-Way Repeated measures ANOVA. Compari- sons of WT-mRNA/Mut-mRNA ratios (WT-mRNA, mRNA that does not carry the mutation; Mut-mRNA, mRNA that does carry the mutation) between lines were performed with the Chi-Square test. P<0.05 was considered statistically significant.
Results
Patient characteristics
Two patients with nonsense SCN5A mutations were selected for inclusion in this study. The first was a 34-year-old male Brugada syndrome patient, who carried the c.4912C>T mutation, which leads to substitution of an arginine with a TGA stop codon at a location (R1638X) close to the C-terminus of the channel (Fig.1A).
He presented with a typical type I Brugada ECG and displayed ventricular tachycardias during electrophysiological investigations. The second patient was a 52-year-old male who carried the c.468G>A mutation, leading to the change of a tryptophan at a position close to the N-terminus (W156X) (Fig.1A). His phenotype was relatively mild and consisted of first degree AV-block and slight QRS prolongation.
Figure 1: Basic characterization of hiPSC lines. A. The corresponding positions of W156X and R1638X mutations on the protein structure of Nav1.5. B. Typical examples of an immunofluores- cent analysis of NANOG (red), SSEA4 (green), Dapi (blue) on the first row and TRA-1-81 (red), OCT-3/4 (green), Dapi (blue) on the second row, in hiPSCWT1, hiPSCR1638Xand hiPSCW156X lines. C.
Pluripotency scores of hiPSCWT1, hiPSCR1638Xand hiPSCW156X lines based on the PluriTest algorithm.
D. Genotyping of hiPSCR1638Xand hiPSCW156X lines focusing on the loci around each mutation (lower row). The corresponding region of the hiPSCWT1 line is shown as a reference (upper row).
Generation of hiPSC lines from individuals with SCN5A nonsense mutations
Dermal fibroblasts were grown and expanded from skin biopsies from the two pa- tients and a sex-matched unrelated control. A Sendai virus carrying the transcrip- tion factors OCT4, SOX2, KLF4, and MYC21 was used to generate the hiPSC lines (hereafter referred to as hiPSCR1638X, hiPSCW156X and hiPSCWT1). Quan- titative PCR confirmed that after several passages the Sendai vectors had been extruded from the cells. All lines generated expressed the pluripotency associated markers NANOG, SSEA4, TRA-1-81 and OCT-3/4 by immunocytochemistry (Fig.1B). Each line could spontaneously differentiate into cell derivatives of all three primary germ layers and had a normal karyotype (Supplementary Fig.1-2).
RNA was isolated from the undifferentiated hiPSC lines and reverse transcribed, and the cDNA was subjected to a microarray. Gene expression patterns were analyzed with the PluriTest algorithm resulting in a pluripotency score, indicating the degree of pluripotency after comparison of the cell line to a reference panel of normal PSCs lines.22 All three lines ranked high in the pluripotency score of PluriTest (Fig.1C). Sanger sequencing of SCN5A at the mutation sites confirmed that each hiPSC line carried the nucleotide changes of its corresponding pro- genitor (Fig.1D). All previous results ensured that the lines generated were indeed pluripotent, integration-free and carried the genotype of the individual from which they were originated. An additional control line, previously characterized in detail for pluripotency, karyotype and ability to undergo cardiomyogenesis17 and hereafter referred to as hiPSCWT2, was also included in the analysis.
Cardiac Differentiation
Directed differentiation was used to generate hiPSC-CMs from all lines. Im- munocytochemical fluorescence staining indicated that the cells expressed the cardiac sarcomeric proteins α-actinin and troponin I (type 3; Fig. 2A). These cells exhibited the typical striation pattern of sarcomeres expected for cardiomyocytes.
The cells also stained positively for the sodium channel α-subunit Nav1.5 that was present over the whole cell surface (Fig.2B). Quantitative PCR analysis revealed that hiPSC-CMs from all lines expressed key cardiac genes that encode various ion channels including KCNH2, KCNQ1, SCN5A, HCN4 and CACNA1C while pluripotent genes such as NANOG and OCT4 were no longer expressed in these cells (Fig.2C).
Figure 2: Differentiation of hiPSC lines towards the cardiac lineage.
