Molecular target validation of Aspartate Transcarbamoylase from Plasmodium falciparum by Torin 2
Soraya S. Bosch1,2‡, Sergey Lunev2‡, Fernando A. Batista2‡, Marleen Linzke1, Thales Kronenberger3, Alexander S. S. Dömling2, Matthew R. Groves2* and Carsten Wrenger1*
1: Unit for Drug Discovery, Department of Parasitology, Institute of Biomedical Sciences, University of São Paulo, Avenida Professor Lineu Prestes 1374, São Paulo – SP 05508-000, Brazil
2: Structural Biology Unit, XB20 Drug Design, Department of Pharmacy, University of Groningen, Antonius Deusinglaan 1, 9700 AD, Groningen, The Netherlands
3: Department of Internal Medicine VIII, University Hospital Tübingen, Otfried-Müller-Strasse 14, 72076 Tübingen, Germany
ABSTRACT
Malaria is a tropical disease that kills about half a million people all around the world annually. Enzymatic reactions within the pyrimidine biosynthesis have been proved proven to be essential for Plasmodium proliferation. Here we report on the essentiality of the second enzymatic step of the pyrimidine biosynthesis pathway, catalysed by Aspartate Transcarbamoylase (ATC). Crystallisation experiments using a double mutant PfATC revealed the importance of the mutated residues for enzyme catalysis. Subsequently, this 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
mutant has been employed in Protein interference assays (PIA) which resulted in an alteredinhibition of parasite proliferation of the parasite. In vitro and whole-cell assays in the presence of the compound Torin2 have shown inhibition of specific activity and parasites’ growth, respectively, with the significantly higher EC50 of the later confirming strongly suggesting that this drug possesses multiple targets. In silico analyses revealed the potential binding mode of the compound Torin 2 to PfATC. Furthermore, a transgenic ATC overexpressing cell line exhibited a 10-fold increased tolerance to Torin 2 compared to the control cultures. Taken together, our results confirm the antimalarial activity of Torin2, suggesting PfATC as a target of this drug and a promising target for the development of novel antimalarials.
INTRODUCTION
Malaria remains one of the most deadly and neglected diseases nowadays, with five parasitic species affecting humans , - of which Plasmodium falciparum is the most aggressive, being and responsible for most of the malaria deaths. Plasmodium parasites rely on the de novo pyrimidine biosynthesis pathway for proliferation. Malaria parasites lack the de novo purine synthesis pathway and salvage host-cell purines for growth (1,2). All the enzymes that compose the de novo pyrimidine synthesis were found in Plasmodium genomes (3). Due to the lack of salvage enzymes, the parasite depends exclusively on the de novo pathway as a source of pyrimidines for survival (4–6). With the pyrimidine nucleotide being involved, besides the in DNA replication, in the biosynthesis of 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41
RNA, phospholipids, and glycoproteins in Plasmodium species (7,8), the plasmodial pyrimidine biosynthesis pathway was, unsurprisingly, found to be a promising target in antimalarial research (9). The pathway consists of six enzymes that yield UMP, the precursor of the remaining pyrimidines (Figure 1). The fourth enzyme of the pathway, dihydroorotate dehydrogenase (PfDHODH), has been proposed as a potential drug target more than a decade ago (10) and first inhibitors have beenwere reported a few years later (11). Inhibition of this enzyme has already been shown to be lethal to the parasite (12).
Aspartate transcarbamoylase (ATC, EC 2.1.3.2) is located upstream of PfDHODH within the pyrimidine biosynthetic pathway (Fig. 1). The enzyme catalyses the condensation of carbamoyl-phosphate (CP) and L-aspartate to form N-carbamoyl-L-aspartate (CA) and phosphate. The ATC from Escherichia coli (EcATC) has been extensively studied and found to beused as a paradigm of feedback inhibition and a model of cooperativity and allosteric regulation (13,14). The basic catalytic conformation of this enzyme is composed of three subunits, and the native oligomeric conformation might form a trimer or a hexamer depending on the organism to which it belongs (15,16). An interesting characteristic among these enzymes is that the active site is formed on the interface of two subunits and both polypeptide chains contribute to the active site (17). Nonetheless, a gene encoding for the regulatory subunit was not found in the P. falciparum genome.
The structure of PfATC has already been characterized by our groupus, in both apo T-state (18) and ligand-bound R-state (19). Furthermore, based on the mutagenic studies of EcATC summarized by Lipscom et al. (20) and with the structural information obtained by us, a mutant PfATC with significantly reduced catalytic activity was designed, and the in vitro 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63
activity of wild-type and a this double mutant (PfATC-R109A/K138A) was previously reported (18). In this manuscript, the crystal structure of the double mutant PfATC-R109A/K138A (hereby called RK) is reported. We also report on the effect of mutant RK introduction in cultured P. falciparum parasites submitted to Protein Interference Assay (PIA) (21), a novel and alternative methodology that exploits oligomeric surfaces distortion (22).
In the literature, the compound N-phosphonacetyl-L-aspartate (PALA) is described as a potent inhibitor of ATCs (23,24). This compound combines the features of the two substrates and resembles the transition state of the reaction. Inhibition is described as competitive concerning with CP and non-competitive concerning with aspartate. PALA has been used in co-crystallization experiments with ATCs of several organisms, such as the E. coli and human proteins (25–27). In the 70s several studies demonstrate that PALA can inhibit human CAD – a multifunctional polypeptide composed of CPSase, ATC and DHOase (28) and stop the proliferation of cancer cells in culture (29). Indeed, PALA demonstrated a broad spectrum of activity against experimental tumour models and its biochemical and pharmacological effects were well characterized. Phase I trials were followed by a broad Phase II screening for antitumor activity. Unfortunately, PALA was inactive as a single agent (30).
A few years ago, a new potent antimalarial, Torin 2, was described (31). Initial studies revealed EC50 values against asexual blood stages at low nanomolar range with a 1,000-fold selectivity against the parasites compared to mammalian cells (32). Additionally, it has been reported that Torin 2 binds to three P. falciparum proteins, aspartate 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85
transcarbamoylase (PfATC), phosphoribosylpyrophosphate synthetase (PF3D7_1325100, PfPRS), and a putative transporter (PF3D7_0914700) (32).
In this manuscript, we report the inhibitory effect of Torin 2 on the specific activity of purified PfATC and the decreased antimalarial activity in P. falciparum cultures overexpressing WT-PfATC. These results strongly suggestsupport the identification of PfATC as one of the Torin 2 targets of Torin 2, while the comparison of potency between purified PfATC and whole-cell confirms indicates Torin 2 as posses a multi-target compoundpleiotropy.
RESULTS
Active site mutations result in significantly altered PfATC kinetic properties
In this study, the kinetic properties of the previously described (18) PfATC-Met3-RK mutant have been investigated (33). At a fixed concentration of L-aspartate (1 mM) and a gradient of CP (0.08 – 20 mM) the double mutant PfATC-Met3-RK showed non-cooperative behaviour interpreted as a Michaelis-Menten curve with determined Vmax- and Km-values of CP of 3.52 ± 0.12 μmol mg-1 min-1 and 7.9 ± 0.6 mM, respectively (Figure 3a). Similarly, at fixed CP concentration (2 mM) and a gradient of L-aspartate (0.04 – 20 mM), PfATC-Met3-RK also showed Michaelis-Menten kinetics with Vmax-value of 0.97 ± 0.07 μmol mg-1min-1 and Km-value of 9.1 ± 1.4 mM L-aspartate (Figure 3b). These parameters also differ from previously reported cooperative (under 1 mM L-asp) kinetics of the wild type PfATC-Met3 (19) with significant substrate inhibition at L-aspartate concentrations above 1 mM. At 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106
low-millimolar concentrations of CP and L-aspartate (both 1 mM) the double mutant PfATC-Met3-RK was significantly less active (0.1-0.3 μmol mg-1 min-1) compared to the wild type (approx. 10 μmol mg-1 min-1 (18,19)).
