Dynamics of a GPCR studied with single-molecule microscopy
Keijzer, Sandra de
Citation
Keijzer, S. de. (2006, April 12). Dynamics of a GPCR studied with single-molecule microscopy.
Retrieved from https://hdl.handle.net/1887/4363
Version:
Corrected Publisher’s Version
3
Cell polarity allows Dictyostelium discoideum cells to chemotax in very shallow cAMP gradients that differ by only 2% across their cellular body. Until now, the dynamics of the cAMP receptor, cAR1, is excluded from the current models describing the mechanism of cell polarity. In this study the mobility of individual cAR1-eYFP was investigated with single-molecule microscopy in live cells under different physiological conditions. Independent of cAMP, an immobile and mobile fraction was found with the latter showing a diffusion constant of D = 0.19 µm2/s. The mobile fraction of receptors
increased in from 38% to 54% at the anterior of cells responding to an external cAMP source. This mobility shift was not caused by a difference in membrane viscosity or by a conformational change of the receptor due to phosphorylation. Instead, studies on Gα2-protein deficient cell lines lead to the conclusion that the mobility shift of the receptors at the leading edge is linked to the uncoupling/activation of the Gα2-protein. Our data further suggest that the mobility shift is directly involved in gradient sensing and provides a molecular explanation of the primary amplification steps proposed in the theoretical models describing polarity in chemotactic cells.
Sandra de Keijzer, Arnauld Sergé, Piet H.M. Lommerse, Freek van Hemert, Gerda E.M. Lamers, Yu Long3, Herman P. Spaink, Thomas Schmidt, B. Ewa Snaar-Jagalska.
3.1 Introduction
Chemotaxis is a process via which individual cells detect the direction of a stimulus, which in turn initiates changes in cell morphology and causes movement of the cells towards the source of the stimulus. The directed movement of cells in response to chemoattractants involves several complex and interrelated processes, including directional sensing, polarized cytoskeleton organization and motility. Chemotaxis is involved in neurogenesis, angiogenesis and other morphogenetic processes (Behar et al., 1994). Probably the most prominent example of chemotaxis is the navigation of neutrophils as towards sites of inflammation (Xu et al., 2003).
Dictyostelium discoideum is an amoeboid protozoan commonly used as a model organism to study signaling pathways that regulate the chemotactic response (Chung and Firtel, 2002; Meili and Firtel, 2003). Chemotaxis to 3’,5’-cyclic adenosine monophosphate (cAMP) is part of a differentiation program where free-living amoebae aggregate to form a multicellular organism. Binding of cAMP to cAR1, one of the four G-protein coupled cAMP receptors, leads to activation of second messenger pathways via its coupled Gα2/βγ protein (Janetopoulos et al., 2001). Among the proteins activated are adenyl cyclase (AC), guanylyl cyclase (GC), phospholipase C (PLC), phosphoinositide 3-kinase (PI3K), and PTEN-phosphatases which finally leads to actin polymerization at the anterior and myosin II reorganization at the posterior of the cell (Kimmel and Parent, 2003).
C
car1
-A
cAR1-YFP/car1
-5 µµµµm
B
3.2 Results3.2.1 A functional cAR1-eYFP fusion protein
The G-protein coupled cAMP receptor, cAR1, of Dictyostelium discoideum was fused to eYFP and stably expressed in receptor-deficient car1- cells to an expression level that resembles that of the endogeneous receptor in wild-type cells (see supplemental materials and methods). The fusion-protein, proved to be effectively synthesized and targeted to the plasma membrane (Fig. 3.1 B). To validate molecular weight and stability of the fusion protein whole-cell extracts of transformed car1- cells were immunoblotted using a purified GFP-antibody. As shown in Figure 3.1 A, the receptors appeared as a single band at the predicted size of ~70 kDa. cAR1-eYFP was functionally indistinguishable from wild-type cAR1 since the fusion protein complemented the deficiency of the cAR1 protein and completely rescued the developmental program (Devreotes, 1994) of car1- including the formation of a fruiting body. In contrast car1- cells could not undergo development beyond the one-cell state (Fig. 3.1 C, top left).