A. Typical examples of an immunofluorescent analysis of TNNI3 (green), α‐ACTININ (red) and Dapi (blue) in hiPSC-CMWT1, hiPSC-CMR1638Xand hiPSC-CMW156X. Lower row illustrates magnified images of regions of interest of each corresponding cell in the first row. Scale bar is 10 μm. B. Typical examples of an immunofluorescent analysis of F-actin (green), Nav1.5 (red) and Dapi (blue) in hiPSC- CMWT1, hiPSC-CMR1638Xand hiPSC-CMW156X. Lower row images illustrate the regions of interest in higher magnification. C. Analysis of qPCR data from 3 independent experiments on various cardiac and pluripotency genes in hiPSCWT1, hiPSCR1638Xand hiPSCW156X lines and in the cardiomyocytes resulting from them. The fold change expression in each sample is relative to the hiPSCWT1 sample for each gene.
Baseline electrophysiological characterization of hiPSC-CMs carrying mutations R1638X and W156X
To assess and compare the functional phenotype of hiPSC-CMs generated from each line, we measured APs and INa in single hiPSC-CMs derived from the two WT, R1638X and W156X hiPSC-lines (annotated as hiPSC-CMWT1, hiPSC- CMWT2,hiPSC-CMR1638Xand hiPSC-CMW156X, respectively). Sodium channel function has a direct impact on the fast depolarization phase (phase 0) of the AP and subsequently on the quantifiable parameter characterizing this phase, the maximal upstroke velocity (Vmax).23 Our results showed that the Vmax of hiPSC- CMR1638Xand hiPSC-CMW156X were significantly reduced when compared to the Vmax of the two controls hiPSC-CMWT1 and hiPSC-CMWT2 (Fig.3A) suggesting that both mutations reduce the function of the sodium channel in this model.
Other AP parameters such as MDP APA, APD50 and APD90 did not differ signifi- cantly between the four hiPSC-CMs lines (Fig.3A). In accordance with the Vmax
measurements, both hiPSC-CMR1638Xand hiPSC-CMW156X displayed reduced INa
densities compared to hiPSC-CMWT1 and hiPSC-CMWT2 (p<0.01) (Fig.3B-C).
On average, INa densities of the mutant channels were ≈25 to 30% of the hiPSC- CMWT (Fig. 3C, right panel). V1/2 of activation was shifted 4 mV in a positive direction in hiPSC-CMW156X and hiPSC-CMWT2 compared to the two other groups (p=0.01), while k did not differ significantly (Fig.3D). Voltage dependence of inactivation did not differ between all groups (Fig.3E).
Nonsense mediated decay in hiPSC-CMs
The presence of NMD was evaluated in hiPSC-CMsR1638X and in hiPSC-CMsW156X. In hiPSC-CMsR1638X the premature termination sequence is located more than 50 nucleotides upstream of the last exon junction point of the mRNA. Because of its location, it is predicted that NMD does not occur.4 In the case of hiPSC-CMsW156X it is predicted that the NMD mechanism leads the mRNA carrying the premature stop codon to its degradation. We generated cDNA from RNA of both samples and amplified the region surrounding the mutation by PCR. The PCR product from each sample was cloned into a TOPO vector, which was transformed to chemically competent E.coli cells.
Transformed bacterial colonies were screened and their plasmids isolated and sequenced. By sequencing a large number of clones we were able to establish the WT-mRNA/Mut-mRNA ratio in each sample. This allowed us to estimate the relative amount of Mut-mRNA that was being degraded by NMD in hiPSC- CMsW156X and hiPSC-CMsR1638X.
Figure 3: Action potential (AP) and sodium current (INa) characteristics from hiPSC-CMWT1, hiPSC- CMWT2, hiPSC-CMR1638Xand hiPSC-CMW156X.
A. Top panels, representative APs and the first derivatives of the AP upstrokes velocities. Bottom pan- els, average AP parameters for cells stimulated at 1 Hz, revealing a reduction of maximum upstroke ve- locity (Vmax)in hiPSC-CMR1638Xand hiPSC-CMW156X compared to hiPSC-CMWT1and hiPSC-CMWT2 (p<0.001., One-way ANOVA, posthoc Bonferroni test). B. Typical INa examples measured by the illustrated voltage clamp protocol. C. Left panel, current-voltage relationships of INa from hiPSC- CMWT1, hiPSC-CMWT2, hiPSC-CMR1638Xand hiPSC-CMW156X # and * indicate significant differences for hiPSC-CMR1638Xand hiPSC-CMW156X compared to hiPSC-CMWT1 and hiPSC-CMWT2, respectively (p<0.05, Two-way repeated measures ANOVA). Right panel, INa density measured at a test potential of -15 mV. D. Voltage dependence of activation. Solid lines: Boltzmann fits of average data. E. Volt- age dependence of steady-state inactivation, determined as the normalized current at a potential of -20 mV, plotted against the membrane potential during the preceding step (see inset). Solid lines:
Boltzmann fits of average data. APA, action potential amplitude; APD50 and APD90 , action poten- tial duration at 50% and 90% repolarization; MDP, maximum diastolic potential.