Plasmodial ATC is a trimer in solution
In order to analyse the oligomeric state of the wild-type PfATC-Met3 as well as the mutant version, PfATC-Met3-RK, Static Light Scattering (SLS) experiments were performed. The measured molecular weights for the wild-type PfATC-Met3 and PfATC-Met3-RK were 121.4 ± 0.8 kDa and 111.9 ± 1.95 kDa, respectively, and are consistent with a trimeric assembly. These data indicate that the R109A and K138A mutations did not affect the native oligomeric assembly of the enzyme.
Moreover, the PfATC-Met3 and PfATC-Met3-RK samples eluted as a single peak with the retention volume of 15.2 and 16.8 ml, respectively, being characterized as a monodisperse (Mw/Mn = 1.00 and 1.002, respectively) trimer.
In order to assess the effect of the active site mutations on the structure of PfATC, the mutated PfATC-Met3-RK was recombinantly expressed, purified and crystallised. Similarly to the wild-type, mutant crystals appeared overnight in identical crystallisation conditions (18). Analysis of the electron density in the active site area revealed additional electron density that was interpreted as bound CP molecules (Figure 2a). The CP domain of the crystal structure of E. coli ATC bound to CP (PDB 1ZA2 (34)) was superimposed with the CP domain PfATC-Met3-RK structure reported in this study. While the CP molecules in both 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127
structures occupied similar locations (0.7 Å between the phosphate atoms), the positions of the amide-groups were quite different distinct (2.9 Å between the amine groups).
Two out of three active sites in the PfATC-Met3-RK structure contained the CP molecules; however, there was no insufficient electron density to model the loops 297-311 from the Asp-domains as well as the catalytic loops 130-141 from the adjacent subunits. Interestingly, based on the presence of the electron density, both loops have been modelled in the third subunit lacking the presence of CP (Figure 2b). No further conformational differences have been observed between the subunits.
Superposition of the CP-binding domains of PfATC-Met3-RK (PDB 6HL7) and the apo-structure PfATC-met3 (5ILQ) showed that the aspAsp-binding domain of the PfATC-Met3-RK structure was shifted approx. 3 Å towards the CP-domain (Figure 2c), similarly to the position of Asp-domain in the citrate-bound structure representing the R-state (5ILN) (Figure 2d).
Mutant PfATC copies can be incorporated into the native assembly after recombinant expression in E. coli
In order to analyse the ability of the wild-type PfATC to bind its mutant variant PfATC-Met3-RK in vitro, a pull-down assay was performed. Recombinant PfATC-Met3 (Strep-tag at the C-terminus) and PfATC-Met3-RK (His6-tag at the C-terminus) were expressed separately in E. coli and the mixed lysates were purified by either Strep-tactin (IBA Life sciences) or Ni-NTA chromatography (Qiagen). Subsequently, the purified proteins from 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148
both elutions were mixed, incubated for one hour and sequentially purified only by Strep-tactin chromatography. The resulting elution fraction was concentrated and analysed by Western Blot, confirming the presence of both Strep- and His6-tagged species (Figure 4). The presence of his tagged species pulled by Strep purification confirms that the wild-type PfATC and the RK double mutant can form hetero-complexes in solution.
Protein Interference Assay (PIA) reveals a significant reduction in parasitaemia in minimal culture media after the introduction of PfATC and PfAspAT mutants.
In this work, we report the proliferation curves of P. falciparum parasites transfected with a plasmid encoding full a R109A/K138A mutant version of PfATC R109A/K138A as well as a double-transfected parasite cell line expressing PfAspAT-Y18A/R257A/PfATC-R109A/K138A mutants, in minimal and normal RPMI media. As the transcription of the introduced construct hosting a mutated PfATC-RK leads to an excess of the mutant protein compared to the native endogenous protein, it is not unreasonable to hypothesize that a significant proportion of the expressed PfATC would contain at least a single copy of the mutant protein within the trimeric assembly. Furthermore, considering that the introduced mutations would affect two interfaces at the same time (Figure 5), the presence of one mutant copy in the PfATC trimer would significantly decrease its catalytic function.
Single transfection 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168
The proliferation profiles of the parasitic cell lines expressing additional PfATC-RK mutant as well as control (BSD Mock) show no difference in growth when cultivated in normal RPMI media (Figure 6a). These data show that there are no significant negative effects of introducing neither the expression plasmids nor the mutant protein in terms of effects on parasite growth. However, a drop in parasitaemia can be observed in the minimal media that has not been supplemented with additional aspartate to mimic physiological conditions (Figure 6a). Addition of 20 nM and 20 µM of aspartate did not significantly change significantly the growth profile of the PfATC-RK transfected parasites (figures 6c and 6d).
Double transfection
The proliferation curves of transgenic cell lines expressing PfAspAT Y68A/R257A (PfAspAT-YR) have been previously characterized (35). The proliferation curves of a double transgenic cell line expressing PfAspAT-YR and PfATC-RK mutants have been generated and compared in Protein Interference Assays to the control parasites harbouring the respective double transfected mock constructs. The PfAspAT-YR mutant species possesses no aspartate aminotransferase activity (35). Formation of a heterocomplex between WT endogenous protein and transfected YR mutant results in a significant reduction of aspartate biosynthesis in vitro and whole-cell (35). The co-transfection of PfAspAT-YR and PfATC-RK would, theoretically, reduce the provision of aspartate which is subsequently used by the PfATC. Proliferation assays in normal media do not show any difference to the 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189
control cell line (Figure 6b). When performing the same experiment in minimal media a clear phenotype has been observed with almost no parasite proliferation after 10 days. These data suggest an essential role of PfATC for parasite’s viability, reinforce the role aspartate in parasites’ viability and suggests a link between aspartate biosynthesis and the essentiality of the de-novo pyrimidine biosynthesis pathway.
Evaluation of the presence of ATC transcripts and protein in the transgenic cell lines
The PfATC overexpression in the single- and double-transfected cell lines compared to the mock control was determined by quantitative real-time polymerase chain reaction (qRT-PCR) and western blot analysis. The PfATC mRNA levels in all three transgenic cell lines exhibited an increase of approximately 1.5-fold compared to the endogenous PfATC in the control mock cell lines (Figure 7b). Additionally, the presence of the Myc-tagged PfATC (Wild-type or mutant) has been verified in parasite cell extract via Western Blot analysis (Figure 7c). Further, western blot analysis using specific primary antibodies allowed for relative quantification of PfATC overexpression. PfATC-WT and RK exhibited 8 and 10-fold excess protein expression, respectively (Figure 7d)
In vitro and whole-cell inhibition of plasmodial aspartate transcarbamoylase 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208
As above mentioned above, PALA is a well-known inhibitor of ATCs (25–27). We analysed the inhibitory potential of PALA against the recombinantly expressed PfATC. An IC50-value of 160 ± 28 µM was calculated. Although the determined IC50-value at the enzymatic level was not promising, PALA was also tested at the cellular level by performing dose-response assays. The EC50-value of 662 ± 10 µM against cultured P. falciparum 3D7 confirmed the low potency of this compound.
Recently, Hanson and collaborators reported that the small molecule Torin 2 is highly potent against the sexual and asexual stages of the plasmodial parasites (31). Since a previous report has claimed PfATC as a potential target of this compound (32), dose-response activity assays of recombinantly expressed PfATC in the presence of Torin 2 have been performed and an IC50-value of 67.7 ± 6.6 µM was calculated measured (Figure 8a).
In order to assess the effects of Torin 2 at cellular level, drug assays have been performed against the transgenic PfATC over-expressing parasites and compared to the respective mock cell line. The dose-response profile revealed EC50-values of 0.445 ± 0.087 nM and 0.024 ± 0.005 nM, respectively (Figure 8b). Evaluation of chloroquine effect on the ATC-RK overexpressing parasites was used as control (Figure 8c). WT 3D7, MOCK and AspAT-RK cell lines did not exhibit significant differences in terms of EC50 (11 nM, 15 nM and 11 nM, respectively). These results reveal a clear protective effect of additional PfATC protein against Torin 2, indicating identifying PfATC as one of the molecular targets of Torin 2 and suggest a druggable potential for PfATC.