Figure 3.1: Generation of cell lines with optimal cAMP-receptor/YFP fusion proteins. A, cAR1-eYFP
3.2.2 Detecting single molecules
Single-molecule microscopy (SMM), a combination of regular wide-field microscopy with laser excitation and ultra-sensitive CCD camera detection, was used to obtain high spatial (~40nm) and temporal (~44ms) resolution information on the mobility of cAR1 receptors. In order to reach a density of fluorescent receptors at which individual molecules could be observed (< 1 µm-1), cells were photobleached prior to imaging (Fig. 3.2 A). It
should be noted that the unbleached population of receptors is a representative subpopulation of all receptors since photobleaching occurs at random. As predicted for individual molecules, fluorescence signals were characterized by diffraction-limited spots on the camera which exhibited single-step photobleaching, typical for single molecules (Fig. 3.2 B). Images were taken at a rate of 23 s-1, and automated analysis yielded values for
the integrated fluorescence and the lateral position of the receptors (accuracy ~ 40 nm). From those receptor positions trajectories of individual cAR1-eYFP were reconstructed (Fig. 3.2 C).
Figure 3.2: Detection of a single molecule. A, the left picture shows a fluorescence image
of the top membrane of a typical unstimulated car1- Dictyostelium cell transformed with cAR1-eYFP. After a brief photobleaching pulse (2-3 s) individual receptors were detected (peaks of fluorescence in the right image). B, the fluorescence signal of an individual cAR1-eYFP molecule as a function of time showing a single-step photobleaching event characteristic for single molecules. C, trajectory of an individual cAR1-eYFP diffusing in the top plasma membrane.
3.2.3 The effect of cAMP on the mobility of cAR1
Trajectories of cAR1-eYFP similar to that shown in Figure 3.2 C from the top membrane of resting cells were further analyzed to study the receptor mobility. For that, the cumulative probability of the square displacements (r2, see M&M) was determined for a
time delay of 44 ms (Fig. 3.3). 2060 trajectories were analyzed and square displacements up to 0.2 µm2 were found. Figure 3.3 A shows the data for a resting cell (control). For data
shown in Figure 3.3 B, cell polarization was achieved by a natural assay in which cells were brought to an early aggregation stage by starvation. The leading and trailing edge of each cell was defined with respect to the centre of the aggregate. The cumulative probability distributions of the square displacements of receptors located at the anterior and posterior of chemotaxing cells, respectively, showed a slight difference (Fig. 3.3 B). In order to quantify the significance of that difference we applied a two-sample Kolmogorov-Smirnov test (KS-test) with an acceptance level of 93.5%. The KS-test applied to the data in Figure 3.3 A&B showed that molecules at the posterior of chemotaxing cells were characterized by a mobility that did not differ from that of the control. In contrast receptors at the anterior revealed a different, faster mobility compared to receptors both in control condition and receptors at the posterior of chemotaxing cells.
More pronounced differences were obtained for cells sensing a gradient in a chemotaxis needle assay. Here the opening (radius 0.5 µm) of a micropipette filled with 10 µM cAMP was placed at a distance of 75 µm from the cells. This arrangement created a shallow gradient of 0.4 nM/µm at the position of the cell being studied. The anterior and posterior of the cell were defined with respect to the position of the pipette. Immediately before introduction of the pipette the mobility of the receptors (Fig. 3.3 C) was not different between anterior and posterior and equal to that of the control (Fig. 3.3 A). After the cells sensed a gradient (30-60 s after the pipette had been introduced) a difference was observed (Fig. 3.3 D): receptors at the leading edge had a higher mobility than those at the posterior, with the latter being indistinguishable from those of the control (Fig. 3.3 A).
A quantitative description of the data was obtained by global analysis of the square displacement distributions (Fig. 3.3). The cumulative probability of square displacements, P(r2,t
lag), was fitted to a two-population model, reflecting a mobile receptor fraction and an
immobile receptor fraction (Schmidt et al., 1995):
P (r2) = 1 - α exp (-r2/MSD) - (1-α) exp (-r2/4σ2) (3.1)
Eq. 3.1 leads to a characteristic mean squared displacement, MSD, and a fraction of mobile receptors, α. In our experiments, the lateralaccuracy was found to be σ = 40 nm. Assuming that mobile receptors were characterized by one MSD, all data (Fig. 3.3) were fitted simultaneously yielding a fraction α (Fig. 3.6) for each data set and a corresponding MSD. The receptor mobility in all data sets was characterized by MSD = 0.034 ± 0.003 µm2
which, using the delay between two observations of tlag = 44 ms, translates to a diffusion
1E-4 1E-3 0.01 0.1 0.0 0.2 0.4 0.6 0.8 1.0 Control cAR1-YFP bi-exp. fit
P
(r
2,t
la g)
1E-4 1E-3 0.01 0.1 0.0 0.2 0.4 0.6 0.81.0 Needle assaybefore cAMP
anterior posterior
P
(r
2,t
la g)
r
2(µm
2)
1E-4 1E-3 0.01 0.1 0.0 0.2 0.4 0.6 0.8 1.0 anterior posterior Natural assay 1E-4 1E-3 0.01 0.1 0.0 0.2 0.4 0.6 0.81.0 Needle assaywith cAMP
anterior posterior
r
2(µm
2)
A
B
C
D
mobile (Fig. 3.3 A), whereas 44±4% and 39±4% were mobile in the natural assay at the anterior and the posterior side of the cell, respectively (Fig. 3.3 B). For the needle assay mobile fractions of 54±5% and 31±3% were determined at the anterior and the posterior side of the cell, respectively (Fig. 3.3 D). Hence, receptor stimulation increases the fraction of mobile receptors at the anterior of the cell by a factor of 54/38 = 1.5, whereas, within experimental error, the fraction did not change at the posterior.