For hiPSC-CMR1638X, 61% of the total clones analysed (n=33) contained the mutation while for hiPSC-CMW156X the mutation was present in 19% of the clones (n=42) (p<0.05, Chi-Square test), confirming the occurrence of NMD in cells harbouring the mutation W156X (Fig.4). To validate our results, we treated hiPSC-CMsW156X with puromycin, a NMD inhibitor,24 at a concentration of 300 μg/ml for 8h. After treatment the WT-mRNA/Mut-mRNA ratio reached close to 1:1 with 51% clones (n=63) carrying the mutation, indicating that puromycin had indeed blocked the NMD mechanism.
Figure 4: NMD occurrence in patient derived hiPSC-CMs.
Percentage of clones resulting from a TOPO cloning approach that carry the WT-mRNA or the mutant-mRNA transcripts in hiPSC-CMR1638X (n=33), hiPSC-CMW156X(n=42)and hiPSC-CMW156X treated with puromycin (300 μg/ml for 8h) (n=63). The differences in WT-mRNA/mutant-mRNA ratio between each line are attributed to the presence or absence of NMD for each particular mutation.
Readthrough promoting drugs do not exert an increase in INa in hiPSC-CMR1638X and hiPSC-CMW156X
To assess readthrough efficiency of gentamicin and PTC124, we first confirmed the potency of these drugs in HEK293T cells transfected with a GFP plasmid (H2B- GFP opal) harbouring a nonsense mutation (W172X), as reported previously.20 Cells were transfected and incubated with gentamicin (0.5 mM and 1 mM) and PTC124 (17 μM and 34 μM) for 48 hours. Immunofluorescence demonstrated the presence of GFP in gentamicin- and PTC124-treated cells transfected with H2B-GFP opal, whereas untreated cells did not demonstrate any signal, indicat- ing the potency of these drugs in evoking readthrough (Fig.5A). To demonstrate that gentamicin was actually present in the nucleus of hiPSC-CMs, genes known
to be upregulated after gentamicin exposure25 were examined by quantitative PCR. GRP94, CHOP and BiP expressions were upregulated in gentamicin- treated hiPSC-CMR1638Xand hiPSC-CMW156X compared with untreated cells from the same line (Fig.5B). Moreover, we confirmed expression of the gene LRP2 (Ct values:24-25), which encodes megalin, the proposed cytoplasmic membrane receptor of gentamicin.26 Megalin expression did not change under gentamicin treatment (Supplementary Fig. 3). Because the gene response following PTC124 treatment is presently unknown, an equivalent experiment for this compound could not be performed. However, given the lipophilic nature of the drug, it would be expected to enter the cell through membrane diffusion.
Figure 5: Potency of gentamicin and PTC124 compounds.
A. Immunofluorescent analysis of GFP in HEK293T cells transfected with H2B-GFP opal in the following conditions: untreated, treated with gentamicin 0.5 mM-1 mM and treated with PTC124 17 μM-34 μM for 48h. The positive control corresponds to HEK293T cells transfected with the H2B-GFP wt plasmid. B. Analysis of qPCR data from 3 independent experiments on the gentamicin response genes of GRP94, CHOP and BiP in hiPSC-CMR1638Xand hiPSC-CMW156X after gentamicin treatment (0.5 mM-1 mM for 24h-48h).
To test the potential readthrough promoting effects of gentamicin and PTC124 in hiPSC-CMs, we measured INa in hiPSC-CMR1638Xand hiPSC-CMW156X after incubation in the presence of different concentrations of drugs. On the same day that drug-treated cells were measured, untreated or dimethyl sulfoxide-treated cells were included and used for direct comparison. Neither gentamicin at a con- centration of 0.5 mM or 1 mM for 2 days, nor PTC124 at a concentration of 17 μM for 4 days were able to induce a significant effect on maximal peak INa density compared to baseline or dimethyl sulfoxide only, respectively, in any of the groups studied (Fig.6). To rule out detrimental effects which could possibly mask the readthrough promoting effects, we also examined INa density and APs in hiPSC- CMWT2 upon drug exposure. This did not reveal significant effects of gentamicin and PTC124 on any of the studied parameters (Supplementary Fig. 4).
Figure 6: Lack of readthrough efficiency in patient derived hiPSC-CMs.
Average maximal peak INa in control (Ctrl) and drug treated cells in hiPSC-CMR1638X (left panel) and hiPSC-CMW156X (right panel). Treated cells are compared with day-matched controls. Effects of genta- micin or PTC124 were not statistically significant different from untreated or DMSO-treated controls.