209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228
Corroborating the proposed mechanism, molecular modelling, encompassing docking within the active site of PfATC (PDB 5ILN) [16] followed by a short molecular dynamics simulation, was employed in the evaluation of the potential binding mode of Torin 2 to PfATC (Figure 9a). After the simulation, the suggested binding mode presented hydrogen-bonding interactions between the side-chain amino-acids Arg295 and the main-chain of Lys138 with the amino group substituting the pyridine ring (Figure 9b), together with the interaction between His187 and the oxygen atom of the carbonyl group, which remained stable during the simulation (Figure 9c). Additionally, transient supporting polar contacts between the Arg159 and the nitrogen from the three-membered ring could be observed.
DISCUSSION
Due to the increase in the selection of P. falciparum resistant strains, there is an urgent necessity need for new drug targets that would support the rational development of new antimalarial compounds. The recently described Protein Interference Assay (PIA) provides a clear strategy for highly specific interference with the function of the target protein in vitro. PIA can be applied to systems where drug target validation was shown to be challenging due to the lack of efficient probe tools or low efficiency of the standard techniques (e.g. RNAi/knock-in/out) in Plasmodium parasites (21). A lTypically low similarity of the oligomeric surfaces provides an opportunity for highly specific targeting. Even Although the PIA approach is indeed limited to oligomeric targets, it can still be used for drug-target validation of pathways of interest.
229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249
Recently, we have shown that transgenic P. falciparum parasites expressing additional copies of mutated mutant malate dehydrogenase (PfMDH) (22) and aspartate aminotransferase (PfAspAT) were significantly less viable in aspartate-limited media compared to control cultures. These data confirm the malate-aspartate interconversion pathway of P. falciparum as essential for parasite survival (35).
In this manuscript, we show that PIA can be applied to support demonstrate the essentiality of aspartate transcarbamoylase (PfATC) of P. falciparum. We also show that inhibition of PfATC by Torin 2 can be measured at the recombinant enzymatic level. Finally, protection against PfATC is observed in transgenic parasites that overexpress PfATC reinforcing this enzyme as a potential drug target.
In previous publications, we reported and characterized a mutated form of PfATC, which harbours crucial point mutations in the active site (R109A and K138A) resulting in significantly reduced activity. Here, we report on the loss of the cooperativity as well as substrate inhibition of the RK mutant compared to the wild-type enzyme (Figure 3). Furthermore, we have shown that mutant PfATC-Met3-RK species could be co-purified with the wild-type enzyme post expression in vitro, suggesting the ability of the mutants to recombine with the wild-type PfATC and form a heterocomplex (Figure 5).
Analysis of the crystal structure of PfATC-Met3-RK (PDB 6HL7) provided evidence that the introduced active site mutations did not disrupt the folding of the enzyme (Figure 2). PfATC-Met3-RK mutant also retained the trimeric assembly, as further confirmed by Static Light Scattering (SLS) experiments. These data suggest that the presence of a single mutant 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270
copy of PfATC-Met3-RK in the ATC heterocomplex would disturb the correct function of two out of the three active sites (Figure 5), thus significantly interfering with the overall activity of the trimer.
In order to evaluate PfATC essentiality, PIA experiments have been designed by generating a transgenic strain of P. falciparum which overexpresses the mutant PfATC-RK (Figure 7d). In minimal media, used to mimic biological conditions, the parasites expressing additional mutated PfATC exhibited a significant growth delay compared to the control cell line (Figure 6a). It is important to remark note that the PIA approach is unable to provide a complete knockout effect since the heterocomplex formation is unlikely to affect all wild-type subunits. Besides and that, the mutant ATC species retains residual activity (Figure 3). Simultaneous PIA deactivation of both PfATC and PfAspAT had significantly more pronounced effect on the proliferation of the parasite in non-aspartate supplemented media (Figure 6b). One of the possible explanations for the augmented growth deficiency induced by the introduction of the two dominant-negative mutants is the role of aspartate as a necessary precursor of pyrimidine biosynthesis. As above mentioned, we have recently reported the PIA analysis of the enzymes AspAT and MDH of P. falciparum (35). In this previous publication, we demonstrated that, when cultivated in aspartate-limited media (the same conditions used for the herein described PfATC analysis), parasites transfected with both mutants presented a significant growth defect compared to control or single transfected parasites. These results suggested that, although inhibition of AspAT or MDH alone is not sufficient to hamper parasites’ growth, future drug targets to treat malaria could be found within downstream components of the aspartate metabolism 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292
pathway (35). As stated above, ATC uses the aspartate, captured from serum/haemoglobin or synthesised by AspAT, and carbamoyl phosphate to form N-carbamyl-L-aspartate and inorganic phosphate in the second step of the pyrimidine biosynthesis (13,14). Aspartate is known to be the least common of all the amino acids available within the human serum (36). Moreover, although aspartate is available in haemoglobin, which is used as a source of amino acids (except isoleucine) during the blood-stage (37), the PIA experiments on AspAT and MDH enzymes suggest insufficiency of this source to support the rapid proliferation of the parasite (35). Therefore, a functional aspartate biosynthesis is likely to be a key element for the maintenance of P. falciparum in human red blood cells. Our analysis suggests PfATC as a possible the link between the essentiality of aspartate mentalism and pyrimidine biosynthesis. However, indirect mechanisms of proliferation inhibition such as interference with glutamate biosynthesis and nitrogen excretion pathways cannot be discardedexcluded, since supplementation of minimal media with 20 nM and 20 µM of aspartate did not result in a significant increase in parasites’ viability.
In contrast to earlier reports, PALA revealed a poor inhibitory profile against the plasmodial ATC in vitro and whole-cell assays. As previously suggested, Torin 2 is highly active against the sexual and asexual stages of the plasmodial parasites (EC50-values of 6.62 nM and 1.4 nM respectively) (31) and might targetinhibits the plasmodial ATC (32). In order to validate PfATC as one of the molecular targets of Torin 2, enzymatic assays against the plasmodial ATC have been carried out, revealing an IC50-value of 67 µM. The difference in potency of specific activity inhibition and the proliferation inhibition, the latter being significantly higher than the former, is in agreement with previous studies of Torin2 in 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314
malaria. When reporting the development of Torin2 and its potency against Plasmodium, Sun et al. described that, attachment of the compoundTorin 2 to a specific matrix could bindenriched 3 proteins after running afrom the lysate of gametocytes of P. falciparum, PfATC being one of them (38). The massively significantly higher potency of this compound in whole-cell assays suggests that Torin2 indeed may binds and inhibits other targets, causing a synergistic effect. In order to obtain stronger evidence of the role of PfATC in Torin 2 antimalarial activity, we performed whole-cell drug assays against Torin 2, comparing the proliferative inhibition in control cultures to our transgenic cell line that overexpresses PfATC. qPCR and western-blot analysis confirmed the overexpression of PfATC-RK on transcription and protein level respectively (Figure 7). A clear protective effect has been observed as a consequence of the overexpression of the PfATC in the parasite. The 10-fold increased EC50-value reinforces PfATC as part of the antiproliferative effect of Torin 2 likely due to inhibition of the pyrimidine biosynthesis pathway. Control experiments performed with another well-known antimalarial compound, chloroquine, did not result in improved viability of the similarly transfected parasites, strengthening the role ofsuggesting that overexpression of PfATC in the observed increased protection against Torin 2confers no proliferative benefits to the parasite. These data represent an important step towards the deconvolution of the antimalarial mechanism of this compound. BesidesFinally, our results reinforce the pyrimidine biosynthesis as a druggable pathway and support the essentiality of PfATC. Moreover, the successful assessment of PfATC by PIA consolidates the potential of this technique to integrate the currentas a strategy for antimalarial target validation.