Figure 3.3: Diffusion of cAR1-eYFP for resting cells and polarized cells.
A, cumulative
Furthermore, the shift in mobile fraction observed in the natural assay is reduced compared to the shift in the needle assay (Fig. 3.3). This difference can be explained taking into account that in the natural assay cAMP is produced in waves in which the local gradient exists only for part of the cycle. Consequently, the difference in mobile fraction observed in the needle assay (54% vs 31%) is reduced by 0.5 for the natural assay (yielding 48% vs 37%) which fully accounts for our findings (Fig. 3.3 B). It should be noted that the change in mobility was not due to a change in membrane viscosity, since the mobility of an inert membrane marker (conconavilin A) was position-independent even for highly polarized cells (Fig. 3.4).
3.2.4 Comparative studies on mutant cell lines
Whether the difference in mobility between the anterior and the posterior of gradient-sensing polarized Dictyostelium cells was caused by a conformational change of the receptor due to its phosphorylation state or by an altered interaction between the cAR1 receptor and its coupled G-protein, was addressed by comparative studies on mutant cell lines. We analyzed a phosphorylation deficient mutant expressing a cAR1 receptor in which the four serine clusters in the C-terminal tail were substituted (YFP). For cm1234-YFP the fraction of mobile receptors at the anterior exceeds that at the posterior by a factor of 1.7 (72% vs 43%, Fig. 3.5 A & 3.6) in the natural assay. This ratio was close to that found for cAR1-eYFP during the needle assay (Fig. 3.3 D) demonstrating that the pronounced shift of receptor mobility was found to be independent of the phosphorylation state of the receptor. It should be noted that cm1234-YFP cells are defective in propagation of the cAMP wave (Kim et al., 1997) and therefore cells expressing cm1234-YFP were measured very close to the aggregation centre.
In comparison, experiments on the behavior of cAR1-eYFP expressed in a mutant lacking the Gα2 subunit, cAR1-eYFP/gα2- lead to a significant effect. Since the gα2- cells were unable to aggregate (Okaichi et al., 1992), the mobility of the cAR1-eYFP receptor was analyzed in the needle assay only. In contrast to the observations on the cAR1-YFP/car1- cells, no mobility shift between resting (data not shown) and starved
cAR1-Figure 3.4: Fluidity of membrane similar in anterior-posterior.
1E-4 1E-3 0.01 0.1 0.0 0.2 0.4 0.6 0.8 1.0 anterior posterior cAR1-eYFP/gα2 -before cAMP
P
(r
2,t
la g)
r
2(µm
2)
1E-4 1E-3 0.01 0.1 0.0 0.2 0.4 0.6 0.81.0 cAR1-eYFP/gwith cAMP α2
-r
2(µm
2)
anterior posterior eYFP/gα2- cells, independent of the presence of a gradient, was observed (Fig. 3.5 A&B & 3.6). The mobile receptor fraction in gα2- cells (51±5%) was comparable to that in the anterior of gradient sensing car1- cells and independent of receptor localization with respect
to the chemoattractant source. These two findings together suggest that the mobile population in cAR1-eYFP/car1- cells represented receptors which were uncoupled from their associated Gα2 protein. Although binding of the receptor to the GDP-bound, inactive Gα2GDP is expected to result in a small decrease in receptor mobility according to the
Saffman-Delbrück model (Saffman and Delbruck, 1975), this can not account for the dramatic effect observed. A more likely explanation follows from mammalian cells where Gα binds via a protein-protein network to a cytoskeleton meshwork (Rogers et al., 2004). As the mechanisms underlying chemotaxis are highly conserved, we propose a similar linkage to explain our results in D. discoideum. Such anchorage will lead to a larger fraction of immobile receptors. Ligand-induced actin polymerization can not play a role, since ga2- cells are completely deficient in chemoattractant-induced responses (Kumagai et al., 1989).