Dashed lines indicate average maximal peak INa density in hiPSC-CMWT1.
Discussion
After the discovery of the readthrough-promoting effects of certain aminogly- cosides antibiotics, several studies showed beneficial effects for different types of diseases,9, 27, 28 providing proof-of-principle for eventual therapeutic application of these drugs in conditions caused by nonsense mutations. More reports followed after the development of the drug PTC124,6, 29 which is therapeutically more interesting because of the lack of side effects that complicate the use of aminogly- coside antibiotics. Here, we tested the efficacy of the aminoglycoside gentamicin and non-aminoglycoside PTC124 in hiPSC-CMs generated from patients het- erozygous for the SCN5A mutations R1638X and W156X. Mutant hiPSC-CMs
from a Brugada Syndrome patient and a patient with mild conduction disease, exhibited clear electrophysiological phenotypes expected for loss-of-function, demonstrating the validity of hiPSC-CMs as a model system for these sodium channel related cardiac disorders. However, neither gentamicin nor PTC124 treatment were capable of increasing the INa in the mutant hiPSC-CMs.
Phenotype of hiPSC-CMs carrying mutations R1638X and W156X
In accordance with the genotype of the patients, hiPSC-CMs carrying the mu- tations R1638X and W156X displayed reduced peak INa density and maximal upstroke velocity of the AP, compared with the control cell line. The maximal diastolic potential values are similar in all hiPSC lines and therefore the (voltage- dependent) availability of sodium channels in mutated hiPSC-CMs and control hiPSC-CMs does not play a role in the reduced Vmax. This is key to interpret- ing data using hiPSC-CMs as cardiac disease models; although hiPSC-CMs in general have immature electrophysiological features compared to their adult counterparts,30 there could be a degree of variation in the functional status be- tween cardiomyocytes derived from different hiPSC lines. Although this was not observed in the hiPSC-CMs generated using our cardiac differentiation protocol, the different genetic backgrounds of the control and the mutated hiPSC lines are limitations of the study. Isogenically matched controls produced by genetic repair would be better comparators.17, 31 Nevertheless, for nonsense mutations, it would be expected that translation leads to non-functional truncated proteins, resulting in haploinsufficiency, as we indeed observed in this study. Interestingly, while the clinical phenotype of the two subjects differed remarkably (one being diagnosed with Brugada Syndrome while the other exhibiting mild conduction disorder), the extent of loss-of-function in hiPSC-CMs was similar across the two groups. This indicated that other factors may be of crucial importance in the development of the phenotype. The development of conduction slowing and Brugada Syndrome, besides sodium channel function, may also be influenced by cardiomyocyte coupling (through gap junctions) and collagen deposition, which may in turn be modulated by the inheritance of other genetic factors.32, 33 In this respect, the role of oligogenic inheritance in susceptibility to these disorders is becoming increasingly clear. 34 It could also be speculated that the R1638X trun- cated channel is associated with a trafficking defect and fails to bind with interact- ing partners at the cardiomyocyte membrane, which could affect interactions of the sodium channel macromolecular complex (e.g. connexins), as opposed to the W156X which is not expressed entirely because of NMD. It should be noted however that important components contributing to sodium channel function or expression might be lacking or are different in hiPSC-CMs compared to human
adult cardiomyocytes. Studies aimed at elucidating the complete interactome of the cardiac sodium channel in hiPSC-CMs are therefore warranted.
Lack of efficiency of gentamicin and PTC124 for mutations R1638X and W156X in SCN5A
Our study showed no obvious beneficial effects of gentamicin and PTC124 in restoring protein function in hiPSC-CMs harbouring the mutations R1638X and W156X. Several factors are known to be of importance in determining the effi- ciency of readthrough promoting drugs. First, the nucleotide sequence that results in a premature stop codon affects the potency of the drugs. For both gentamicin and PTC124, a UGA sequence exhibits the highest probability of being subjected to readthrough, followed by the sequences UAG and UAA, respectively.35 Both mutations here resulted in a premature termination codon based on the most optimum sequence UGA. Apart from this, the downstream nucleotide identity has an impact on readthrough efficiency: C>U>A=G.36 The cell lines studied however did not possess the most optimal sequence (G and A for lines hiPSCR1638X and hiPSCW156X, respectively). Finally, available transcript levels of the mutant allele increase the chance of success.13 Transcript levels are determined in part by the process of NMD. Here, we evaluated two mutations, one expected to be subjected to NMD (W156X) and the other not because of its presence in the last exon of the gene (R1638X).12 We demonstrated the presence of NMD in hiPSC-CMW156X as evidenced by the low ratio of mutant:WT transcripts. This low ratio was close to one on treatment with the NMD-inhibitor puromycin.