315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336
CONCLUSION
In this manuscript, the essentiality of the plasmodial aspartate transcarbamoylase (ATC) has been analysed. Crystal structure analysis of the mutated plasmodial ATC revealed the importance of the residues R109 and K138 for the formation of the active sites located on the interfaces of two subunits. These active-site mutations do not influence the protein assembly and thereby enabled analysis study by the recently developed Protein Interference Assays (PIA). The respective knockdown phenotype strongly suggests the dependence of P. falciparum on ATC for rapid proliferation. Moreover, the investigation of PfATC as a potential target of the powerful antimalarial compound Torin 2 revealed the involvement of this enzyme in the antiproliferative mechanism of this drug. Further, comparison of specific activity inhibition and whole-cell effect indicates that PfATC is unlikely the only target of Torin 2, and thus, further investigation is necessary to clarify its complete inhibitory routeother interactions. Taken together, our findings validate the plasmodial ATC as an essential enzyme supporting P. falciparum proliferation. Alongside with the already well-established and validated DHODH within the same pathway, PfATC has potential to be targeted in the rational development of novel antimalarial drugs.
MATERIALS AND METHODS
Cloning of plasmodial aspartate transcarbamoylase. 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356
Cloning of full-length PfATC, as well as the truncated and mutated variants, for recombinant bacterial expression, was performed as previously described (18). The resulting pASK-IBA3-based plasmids encoded the full-length PfATC, as well as truncated and mutant variants in frame with a C-terminal Strep-tag. In order to perform pull-down experiments, a construct encoding PfATC-Met3-RK with C-terminal His6-tag was cloned using sequence-specific primers (Table 1).
Furthermore, full-length PfATC, as well as PfATC-R109A/K138A-full genes, were sub-cloned into the P. falciparum transfection plasmid pARL+ using sequence-specific primers (Table 1) and KpnI and AvrII restriction enzymes (New England Biolabs). The resulting constructs PfATC-Myc and PfATC-RK-Myc encoded the full-length PfATC and its RK-mutant, respectively, with Myc-tag at the C-terminus. All resulting constructs have been confirmed by sequencing.
Table 1. Primers used in this study
Name
(Restriction site)
Primer sequence
Recombinant expression (E. coli)
PfATC-Met1-S (BsaI) GCGCGCGGTCTCCAATGATTGAAATATTTTGCACTGC
PfATC-Met3-S (BsaI) GCGCGCGGTCTCCAATGTTTTATATCAATAGCAAG
PfATC-AS (BsaI) GCGCGCGGTCTCCGCGCTGCTAGTTGATGAAAAAATGAG
PfATC-His-AS (BsaI) GCGCGCGGTCTCAGCGCTTTAATGATGATGATGATGATGTCCGCTAGTTGAT
GAAAAAATGAGATATAATAAAGCC Site-directed mutagenesis PfATC-R109A-S GTTCCTTGAACCAAGTACAGCAACAAGATGTTCTTTTGATGC PfATC-R109A-AS GCATCAAAAGAACATCTTGTTGCTGTACTTGGTTCAAGGAAC PfATC-K138A-S CTGATATGAATTCAACTTCTTTTTATGCGGGAGAAACTGTTGAAGATGCC PfATC-K138A-AS GGCATCTTCAACAGTTTCTCCCGCATAAAAAGAAGTTGAATTCATATCAG P. falciparum transfection
PfATC-S (KpnI) GAGAGGTACCATGATTGAAATATTTTGCACTGC
357 358 359 360 361 362 363 364 365 366 367 368 369
PfATC-MYC-AS (AvrII) AGACCTAGGTTATAAATCTTCTTCTGATATTAATTTTTGTTCTCCGCTAGTTG ATGAAAAAATGAG qRT-PCR primers PfAldolase-qRT-S TGTACCACCAGCCTTACCAG PfAldolase-qRT-AS TTCCTTGCCATGTGTTCAAT PfATC-qRT-S AACAGGCGAACATCCAACTC PfATC-qRT-AS TTCAAATCTCCAACGAAAGC
Table 1 - Primer sequences used in this study. Restriction sites are highlighted in bold, C-terminal His6-tag is shown in italic, and altered codons are underlined. Fructose-biphosphate aldolase (PF3D7_1444800) was used as a control housekeeping gene in qRT-PCR experiments.
Recombinant Protein Preparation
Recombinant expression and purification of all PfATC constructs were performed in E. сoli according to the previously described protocol (18). The homogeneity of the enzyme preparation was analysed by SDS-PAGE and Western Blot. The kinetic properties of PfATC and their mutants were investigated as previously reported using the Malachite Green and Ceriotti’s colourimetric methods (18,19).
Pull-Down Assay
Equal volumes of the lysate containing soluble recombinant His-tagged mutant ATC and the lysate containing Strep-tagged-ATC-WT were mixed and incubated on ice for 2 hours. The mix of lysates was further separated into two fractions, H (His-tagged PfATC-R109A/K138A) and S (Strep-tagged PfATC-WT). The subsequent purification from the 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386
mixed lysates was performed via the Strep-tactin (for S fraction) and via Ni-NTA agarose (for H fraction). The elution fractions of both purifications were mixed followed by buffer exchange. After 1-hour incubation on ice, the mixed sample was re-purified using Strep-tactin resin and the concentrated elution fraction was further analysed by western blot.
Culture conditions of P. falciparum
Prior to the experiments, cultures were maintained in fresh group O-positive human blood at 4% haematocrit using RPMI 1640 media containing 5g of Albumax II, 2 g of glucose, 30 mg of hypoxanthine, and 20 mg of gentamicin per litre. Flasks were incubated at 37° C under a gas mixture of 5% O2, 5% CO2, and 90% N2. Parasites were synchronized with 5% sorbitol, and the parasitaemia was determined after approximately 48h by light microscopy (39).
Ethics Statement
All blood samples (human O+ blood) were obtained anonymized from the Brazilian blood bank ProSangue. Further, the use of human blood for P. falciparum cell culture was approved by the ICB-USP research ethics committee.
Transfection of P. falciparum 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405
The successfully cloned and precipitated pARL 1a- constructs were transfected into the malaria parasite P. falciparum 3D7 (40). The plasmid DNA was centrifuged for 30 min at 10.000 g and 4° C before the supernatant was removed and the DNA pellet could be air-dried. The plasmid DNA was then resuspended in 50 μL of Tris-EDTA (TE) buffer (10 mM Tris-HCl; 1 mM EDTA; pH 7.5) and 200 μL cytomix (41). P. falciparum 3D7 culture at a parasitemia of at least 2 % of ring-stage parasites was centrifuged for 10 min at 4° C. The supernatant was removed and 250 μL of iRBC were added to the resuspended plasmid DNA and subsequently transferred to an electroporation cuvette (BioRad, Germany) and electroporated using the BioRad X-cell total system (BioRad, Germany) at 0.31 kV and 950 mF. After electroporation, the cells were transferred into pre-warmed RPMI medium and inoculated with 200 μl of fresh RBC. Four hours post-transfection the culture medium was exchanged. Parasites were grown for 24 h without drug selection before the medium was supplemented with 5 nM WR99210 or 1 μg/ml blasticidin, according to the resistance cassette of the employed plasmid, and parasites were maintained in continuous culture for selection. To compare the effect of the selection drugs the parasites were also transfected with the respective mock plasmid pARL 1a- hDHFR (WR) and/or BSD, as previously described in (41), and these results used as a control. Recombinant expression was verified by Western Blot analysis using a monoclonal anti-Myc antibody (Molecular Probes, Germany) according to (42). Specific anti-ATC antibodies have been produced in-house by mice immunization and were used as primary antibody in the evaluation of ATC overexpression in the transfected cell lines. Blots were probed with the polyclonal anti-PfATC antibody at a dilution of 1:1000, stripped and re-probed with a rabbit polyclonal 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427
antibody directed against thiamine pyrophosphokinase (PfTPK, loading control) according to Eschbach et al (43). Anti-mouse-HRP and anti-rabbit-HRP antibodies (Invitrogen) were used as secondary antibodies at a dilution of 1:10000 against anti-PfATC and PfTPK antibodies respectively. Secondary antibody detection was performed with the Pierce™ Fast Western Blot Kits, SuperSignal™ West Femto kit. Relative expression levels were estimated by analysis of band intensities using the ImageJ image processing software.