Figure 3.5: Cumulative probability distribution of cAR1 in different genetic backgrounds. A, cumulative probability
P(ri2, 44 ms) plotted versus the square displacement of cm1234-YFP from the top membrane of the anterior (N=398) and posterior (N=349) of polarized wt cells in natural assay. B&C, cumulative probability distribution of squared displacements of cAR1-eYFP from the top membrane of the anterior (N=404) and posterior (N=509) of gα2- cells before needle with cAMP was placed (B) and after the needle with 10-5 M cAMP was placed (C).
In conclusion, we suggest here that the immobile fraction of receptors that become mobile upon stimulation reflects inactive receptors bound via Gα2GDP to cytoskeleton
elements and/or a protein-protein network. In addition to this fraction of cAMP-responsive, immobile receptors, a second pool of immobile receptors that don not change their mobility upon stimulation was observed for all cells. This pool of immobile receptors was probably coupled to other cellular structures or to the cytoskeleton structures in a different way. With reference to the results with the cm1234-YFP mutant, it should be noted that phosphorylation of the receptor is independent of G-protein signaling as G-protein reassociation still occurs on phosphorylated receptors (Janetopoulos et al., 2001).
Figure 3.6: The fraction sizes of mobile receptors. The graph depicts the fraction sizes
-3.3 Discussion
Our findings are explained in a model in Figure 3.7. Receptors normally reside in an inactive Gα2GDP state and are immobilized by cytoskeleton structures. On receptor
activation Gα2GDP is processed into Gα2GTP and decouples both from the receptor and from
its Gβγ part. Due to this, the receptor is also decoupled from structural elements and free to move in the membrane thereby eventually activating other Gα2GDP aggregates. In the last
step collision of the receptor with G-protein is paralleled by anchorage to structural elements and receptor immobilization.
The results fit readily into current models of chemotaxis and can also account for the anterior/posterior shift in binding kinetics of the chemoattractant found in a previous single-molecule study (Ueda et al., 2001). The most successful model to describe Dictyostelium chemotaxis is one in which an excitory signal is produced locally in a background of global signal inhibition (LEGI model) (Ma et al., 2004; Janetopoulos et al., 2004). Incorporated into this model is an amplification step in the excitory path for which our findings might yield a molecular interpretation. Assuming that G-protein activation is solely a diffusion-limited process, the higher mobility of receptors at the anterior end will increase the rate of activation of G-proteins proportionally with the diffusion constant. Taking the off-rate of the cAMP from the receptor, koff = 1.1 s-1,(Ueda et al., 2001) as a typical timescale, the
associated distance of receptor movement becomes, 4D/koff = 0.87 µm far enough to
activate additional G-proteins. If we further assume that the probability of the loss of cAMP from the receptor is linked to the process of G-protein activation, the above mechanism also explains the increased cAMP off-rate at the anterior of the cell (Ueda et al., 2001). The amplification step proposed here will lead to a higher local G-protein excitation at the anterior, which was monitored by fluorescence resonant energy transfer between Gα and Gβγ, (Xu et al., 2005) but has been interpreted just in terms of receptor occupancy in ref. (Xu et al., 2005). Single-molecule colocalization experiments between fluorescent receptors and Gα2GDP will have to be performed to unravel the underlying processes. Recent
3.4 References
Azpiazu,I. and Gautam,N. (2004). A fluorescence resonance energy transfer-based sensor indicates that receptor access to a G protein is unrestricted in a living mammalian cell. Journal of Biological Chemistry 279, 27709-27718.
Behar,T.N., Schaffner,A.E., Tran,H.T., and Barker,J.L. (1994). Correlation of gp140trk expression and NGF-induced neuroblast chemotaxis in the embryonic rat spinal cord. Brain Res. 664, 155-166.
Chung,C.Y. and Firtel,R.A. (2002). Signaling pathways at the leading edge of chemotaxing cells. J. Muscle Res. Cell Motil. 23, 773-779.
Devreotes,P.N. (1994). G protein-linked signaling pathways control the developmental program of Dictyostelium. Neuron 12, 235-241.