Nevertheless, cardiomyocytes from neither mutated cell lines where responsive to treatment with the readthrough promoting drugs. The efficiencies of gentamicin and PTC124 have been demonstrated in vitro and in vivo for different types of diseases, including Duchenne’s muscular dystrophy, Usher syndrome and cystic fibrosis. Of note, all these diseases are based on (near)-complete loss of protein, as they are characterized by X-linked or homozygous inheritance patterns. Also the in vitro studies which have demonstrated the efficiency of gentamicin or PTC124 on mutations related to other types of disease, including SCN5A mutation as- sociated phenotypes,11 make use of heterologous expression systems in which the mutation is homozygously expressed. In all these studies, a small percentage of restored protein can easily be observed. In the present study, effects of gentamicin and PTC124 were studied in a heterozygous system because homozygous or com- pound heterozygous nonsense SCN5A mutation carriers are extremely rare. Small effects are possibly masked by the amount of variation we observe in the system.
However, it is doubtful whether such small effects of the readthrough promoting drugs would be of clinically relevant value.
Where premature termination is suppressed, the translational machinery inserts an amino-acid that is usually different from the WT protein. In the case of SCN5A, this may have deleterious consequences because the change in amino acid may induce a gain of function of the protein, resulting in an increase in the sustained component of INa. Increased sustained INa can cause Long QT syndrome, which is characterized by life-threatening arrhythmia and sudden cardiac death. Indeed, previous studies on readthrough of nonsense mutations in the gene KCNQ1 (encoding the channel responsible for the slow delayed rectifier potassium cur- rent) showed changes in the kinetics of the corresponding channel in response to readthrough,10 highlighting this potential risk.
In conclusion, in this study the readthrough-promoting agents PTC124 and gentamycin failed to suppress translational termination by premature stop co- dons in hiPSC-CMs carrying the mutations R1638X and W156X in SCN5A.
Although effects might be different for other mutations, therapeutic application of these agents in this patient group is, based on our experiments, predicted not to have a beneficial effect.
Acknowledgements
The authors thank Prof. Aldo Di Leonardo (STEBICEF Department, Univer- sity of Palermo, Italy) for providing the H2B-GFP plasmids, Elisa Giacomelli (Anatomy and Embryology Department, Leiden Medical University Centre) for differentiating the hiPSCWT2 line into cardiomyocytes and the iPS-core facility of Leiden Medical University Centre.
Funding sources
This work was supported by grants from the Rembrandt Institute of Cardio- vascular Science (to C.L.M and to A.A.M.W), European Research Council ERC-AdG-STEMCARDIOVASC (to C.L.M) and the Dutch Heart Foundation, CVON2012-10 Predict (to C.R.B. and A.A.W.)
Disclosures: None
Supplementary Material
Supplementary Table S1 Primers used for qPCR GeneFwd Primer (5”-3”)Rev Primer (5”-3”) TNNIIAGCATCTATAACTTGGAGGCAGAGTGGAGACTTTCTGGTTATCGTTG SCN5AGAGCTCTGTCACGATTTGAGGGAAGATGAGGCAGACGAGGA KCNJ12TGGATCCTTTCCAGTTGGTGCGGCTCCTCTTGAGTTCTATCTT KCNH2TGGGAGCTGCTTCCTATGTCTCCTTCTCCATCACCACCTC KCNQ1CGCCTGAACCGAGTAGAAGATGAAGCATGTCGGTGATGAG HCN4CAATGAGGTGCTGGAGGAGTGGTCGTGCTGGACTTTGTG CACNA1CCAATCTCCGAAGAGGGGTTTTCGCTTCAGACATTCCAGGT NANOGTGCAAGAACTCTCCAACATCCTATTGCTATTCTTCGGCCAGTT OCT4GACAGGGGGAGGGGAGGAGCTAGGCTTCCCTCCAACCAGTTGCCCCAAAC REXIACCAGCACACTAGGCAAACCTTCTGTTCACACAGGCTCCA SOX2GGGAAATGGGAGGGGTGCAAAAGAGGTTGCGTGAGTGTGGATGGGATTGGTG GAPDHTCCTCTGACTTCAACAGCGAGGGTCTTACTCCTTGGAGGC SCN5A (genotype W156X mutation)TGCCCATTTCTCTCCTATGTCCCTAGAAGGCACAACTCAA SCN5A (genotype R1638X mutation)TGGTCCTCAAACCACACTTTAACATGACGAGGAAGAGCAG SCN5A (NMD evaluation-R1638X)TCGACATTGTGACCAAGCAGACGTGGTGATCTGGAAGAGG SCN5A (NMD evaluation-W156X)CGGCTGTGAAGATTCTGGTTCAAAGGAATCGAAGCTGGTG GRP94TGGGAAGAGGTTCCAGAATGGTTGCCAGACCATCCGTACT CHOPGCGCATGAAGGAGAAAGAACCCAATTGTTCATGCTTGGTG BiPTTTCTGCCATGGTTCTCACTAAAAAACATTTAGGCCAGCAATAGTTCC LRP2GGAAAGTTGATTGCAGGGACTTGGTCACAGACATAAGCACGA