Protein Interference Assay
The long-term viability of the respective transgenic cell lines was investigated within synchronized parasites at ring-stage, using 1 ml cultures in 24 well plates at a starting parasitemia of 0.3 – 0.5%. The assay was performed in normal RPMI 1640 medium as well as RPMI 1640 minimal media without aspartate/asparagine supplementation (44). For the single PfATC transfected PIA experiments, parasites were also separately cultivated in RPMI 1640 medium supplemented with 20 nM and 20 µM aspartate.
Samples were taken every 48 hours (approximately every cycle) for 10 days, stained with ethidium bromide followed by three washing steps with PBS and applied to a Guava EasyCyte mini cytometer (Millipore).
The culture media and selection drug exchange were performed every 48 h. Parasite cultures reaching a parasitaemia of 8-10% were diluted and cumulative parasitaemia was calculated by extrapolation from observed parasitaemia. All the samples were grown in 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447
triplicate and at least two independent experiments were performed. A two-way ANOVA analysis with Bonferroni’s correction was performed using the GraphPadPrism 5 software.
Drug Assay Screening
The stock culture was synchronized with 5% sorbitol, and then approximately 48 h later, the level of parasitaemia was determined by light microscopy. Parasites were noted to be ring and early trophozoites. The stock culture was then diluted with complete medium and normal human erythrocytes to a starting 4% haematocrit and 0.5% parasitaemia. To perform dose-response trials, the culture was incubated with serial dilutions of the drug resuspended in DMSO in a 96 well plate, under standard culturing conditions for 96 h.
For the fluorescence assay, after 96 h of growth, 100 μl of SYBR Green in lysis buffer (0.2 μl of SYBR Green/ml of lysis buffer, 20 mM Tris-HCl, pH 7.5, 5 mM EDTA; 0.008% Saponin; 0.08% Triton X-100) was added to each well, and the contents were mixed until no visible erythrocyte sediment remained, according to (45).
After 1 h of incubation in the dark at room temperature, fluorescence was measured with a SpectraMax i3x multi-well plate fluorescence reader (Molecular Devices, USA) with excitation and emission wavelength bands centred at 485 and 530 nm, respectively, and a gain setting equal to 50. Data were analysed via SoftMax Pro and the GraphPad Prism 5 software. 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467
RNA Purification and Quantitative Real-Time PCR
The stock cultures were synchronized with 5% sorbitol and allowed to recover for 72 hours. Upon reaching the trophozoite stage, the cultures were collected and treated with 1% saponin for host erythrocyte lysis. After centrifugation, the dark pellet containing the parasites was resuspended in Trizol (Life Technologies) and stored at -20° C. In order to extract the RNA, the Trizol treated parasite samples were vigorously shaken in presence of chloroform for 15 seconds and the aqueous supernatant was separated by centrifugation, transferred to the fresh tube and precipitated using ice-cold isopropanol. The resulting small pellet was washed with 75% ethanol, resuspended in MiliQ water and stored at -80° C. The resulting RNA samples were analysed by quantitative real-time PCR using a mastercycler Realplex 2 Epgradient S (Eppendorf). The raw data were analysed using the method of fold change=2^(-∆∆Ct), this analysis is giving the expression fold change of the gene in the study which is normalized against a housekeeping gene and with the respective mock cell line. In addition to using the specific primers of the PfATC, the qRT-PCR was accompanied by a set of primers for the housekeeping gene fructose-biphosphate aldolase (PF3D7_1444800) as control (Table 1).
It was performed a one-way ANOVA analysis of the values by GraphPad Prism 5, which demonstrated no significant differences among the samples.
Determination of the oligomeric state 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487
The oligomeric state of the wild-type PfATC-Met3 and its RK mutant was determined by static light scattering experiments performed in line with size exclusion chromatography using an NGC (BioRad). PfATC-Met3 sample, purified to homogeneity and concentrated to 3.0 mg/ml, was injected onto Superdex S200 10/300 (GE Healthcare) size exclusion column in line with MiniDAWN TREOS (Wyatt) three-angle static light scattering device. The size exclusion column was previously equilibrated with PBS. An inlet filter was used to prevent big aggregates (>100 nm) from interfering with the measurements. Static light data were analysed using the software provided by the manufacturers (ASTRA 6.1.5.22; Wyatt Technologies). The protein concentration and particle size were calculated based on the protein theoretical absorbance at 280nm [Abs 0.1% (1 mg/ml) = 0.841; for the wild-type and 0.846 for the double mutant. http://web.expasy.org/protparam].
Crystallisation, X-ray data collection and processing
The crystallisation of PfATC-Met3-RK was performed similarly to the procedure used for native PfATC (PfATC –Met3). All crystals were cryoprotected using the crystallization-liquor supplied with 20% (v/v) glycerol; flash cooled and stored in liquid nitrogen before the data collection. The crystallisation parameters are summarised in Table 2. Cryo-cooled PfATC-Met3-RK crystals were sent to the European Synchrotron Radiation Facility (ESRF, Grenoble) using a cryo-container (Taylor-Wharton).
The collected X-Ray data for PfATC-Met3-RK crystals were processed using XDSAPP (46) and Aimless (47). The structure was solved and initially refined using the DIMPLE pipeline 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508
within the CCP4 suite (47) using the coordinates of the apo protein, PfATC-met3 (PDB 5ILQ(18)) as a model structure. The final refinement steps included manual rebuilding in Coot (48) and Refmac5 (49) using locally generated NCS restraints and TLS parameters. The resulting crystal structure was deposited in PDB (50) under the accession code of 6HL7. Data collection and processing statistics are shown in Table 3.
Table 2. Crystallization
PfATC-Met3-R109A/K138A (6HL7)
Method Hanging drop
Plate type 24-well
Temperature (K) 293
Protein concentration (mg ml-1) 10 Buffer composition of protein solution
PBS
Crystallization condition 0.2 M Potassium citrate tribasic monohydrate 20% w/v PEG 3350
Volume and ratio of drop 3 ìl (1:1) Volume of reservoir 500 ìl
Table 3. X-ray data collection and refinement statistics
Crystal PfATC-Met3-R109A/K138A (6HL7)
Diffraction source ID23-1 (ESRF)
Wavelength (Å) 0.976 Temperature (K) 100 Detector PILATUS 6M Crystal-detector distance (mm) 494.79
Rotation range per image 0.1 509 510 511 512 513 514 515 516
(o) Number of images 1670 Space group C 1 2 1 Cell dimensions a, b, c (Å) α, β, γ (o) 148.0, 89.7, 121.6 90.0, 122.2, 90.0 Resolution (Å) 57.6 – 2.5 Rmerge 6.3 (80.4) Mean I/σI 12.95 (1.30) Completeness (%) 97.6 (94.0) CC 1/2 99.9 (61.9) Isa 32.20 Observed reflections 146767 (22942) Unique reflections 46404 (7154) Redundancy 3.16 (3.20) Refinement Resolution (Å) 2.5
No. reflections (free) 45755 (2399) Rwork / Rfree 20.5 /25.1 No. atoms Protein Non-protein Water 7928 7870 16 42 Average B-factors Protein (Å2) Ligands (Å2) Waters (Å2) 71.33 96.34 54.42 R.m.s. deviations Bond lengths (Å) Bond angles (o) 0.01 1.94 Ramachandran plot Most favoured, % Allowed, % 92.9
Table 3 shows data collection, processing and refinement statistics of both structures.
R-factor is defined as ( )/(
), where Fobs and Fcalc are observed and calculated structure factors of the reflection of hkl, respectively.
Rmerge is defined as
, where Ii(hkl) is the ith intensity measurement of reflection hkl and <I(hkl)> is the average intensity from multiple observations. Rfree was calculated based on a small subset (5 %) of randomly selected reflections omitted from the refinement. Values in parentheses correspond to the highest resolution shell.