Harms,G.S., Cognet,L., Lommerse,P.H., Blab,G.A., and Schmidt,T. (2001).
Autofluorescent proteins in single-molecule research: applications to live cell imaging microscopy. Biophys J 80, 2396-2408.
Janetopoulos,C., Jin,T., and Devreotes,P. (2001). Receptor-mediated activation of heterotrimeric G-proteins in living cells. Science 2001. Mar. 23;291. (5512. ):2408. -11. 291, 2408-2411.
Janetopoulos,C., Ma,L., Devreotes,P.N., and Iglesias,P.A. (2004). The chemoattractant-induced PI(3,4,5)P-3 accumulation is regulated by a local excitation, global inhibition mechanism. Molecular Biology of the Cell 15, 402A.
Jin,T., Zhang,N., Long,Y., Parent,C.A., and Devreotes,P.N. (2000). Localization of the G protein betagamma complex in living cells during chemotaxis. Science 2000. Feb. 11;287. (5455. ):1034. -6. 287, 1034-1036.
Kim,J.Y., Soede,R.D., Schaap,P., Valkema,R., Borleis,J.A., van Haastert,P.J.,
Devreotes,P.N., and Hereld,D. (1997). Phosphorylation of chemoattractant receptors is not essential for chemotaxis or termination of G-protein-mediated responses. J. Biol. Chem. 272, 27313-27318.
Kimmel,A.R. and Firtel,R.A. (2004). Breaking symmetries: regulation of Dictyostelium development through chemoattractant and morphogen signal-response. Current Opinion in Genetics & Development 14, 540-549.
Kimmel,A.R. and Parent,C.A. (2003). The signal to move: D. discoideum go orienteering. Science JID - 0404511 300, 1525-1527.
Liu,T., Mirschberger,C., Chooback,L., Arana,Q., Dal Sacco,Z., MacWilliams,H., and Clarke,M. (2002). Altered expression of the 100 kDa subunit of the Dictyostelium vacuolar proton pump impairs enzyme assembly, endocytic function and cytosolic pH regulation. J. Cell Sci. 115, 1907-1918.
Ma,L., Janetopoulos,C., Yang,L., Devreotes,P.N., and Iglesias,P.A. (2004). Two complementary, local excitation, global inhibition mechanisms acting in parallel can explain the chemoattractant-induced regulation of PI(3,4,5)P-3 response in Dictyostelium cells. Biophysical Journal 87, 3764-3774.
Meili,R. and Firtel,R.A. (2003). Follow the leader. Developmental Cell 4, 291-293. Okaichi,K., Cubitt,A.B., Pitt,G.S., and Firtel,R.A. (1992). Amino-Acid Substitutions in the Dictyostelium G-Alpha Subunit G-Alpha-2 Produce Dominant Negative Phenotypes and Inhibit the Activation of Adenylyl Cyclase, Guanylyl Cyclase, and Phospholipase-C. Molecular Biology of the Cell 3, 735-747.
Parent,C.A. (2004). Making all the right moves: chemotaxis in neutrophils and Dictyostelium. Current Opinion in Cell Biology 16, 4-13.
Parent,C.A., Blacklock,B.J., Froehlich,W.M., Murphy,D.B., and Devreotes,P.N. (1998). G protein signaling events are activated at the leading edge of chemotactic cells. Cell 95, 81-91.
Postma,M. and Van Haastert,P.J.M. (2001). A diffusion-translocation model for gradient sensing by chemotactic cells. Biophysical Journal 81, 1314-1323.
Pucadyil,T.J., Kalipatnapu,S., Hirikumar,K.G., Rangaraj,N., Karnik,S.S., and Chattopadhyay,A. (2004). G-protein-dependant cell surface dynamics of the human serotonin(1A) receptor tagged to yellow fluorescent protein. Biochemistry 43, 15852-15862.
Rogers,S.L., Wiedemann,U., Hacker,U., Turck,C., and Vale,R.D. (2004). Drosophila RhoGEF2 associates with microtubule plus ends in an EB1-dependent manner. Current Biology 14, 1827-1833.
Saffman,P.G. and Delbruck,M. (1975). Brownian motion in biological membranes. Proc Natl Acad Sci U S A 72, 3111-3.
Schmidt,T., Schutz,G.J., Baumgartner,W., Gruber,H.J., and Schindler,H. (1995). Characterization of Photophysics and Mobility of Single Molecules in A Fluid Lipid-Membrane. Journal of Physical Chemistry 99, 17662-17668.