Supplementary Table S2
LUMC Nomenclature of the hiPSC-lines
Mutation LUMC designation Line
WT (control) LUMC0028iCTRL04 hiPSCWT
R1638X LUMC0029iSCN06 hiPSCR1638X
W156X LUMC0040iSCN2A hiPSCW156X
Supplementary Figure 1. Spontaneous differentiation of hiPSC lines to cell lineages of all 3 pri- mary germ layers. Typical examples of an immunofluorescent analysis of AFP (green), CD31 (red), and β3-tubulin (red), endoderm, mesoderm and ectoderm markers respectively, in cell derivatives of hiPSCWT1, hiPSCR1638Xand hiPSCW156X lines.
Supplementary Figure 2. Karyotype analysis of hiPSC lines.
Combined binary ratio (COBRA) of fluorescence in situ hybridization (FISH) labelling chromosome arms of hiPSCWT1, hiPSCR1638Xand hiPSCW156X lines.
Supplementary Figure 3.
Analysis of qPCR data from 3 independent experiments on megalin (LRP2) expression in hiPSC- CMR1638Xand hiPSC-CMW156X after gentamicin treatment (0.5 mM-1 mM for 24h-48h).
Supplementary Figure 4. Effects of 1 mM gentamicin (incubated 2 days, panel A,C) and 17 μM PTC124 (incubated 4 days, panel B,D) on peak sodium current (INa, panel A,B) and action poten- tial parameters (panel C,D) on hiPSC-CMWT2.
Comparisons were made with no treatment and DMSO for gentamicin and PTC124, respectively.
No significant effects were observed. APA, action potential amplitude; APD50 and APD90 , action potential duration at 50% and 90% repolarization; MDP, maximum diastolic potential.
References
1. Amin AS, Tan HL, Wilde AA. Cardiac ion channels in health and disease. Heart rhythm : the official journal of the Heart Rhythm Society. 2010;7:117-126
2. Remme CA. Cardiac sodium channelopathy associated with SCN5A mutations: Electrophysiological, molecular and genetic aspects. The Journal of physiology. 2013;591:4099-4116
3. Keeling KM, Xue X, Gunn G, Bedwell DM. Therapeutics based on stop codon readthrough. Annual review of genomics and human genetics. 2014;15:371-394
4. Lee HL, Dougherty JP. Pharmaceutical therapies to recode nonsense mutations in inherited diseases.
Pharmacology & therapeutics. 2012;136:227-266
5. Bidou L, Allamand V, Rousset JP, Namy O. Sense from nonsense: Therapies for premature stop codon diseases. Trends in molecular medicine. 2012;18:679-688
6. Peltz SW, Morsy M, Welch EM, Jacobson A. Ataluren as an agent for therapeutic nonsense suppression.
Annual review of medicine. 2013;64:407-425
7. Hirawat S, Welch EM, Elfring GL, Northcutt VJ, Paushkin S, Hwang S, Leonard EM, Almstead NG, Ju W, Peltz SW, Miller LL. Safety, tolerability, and pharmacokinetics of PTC124, a nonaminoglycoside nonsense mutation suppressor, following single- and multiple-dose administration to healthy male and female adult volunteers. Journal of clinical pharmacology. 2007;47:430-444
8. Yu H, Liu X, Huang J, Zhang Y, Hu R, Pu J. Comparison of read-through effects of aminoglycosides and PTC124 on rescuing nonsense mutations of HERG gene associated with Long QT syndrome.
International journal of molecular medicine. 2014;33:729-735
9. Yao Y, Teng S, Li N, Zhang Y, Boyden PA, Pu J. Aminoglycoside antibiotics restore functional expression of truncated HERG channels produced by nonsense mutations. Heart rhythm : the official journal of the Heart Rhythm Society. 2009;6:553-560
10. Harmer SC, Mohal JS, Kemp D, Tinker A. Readthrough of Long-QT syndrome type 1 nonsense muta- tions rescues function but alters the biophysical properties of the channel. The Biochemical journal.