Molecular modelling
Torin 2 ligand structure was prepared using LigPrep on default options, where the unprotonated state was chosen for further steps as suggested by the calculated theoretical pKa value. PfATC-Met3 PDB structure (5ILN) was prepared by adding the adjusting protonation states of amino acids and fixing missing side-chain atoms (PrepWiz, Maestro v2018.4), extra water molecules, phosphate ions and further organic solvents, such as glycerol, were removed. Molecular docking was performed around the co-crystallized citrate ligand, using the default settings of the Induced-Fit docking with extended sampling mode (Prime v5.4 r012 and Glide v8.1, implemented in Maestro v2018.4, (51)) within a 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536
cubic box of 20 Å, top-ranked docking poses were visually inspected for interactions with Arg109 and Lys138. Selected docking poses were evaluated regarding stability by short molecular dynamics simulations (MD). MD simulations were carried out using Desmond (v5.6, using P100 GPU acceleration, (52) with the OPLS3e force-field (53). This force-field has a better performance representing ligand properties and therefore is suitable to deal with chemical diversity. The simulated system encompassed the protein-ligand complex within a predefined solvent box of 13 Å radius (chosen water model was simple point charge, TIP3) with periodic boundary conditions, and counter ions (Na+ or Cl- adjusted to neutralize the overall system charge). The short-range coulombic interactions were treated using a cut-off value of 9.0 Å using the short-range method, while the smooth Particle Mesh Ewald method (PME) handled long-range coulombic interactions. Initially, the system was relaxed and minimized using Steepest Descent and the limited-memory Broyden-Fletcher-Goldfarb-Shanno algorithms in a hybrid manner. The simulation was performed under the NPT ensemble for 5 ns implementing the Berendsen thermostat and barostat methods. A constant temperature of 310 K will be maintained throughout the simulation using the Nose-Hoover thermostat algorithm and Martyna-Tobias-Klein Barostat algorithm to maintain 1 atm of pressure, respectively. The simulation was analysed using the trajectory, both by the ligand stability and the overall changes in the protein conformation, along the production simulation time of 100 ns. Figure 9 was generated using PyMol (54).
Acknowledgements 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558
The authors would like to acknowledge the Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP grants 2013/17577-9 to SSB, 2017/03966-4 and 2015/26722-8 to CW). FB gratefully acknowledges funding through a Science without Borders Fellowship. Further, the authors would like to acknowledge the Ubbo Emmius student fellowships of SSB and the CAPES/Nuffic MALAR-ASP (053/14) network. This project has received funding from the European Union’s Framework Programme for Research and Innovation Horizon 2020 (2014-2020) under the Marie Skłodowska-Curie Grant ITN, Agreement No. 675555, Accelerated Early staGe drug discovery (AEGIS). The authors wish to acknowledge CSC – IT Center for Science, Finland, for computational resources. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
ORCID
Soraya S. Bosch https://orcid.org/0000-0003-1459-4463
Sergey Lunev https://orcid.org/0000-0001-9867-6866
Fernando A. Batista https://orcid.org/0000-0001-5479-5329
Thales Kronenberger https:// orcid .org/0000-0001-6933-7590
Alexander Dömling https://orcid.org/0000-0002-9923-8873
Matthew R. Groves https://orcid.org/0000-0001-9859-5177
Carsten Wrenger https://orcid.org/0000-0001-5987-1749 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577
FIGURE LEGENDS
Figure 1. Schematic of Pyrimidine Biosynthesis pathway.
The enzymes of the pathway present in Plasmodium falciparum are shown in purple. The salvage pathway is presented in red. From the biosynthesis pathway: CPSII, carbamoyl phosphate synthase; ATC, aspartate transcarbamoylase; DHOase, dihydroorotase; DHODH, dihydroorotate dehydrogenase; OPRTase, orotate phosphoribosyltransferase; OMPDCase, orotidine 5´-monophosphate decarboxylase; UMP kinase; UDP kinase and CTP synthase. From the salvage pathway: UPRTase, uracil phosphoribosyltransferase; UP, uridine Phosphorylase and UK, uridine kinase.
Figure 2. Analysis of the electron density in the active site area from PfATC.
a) Structural comparison between the PfATC-Met3-RK structure (PDB 6HL7) and the CP-bound ATC from E. Coli (PDB 1ZA2) shows the difference in CP-binding. b) The coordinates of the loop 297-311 (red), as well as the catalytic loop 130-141 (red) from the adjacent subunit (orange), have been modelled in the PfATC-Met3-RK subunit lacking the presence of CP. c) Superposition of the CP-binding domains of PfATC-Met3-RK and PfATC-Met3 (5ILQ, (18)) show approx. 3Å shift of the Asp-domain of the PfATC-Met3-RK d) No significant difference has been observed between the structures of PfATC-Met3-RK and the citrate-bound structure of PfATC-Met3 representing the R-state (5ILN).
578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598
Figure 3. Substrate kinetics of the double mutant PfATC-Met3-R109A/K138A (PfATC-RK) assessed by the activity assays.
Kinetics measurements for two substrates: A) Carbamoyl-phosphate kinetics and B) L-aspartate. The Vmax-values are expressed in U (µmol min-1 mg-1). These values were obtained with at least three independent experiments, measuring the product of the reaction, by the Ceriotti’s colourimetric method (33).
Figure 4. Western Blot analysis of PfATC wild-type/mutant co-purification.
Lanes 1 and 4 show the samples of initial Ni-NTA elution as assessed by a-His and a-Strep antibodies respectively. Lanes 2 and 5 show the samples of initial Strep elution as assessed by a-His and a-Strep antibodies respectively. Lanes 3 and 6 show the samples of second Strep elution, performed after mixing and incubation of both initial Ni-NTA and Strep elutions, as assessed by a-His and a-Strep antibodies respectively. Antibody recognition of both a-His and a-Strep antibodies on lanes 3 and 6 confirm the formation of WT-mutant heterocomplexes in vitro. The PfATC monomer has a molecular weight of 40.2 kDa.
Figure 5. Schematic representation of the PfATC heterocomplex with mutant/wild-type subunits.
The mutant PfATC-Met3-RK subunit is shown in red and the wild-type PfATC subunits are shown in green. 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618
Figure 6. Proliferation curves of the transfected blood-stage P. falciparum parasites. a) Introduction of PfATC-RK alone produces a delay in the growth of the parasite comparing with the mock cell line (P<0.001). b) Proliferation curves of the double transfected cell line pARL AspAT YR + ATC RK and BSD WR mock cell line (P<0.001). c) Proliferation curves of transfected parasites in minimal media supplemented with 20 nM of aspartate d) Proliferation curves of transfected parasites in minimal media supplemented with 20 µM of aspartate. The values are in % parasitemia counting every 2 days and make the accumulative after a dilution step. *Both cell lines were grown in normal RPMI medium (NM-black) and minimal medium (MM-grey). The values are in % parasitemia counting every 2 days and make the accumulative after a dilution step. In both graphs, the p-value (***) represents 0.001 according to two-way ANOVA with Bonferroni’s correction.
Figure 7. Gene and protein expression of ATC in transfected P. falciparum parasites.
A) Schematic image of the transcribed mRNA and the location of the stop codon and qRT-PCR primer set. B) Gene expression profiles of the parasite cultures transfected with wild-type PfATC, PfATC-RK as well as double-transfected parasites expressing PfAspAT-YR mutant in addition to PfATC-RK. The analysis was performed via the 2 (-∆∆Ct) method in triplicates. The qRT-PCR experiments were carried out in three independent experiments using sequence-specific primers for PfATC and Aldolase as a control (Table 1). C) Western Blot analysis of Myc-labelled ATC expression in the transgenic sell-lines. (1) The control 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640
experiment with the 3D7 cell line, (2) transgenic parasites expressing additional wild-type PfATC, (3) parasites expressing PfATC-RK mutant, (4) PfATC-RK expression in the double-transfected parasite (ATC-RK / AspAT-YR), (5) Parasites carrying control mock plasmid. D) Western Blot analysis of PfATC expression in the transgenic cell-lines using specific anti-ATC antibodies. The control experiment with the MOCK cell line, transgenic parasites expressing additional wild-type PfATC and parasites expressing PfATC-RK mutant are indicated. TPK recognition was used as an endogenous control. ATC overexpression was estimated in 8 and 10-fold excess for PfATC-WT and RK respectively.
Figure 8. Dose-response profile of in vitro and whole-cell assays against Torin 2.
A) Inhibition curve of Torin 2 against purified PfATC. The concentration of the inhibitor is shown in logarithmic scale. The calculated IC50 value was 67.7 ± 6.6 µM. The experiments were performed in triplicate and three different independent assays by measuring inorganic phosphate using the malachite green method (18). B) Dose-response curve showing the viability of P. falciparum overexpressing PfATC and BSD mock cell line exposed to different concentrations of Torin 2. The experiment was performed in triplicate and three different independent assays. EC50 - values of the ATC overexpressing cell line and BSD mock cell line were determined to be 0.445 ± 0.087 nM and 0.024 ± 0.005 nM, respectively. C) Dose-response curve showing the viability of P. falciparum overexpressing PfATC, BSD mock cell-line and non-transfected 3D7 cell-line exposed to different concentrations of chloroquine. The experiment was performed in triplicate and three 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661
different independent assays. EC50 - values of the ATC overexpressing cell line, BSD mock cell line and 3D7 were determined to be 11 nM, 15 nM and 11 nM, respectively.
Figure 9. In silico analysis of the interaction between Torin 2 and PfATC active site.
A) Overview of PfATC (PDB 5ILN) highlighting the potential binding site of Torin-2 in green, in between subunits A (blue) and C (purple). B) Highlight of suggested Torin 2 binding pose, with hydrogen interactions with Arg295, His187 and the main-chain of Lys138 and supporting polar contacts with Arg109 and Arg159. C) Frequency of hydrogen interactions along 100 ns of molecular dynamics simulation within the solvent box.
ASSOCIATED CONTENT Accession Codes
Authors already released the atomic coordinates, PDB codes are list below.
PfATC-Met3-R109A/K138A bound to CP; 6HL7. PfATC-Met3 apo-structure: 5ILQ. PfATC bound citrate: 5ILN. EcATC bound to CP: 1ZA2.
AUTHOR INFORMATION Corresponding Author
*Matthew R. Groves (Structural Biology & Biophysics): m.r.groves@rug.nl 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681
*Carsten Wrenger (Enzyme kinetics & Culturing): cwrenger@icb.usp.br
Author Contributions
‡ S.S.B., S.L. and F.A.B. contributed equally
ABBREVIATIONS USED
Asp, aspartate; CA, N-carbamoyl-L-aspartate; CP, carbamoyl-phosphate; DMSO, dimethyl sulfoxide; Ni-NTA, nickel - nitrilotriacetic acid; ORFs, open reading frames; PALA, N-phosphonacetyl-L-aspartate; PBS, phosphate-buffered saline; qRT-PCR, quantitative real-time polymerase chain reaction; SLS, Static Light Scattering.
REFERENCES
1. Hyde JE. Targeting purine and pyrimidine metabolism in human apicomplexan parasites. Current drug targets. 2007 Jan;8(1):31–47.
2. de Koning HP, Bridges DJ, Burchmore RJS. Purine and pyrimidine transport in pathogenic protozoa: from biology to therapy. FEMS microbiology reviews. 2005 Nov;29(5):987–1020.
3. Krungkrai SR, Krungkrai J. Insights into the pyrimidine biosynthetic pathway of human malaria parasite Plasmodium falciparum as chemotherapeutic target. Asian Pacific Journal of Tropical Medicine. 2016;9(6):525–34.
4. Hyde JE. Targeting purine and pyrimidine metabolism in human apicomplexan parasites. Current drug targets. 2007 Jan;8(1):31–47.
5. Vaidya AB, Mather MW. Mitochondrial evolution and functions in malaria parasites. Annual review of microbiology. 2009;63:249–67.
682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704
6. Rodrigues T, Lopes F, Moreira R. Inhibitors of the mitochondrial electron transport chain and de novo pyrimidine biosynthesis as antimalarials: The present status. Current medicinal chemistry. 2010;17(10):929–56.
7. Reyes P, Rathod PK, Sanchez DJ, Mrema JE, Rieckmann KH, Heidrich HG. Enzymes of purine and pyrimidine metabolism from the human malaria parasite, Plasmodium falciparum. Molecular and biochemical parasitology. 1982 May;5(5):275–90.
8. Loffler M, Fairbanks LD, Zameitat E, Marinaki AM, Simmonds HA. Pyrimidine pathways in health and disease. Trends in molecular medicine. 2005 Sep;11(9):430–7.
9. Lunev S. Identification and Validation of Novel Drug Targets for the Treatment of Plasmodium falciparum Malaria: New Insights. In: Batista FA, editor. Rijeka: IntechOpen; 2016. p. Ch. 12.
10. Baldwin J, Farajallah AM, Malmquist NA, Rathod PK, Phillips MA. Malarial dihydroorotate dehydrogenase. Substrate and inhibitor specificity. The Journal of biological chemistry. 2002 Nov;277(44):41827–34.
11. Baldwin J, Michnoff CH, Malmquist NA, White J, Roth MG, Rathod PK, et al. High-throughput screening for potent and selective inhibitors of Plasmodium falciparum dihydroorotate dehydrogenase. The Journal of biological chemistry. 2005 Jun;280(23):21847–53.
12. Phillips MA, Lotharius J, Marsh K, White J, Dayan A, White KL, et al. A long-duration dihydroorotate dehydrogenase inhibitor (DSM265) for prevention and treatment of malaria. Sci Transl Med. 2015 Jul 15;7(296):296ra111-296ra111.
13. Nelson DL, Cox MM, Lehninger AL. Lehninger principles of biochemistry. New York; 2013.
14. Gerhrt JC, Pardee AB. The enzymology of control by feedback inhibition. The Journal of biological chemistry. 1962 Mar;237:891–6.
15. Guo W, West JM, Dutton AS, Tsuruta H, Kantrowitz ER. Trapping and structure determination of an intermediate in the allosteric transition of aspartate transcarbamoylase. Proceedings of the National Academy of Sciences of the United States of America. 2012 May;109(20):7741–6.
16. Ruiz-Ramos A, Lallous N, Grande-García A, Ramón-Maiques S. Expression, purification, crystallization and preliminary X-ray diffraction analysis of the aspartate transcarbamoylase domain of human CAD. Acta Crystallographica Section F: Structural Biology and Crystallization Communications. 2013 Dec 1;69(Pt 12):1425– 30. 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738
17. Matoba K, Nara T, Aoki T, Honma T, Tanaka A, Inoue M, et al. Crystallization and preliminary X-ray analysis of aspartate transcarbamoylase from the parasitic protist Trypanosoma cruzi. Acta crystallographica Section F, Structural biology and crystallization communications. 2009 Sep;65(Pt 9):933–6.
18. Lunev S, Bosch SS, Batista F de A, Wrenger C, Groves MR. Crystal structure of truncated aspartate transcarbamoylase from Plasmodium falciparum. Acta crystallographica Section F, Structural biology communications. 2016 Jul;72(Pt 7):523–33.
19. Lunev S, Bosch SS, Batista FA, Wang C, Li J, Linzke M, et al. Identification of a non-competitive inhibitor of Plasmodium falciparum aspartate transcarbamoylase. Biochemical and biophysical research communications. 2018 Mar;497(3):835–42. 20. Lipscomb WN, Kantrowitz ER. Structure and mechanisms of Escherichia coli aspartate
transcarbamoylase. Accounts of chemical research. 2012 Mar;45(3):444–53.
21. Meissner KA, Lunev S, Wang Y-Z, Linzke M, de Assis Batista F, Wrenger C, et al. Drug Target Validation Methods in Malaria - Protein Interference Assay (PIA) as a Tool for Highly Specific Drug Target Validation. Current drug targets. 2017;18(9):1069–85. 22. Lunev S, Butzloff S, Romero AR, Linzke M, Batista FA, Meissner KA, et al. Oligomeric
interfaces as a tool in drug discovery: Specific interference with activity of malate dehydrogenase of Plasmodium falciparum in vitro. PloS one. 2018;13(4):e0195011. 23. Eldo J, Cardia JP, O’Day EM, Xia J, Tsuruta H, Kantrowitz ER.