2012;443:635-642
11. Teng S, Gao L, Paajanen V, Pu J, Fan Z. Readthrough of nonsense mutation W822x in the SCN5A gene can effectively restore expression of cardiac Na+ channels. Cardiovascular research. 2009;83:473-480 12. Schweingruber C, Rufener SC, Zund D, Yamashita A, Muhlemann O. Nonsense-mediated mRNA
decay - mechanisms of substrate mRNA recognition and degradation in mammalian cells. Biochimica et biophysica acta. 2013;1829:612-623
13. Linde L, Boelz S, Nissim-Rafinia M, Oren YS, Wilschanski M, Yaacov Y, Virgilis D, Neu-Yilik G, Kulozik AE, Kerem E, Kerem B. Nonsense-mediated mRNA decay affects nonsense transcript levels and governs response of cystic fibrosis patients to gentamicin. The Journal of clinical investigation.
2007;117:683-692
14. Mummery CL, Zhang J, Ng ES, Elliott DA, Elefanty AG, Kamp TJ. Differentiation of human embry- onic stem cells and induced pluripotent stem cells to cardiomyocytes: A methods overview. Circulation research. 2012;111:344-358
15. Savla JJ, Nelson BC, Perry CN, Adler ED. Induced pluripotent stem cells for the study of cardiovascular disease. Journal of the American College of Cardiology. 2014;64:512-519
16. Davis RP, Casini S, van den Berg CW, Hoekstra M, Remme CA, Dambrot C, Salvatori D, Oostwaard DW, Wilde AA, Bezzina CR, Verkerk AO, Freund C, Mummery CL. Cardiomyocytes derived from pluripotent stem cells recapitulate electrophysiological characteristics of an overlap syndrome of cardiac sodium channel disease. Circulation. 2012;125:3079-3091
17. Zhang M, D’Aniello C, Verkerk AO, Wrobel E, Frank S, Ward-van Oostwaard D, Piccini I, Freund C, Rao J, Seebohm G, Atsma DE, Schulze-Bahr E, Mummery CL, Greber B, Bellin M. Recessive cardiac phenotypes in induced pluripotent stem cell models of Jervell and Lange-Nielsen syndrome: Disease mechanisms and pharmacological rescue. Proceedings of the National Academy of Sciences of the United States of America. 2014;111:E5383-5392
18. Dambrot C, Buermans HP, Varga E, Kosmidis G, Langenberg K, Casini S, Elliott DA, Dinnyes A, Atsma DE, Mummery CL, Braam SR, Davis RP. Strategies for rapidly mapping proviral integration sites and assessing cardiogenic potential of nascent human induced pluripotent stem cell clones. Experimental cell research. 2014;327:297-306
19. Kanda T, Sullivan KF, Wahl GM. Histone-GFP fusion protein enables sensitive analysis of chromosome dynamics in living mammalian cells. Current biology : CB. 1998;8:377-385
20. Lentini L, Melfi R, Di Leonardo A, Spinello A, Barone G, Pace A, Palumbo Piccionello A, Pibiri I.
Toward a rationale for the PTC124 (ataluren) promoted readthrough of premature stop codons: A computational approach and GFP-reporter cell-based assay. Molecular pharmaceutics. 2014;11:653-664 21. Nishimura K, Sano M, Ohtaka M, Furuta B, Umemura Y, Nakajima Y, Ikehara Y, Kobayashi T, Segawa H, Takayasu S, Sato H, Motomura K, Uchida E, Kanayasu-Toyoda T, Asashima M, Nakauchi H, Yamaguchi T, Nakanishi M. Development of defective and persistent sendai virus vector: A unique gene delivery/expression system ideal for cell reprogramming. The Journal of biological chemistry.