N-phosphonacetyl-L-isoasparagine a potent and specific inhibitor of Escherichia coli aspartate transcarbamoylase. Journal of medicinal chemistry. 2006 Oct;49(20):5932–8.
24. Swyryd EA, Seaver SS, Stark GR. N-(phosphonacetyl)-L-aspartate, a potent transition state analog inhibitor of aspartate transcarbamylase, blocks proliferation of mammalian cells in culture. The Journal of biological chemistry. 1974 Nov;249(21):6945–50.
25. Harris KM, Cockrell GM, Puleo DE, Kantrowitz ER. Crystallographic snapshots of the complete catalytic cycle of the unregulated aspartate transcarbamoylase from Bacillus subtilis. Journal of molecular biology. 2011 Aug;411(1):190–200.
26. Huang J, Lipscomb WN. Aspartate transcarbamylase (ATCase) of Escherichia coli: a new crystalline R-state bound to PALA, or to product analogues citrate and phosphate. Biochemistry. 2004 Jun;43(21):6415–21.
27. Van Boxstael S, Cunin R, Khan S, Maes D. Aspartate transcarbamylase from the hyperthermophilic archaeon Pyrococcus abyssi: Thermostability and 1.8 Å resolution crystal structure of the catalytic subunit complexed with the bisubstrate analogue N-phosphonacetyl-L-aspartate. Journal of Molecular Biology. 2003 Feb;326(1):203–16. 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773
28. Ruiz-Ramos A, Velazquez-Campoy A, Grande-Garcia A, Moreno-Morcillo M, Ramon-Maiques S. Structure and Functional Characterization of Human Aspartate Transcarbamoylase, the Target of the Anti-tumoral Drug PALA. Structure (London, England : 1993). 2016 Jul;24(7):1081–94.
29. Tsuboi KK, Edmunds NH, Kwong LK. Selective inhibition of pyrimidine biosynthesis and effect on proliferative growth of colonic cancer cells. Cancer research. 1977 Sep;37(9):3080–7.
30. Grem JL, King SA, O’Dwyer PJ, Leyland-Jones B. Biochemistry and clinical activity of N-(phosphonacetyl)-L-aspartate: a review. Cancer research. 1988 Aug;48(16):4441–54. 31. Hanson KK, Ressurreicao AS, Buchholz K, Prudencio M, Herman-Ornelas JD, Rebelo M,
et al. Torins are potent antimalarials that block replenishment of Plasmodium liver stage parasitophorous vacuole membrane proteins. Proceedings of the National Academy of Sciences of the United States of America. 2013 Jul;110(30):E2838-47. 32. Sun W, Tanaka TQ, Magle CT, Huang W, Southall N, Huang R, et al. Chemical signatures
and new drug targets for gametocytocidal drug development. Scientific reports. 2014 Jan;4:3743.
33. Prescott LM, Jones ME. Modified methods for the determination of carbamyl aspartate. Analytical biochemistry. 1969 Dec;32(3):408–19.
34. Wang J, Stieglitz KA, Cardia JP, Kantrowitz ER. Structural basis for ordered substrate binding and cooperativity in aspartate transcarbamoylase. Proceedings of the National Academy of Sciences of the United States of America. 2005 Jun;102(25):8881–6.
35. Batista FA, Bosch SS, Butzloff S, Lunev S, Meissner KA, Linzke M, et al. Oligomeric Protein Interference Validates Druggability of Aspartate Interconversion in Plasmodium falciparum. MicrobiologyOpen. 2018;
36. Psychogios N, Hau DD, Peng J, Guo AC, Mandal R, Bouatra S, et al. The human serum metabolome. PLoS ONE. 2011 Feb 16;6(2):e16957.
37. Liu J, Istvan ES, Gluzman IY, Gross J, Goldberg DE. Plasmodium falciparum ensures its amino acid supply with multiple acquisition pathways and redundant proteolytic enzyme systems. Proc Natl Acad Sci U S A. 2006 Jun 6;103(23):8840–5.
38. Sun W, Tanaka TQ, Magle CT, Huang W, Southall N, Huang R, et al. Chemical signatures and new drug targets for gametocytocidal drug development. Scientific reports. 2014 Jan;4:3743.
39. Trager W, Jensen JB. Human malaria parasites in continuous culture. Science (New York, NY). 1976 Aug;193(4254):673–5.
774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808
40. Muller IB, Knockel J, Eschbach M-L, Bergmann B, Walter RD, Wrenger C. Secretion of an acid phosphatase provides a possible mechanism to acquire host nutrients by Plasmodium falciparum. Cellular microbiology. 2010 May;12(5):677–91.
41. Wu Y, Sifri CD, Lei HH, Su XZ, Wellems TE. Transfection of Plasmodium falciparum within human red blood cells. Proceedings of the National Academy of Sciences of the United States of America. 1995 Feb;92(4):973–7.
42. Muller IB, Hyde JE, Wrenger C. Vitamin B metabolism in Plasmodium falciparum as a source of drug targets. Trends in parasitology. 2010 Jan;26(1):35–43.
43. Eschbach M-L, Müller IB, Gilberger T-W, Walter RD, Wrenger C. The human malaria parasite Plasmodium falciparum expresses an atypical N-terminally extended pyrophosphokinase with specificity for thiamine. Biological chemistry. 2006;387(12):1583–1591.
44. Liu J, Istvan ES, Gluzman IY, Gross J, Goldberg DE. Plasmodium falciparum ensures its amino acid supply with multiple acquisition pathways and redundant proteolytic enzyme systems. Proceedings of the National Academy of Sciences of the United States of America. 2006 Jun;103(23):8840–5.
45. Smilkstein M, Sriwilaijaroen N, Kelly JX, Wilairat P, Riscoe M. Simple and inexpensive fluorescence-based technique for high-throughput antimalarial drug screening. Antimicrobial agents and chemotherapy. 2004 May;48(5):1803–6.
46. Krug M, Weiss M, Heinemann U, Mueller U. XDSAPP: A graphical user interface for the convenient processing of diffraction data using XDS. Vol. 45, Journal of Applied Crystallography. 2012.
47. Winn MD, Ballard CC, Cowtan KD, Dodson EJ, Emsley P, Evans PR, et al. Overview of the CCP4 suite and current developments. Acta crystallographica Section D, Biological crystallography. 2011 Apr;67(Pt 4):235–42.
48. Emsley P, Lohkamp B, Scott WG, Cowtan K. Features and development of Coot. Acta crystallographica Section D, Biological crystallography. 2010 Apr;66(Pt 4):486–501. 49. Murshudov GN, Vagin AA, Dodson EJ. Refinement of macromolecular structures by the
maximum-likelihood method. Acta crystallographica Section D, Biological crystallography. 1997 May;53(Pt 3):240–55.
50. Berman HM, Westbrook J, Feng Z, Gilliland G, Bhat TN, Weissig H, et al. The Protein Data Bank. Nucleic acids research. 2000 Jan;28(1):235–42.
51. Sherman W, Day T, Jacobson MP, Friesner RA, Farid R. Novel Procedure for Modeling Ligand/Receptor Induced Fit Effects. Journal of Medicinal Chemistry. 2006 Jan;49(2):534–53. 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843
52. Proceedings of the 2006 ACM/IEEE conference on Supercomputing.
53. Harder E, Damm W, Maple J, Wu C, Reboul M, Xiang JY, et al. OPLS3: A Force Field Providing Broad Coverage of Drug-like Small Molecules and Proteins. Journal of Chemical Theory and Computation. 2016 Jan 12;12(1):281–96.
54. Janson G, Zhang C, Prado M, Bioinformatics AP-, 2016 undefined. PyMod 2.0: improvements in protein sequence-structure analysis and homology modeling within PyMOL. academic.oup.com. 844 845 846 847 848 849 850 851 852