2011;286:4760-4771
22. Muller FJ, Schuldt BM, Williams R, Mason D, Altun G, Papapetrou EP, Danner S, Goldmann JE, Herbst A, Schmidt NO, Aldenhoff JB, Laurent LC, Loring JF. A bioinformatic assay for pluripotency in human cells. Nature methods. 2011;8:315-317
23. Berecki G, Wilders R, de Jonge B, van Ginneken AC, Verkerk AO. Re-evaluation of the action potential upstroke velocity as a measure of the Na+ current in cardiac myocytes at physiological conditions. PloS one. 2010;5:e15772
24. Noensie EN, Dietz HC. A strategy for disease gene identification through nonsense-mediated mRNA decay inhibition. Nature biotechnology. 2001;19:434-439
25. Oishi N, Duscha S, Boukari H, Meyer M, Xie J, Wei G, Schrepfer T, Roschitzki B, Boettger EC, Schacht J. XBP1 mitigates aminoglycoside-induced endoplasmic reticulum stress and neuronal cell death. Cell death & disease. 2015;6:e1763
26. Dagil R, O’Shea C, Nykjaer A, Bonvin AM, Kragelund BB. Gentamicin binds to the megalin recep- tor as a competitive inhibitor using the common ligand binding motif of complement type repeats:
Insight from the NMR structure of the 10th complement type repeat domain alone and in complex with gentamicin. The Journal of biological chemistry. 2013;288:4424-4435
27. Kuschal C, DiGiovanna JJ, Khan SG, Gatti RA, Kraemer KH. Repair of uv photolesions in xeroderma pigmentosum group c cells induced by translational readthrough of premature termination codons.
Proceedings of the National Academy of Sciences of the United States of America. 2013;110:19483- 19488
28. Nakamura K, Du L, Tunuguntla R, Fike F, Cavalieri S, Morio T, Mizutani S, Brusco A, Gatti RA.
Functional characterization and targeted correction of atm mutations identified in japanese patients with ataxia-telangiectasia. Human mutation. 2012;33:198-208
29. Kerem E, Hirawat S, Armoni S, Yaakov Y, Shoseyov D, Cohen M, Nissim-Rafinia M, Blau H, Rivlin J, Aviram M, Elfring GL, Northcutt VJ, Miller LL, Kerem B, Wilschanski M. Effectiveness of PTC124 treatment of cystic fibrosis caused by nonsense mutations: A prospective phase ii trial. Lancet (London, England). 2008;372:719-727
30. Veerman CC, Kosmidis G, Mummery CL, Casini S, Verkerk AO, Bellin M. Immaturity of human stem-cell-derived cardiomyocytes in culture: Fatal flaw or soluble problem? Stem cells and development.
2015;24:1035-1052
31. Bellin M, Casini S, Davis RP, D’Aniello C, Haas J, Ward-van Oostwaard D, Tertoolen LG, Jung CB, Elliott DA, Welling A, Laugwitz KL, Moretti A, Mummery CL. Isogenic human pluripotent stem cell pairs reveal the role of a KCNH2 mutation in Long-QT syndrome. The EMBO journal. 2013;32:3161- 3175
32. Nademanee K, Raju H, de Noronha SV, Papadakis M, Robinson L, Rothery S, Makita N, Kowase S, Boonmee N, Vitayakritsirikul V, Ratanarapee S, Sharma S, van der Wal AC, Christiansen M, Tan HL, Wilde AA, Nogami A, Sheppard MN, Veerakul G, Behr ER. Fibrosis, connexin-43, and conduction abnormalities in the Brugada syndrome. Journal of the American College of Cardiology. 2015;66:1976- 1986
33. Hoogendijk MG, Potse M, Linnenbank AC, Verkerk AO, den Ruijter HM, van Amersfoorth SC, Klaver EC, Beekman L, Bezzina CR, Postema PG, Tan HL, Reimer AG, van der Wal AC, Ten Harkel AD, Dalinghaus M, Vinet A, Wilde AA, de Bakker JM, Coronel R. Mechanism of right precordial st-segment elevation in structural heart disease: Excitation failure by current-to-load mismatch. Heart rhythm : the official journal of the Heart Rhythm Society. 2010;7:238-248
34. Bezzina CR, Lahrouchi N, Priori SG. Genetics of sudden cardiac death. Circulation research.
2015;116:1919-1936
35. Welch EM, Barton ER, Zhuo J, Tomizawa Y, Friesen WJ, Trifillis P, Paushkin S, Patel M, Trotta CR, Hwang S, Wilde RG, Karp G, Takasugi J, Chen G, Jones S, Ren H, Moon YC, Corson D, Turpoff AA, Campbell JA, Conn MM, Khan A, Almstead NG, Hedrick J, Mollin A, Risher N, Weetall M, Yeh S, Branstrom AA, Colacino JM, Babiak J, Ju WD, Hirawat S, Northcutt VJ, Miller LL, Spatrick P, He F, Kawana M, Feng H, Jacobson A, Peltz SW, Sweeney HL. PTC124 targets genetic disorders caused by nonsense mutations. Nature. 2007;447:87-91
36. Howard MT, Shirts BH, Petros LM, Flanigan KM, Gesteland RF, Atkins JF. Sequence specificity of aminoglycoside-induced stop condon readthrough: Potential implications for treatment of duchenne muscular dystrophy. Annals of neurology. 2000;48:164-169