Xiao,Z., Zhang,N., Murphy,D.B., and Devreotes,P.N. (1997). Dynamic distribution of chemoattractant receptors in living cells during chemotaxis and persistent stimulation. J Cell Biol JID - 0375356 139, 365-374.
Xu,J.S., Wang,F., Van Keymeulen,A., Herzmark,P., Straight,A., Kelly,K., Takuwa,Y., Sugimoto,N., Mitchison,T., and Bourne,H.R. (2003). Divergent signals and cytoskeletal assemblies regulate self-organizing polarity in neutrophils. Cell 114, 201-214.
Xu,X.H., Meier-Schellersheim,M., Jiao,X.M., Nelson,L.E., and Jin,T. (2005). Quantitative imaging of single live cells reveals spatiotemporal dynamics of multistep signaling events of chemoattractant gradient sensing in Dictyostelium. Molecular Biology of the Cell 16, 676-688.
3.5 Materials and methods
3.5.1 cAR1-eYFP fusion protein
To create C-terminal YFP tagged cAR1, YFP DNA was created by polymerase chain reaction. The N-terminal primer, CGGCTAGCATGGTGAGCAAGGGCGAGGAG, contained an Xbal1 site at 5'end, followed by the N-terminal residues of YFP. The C-terminal primer, GCTCTAGACTTGTACAGCTCGTCCATGCC, contained the last seven residues of YFP, followed by a Nhe1 site. pEYFP (from CLONTECH) was used as the template. The PCR products were double digested with Xbal1 and Nhe1 and then cloned into the Nhe1 site of the Dictyostelium cAR1 expression plasmid (Parent et al., 1998). The DNA was purified and transformed into JB4 cells (car1-) by electroporation (Zigmond et al., 1981). Clones were grown up in a Petri dish in HL5-medium containing 10-µg/ml G418. Cells were cultured in 6-well plates in axenic medium with addition of µg/ml ampicillin and 100-µg/ml mixture of penicillin and streptomycin (1:1) at 22 °C. The expression level of the cAR1-eYFP in car1- cells was calculated in the following manner. The fluorescence of the cells at the membrane before measurement was in average 10 times higher than the fluorescence expected for a single molecule (1000 cnts / 3 ms versus 100 cnts / 3 ms). Thus, there were on average 10 receptors within each diffraction-limited area (s = πr2 = 0.03 µm2,
with r = 1.22.λ/(2NA) = 220 nm, for a wavelength λ = 514 nm). For the whole cell, the surface of the membrane was S = 4πR2 = 314 µm2, where R = 5 µm is the typical radius of
the cell. This lead to a total number of receptors N = 10 S/s = 105, which is comparable to
the expression level of endogenous receptors in wild type cells. 3.5.2 Developmental check car1- expressing cAR1-eYFP
Transformants were plated on NN plates at a concentration of 107 cells/ml.
Development was monitored for the next 30 hours with a confocal microscope (Leica MZFLIII).
3.5.3 Immunoblotting
Protein samples taken from car1- cells. cAR1-eYFP/car1- cells were solubilized with SDS-sample buffer and resolved by SDS-PAGE on 10% gels along with a set of protein MW standards. cAR1-eYFP was detected by immunoblotting with anti-GFP antibody. Free YFP was also run on the gel and immunoblotted.
3.5.4 Cell preparation and measurement
Resting cells were transferred to phosphate buffer (0.534g. Na2HPO4, 0.952g. KH2PO4
to 1 liter of H2O, set pH to 6.5) after 1 night in low fluorescence medium(Liu et al., 2002)
chemotaxis needle assay the cells were maintained overnight in low fluorescence medium and starved for 6-8 hours in phosphate buffer at 22 °C. Before measuring the cells were tested to be aggregation competent. All measurements were performed in 2 wells, chambered cover-glasses (1.5 Borosilicate Sterile, Lab Tek II). The cells were placed in a distance of 75 µm from the opening (r = 0.5 µm) of a pipette filled with 10 mM of cAMP. The internal pressure in the pipette was set to 40 kPa by means of a FemtoJet (Eppendorf) to create a stable shallow gradient of 0.4nM/µm cAMP at the position of the cell. After positioning the needle the cells were measured within a minute, taking time to focus on the cell and perform single molecule measurements. The anterior and posterior region of the cell that was measured was determined by positioning a region ~1/3 of the whole length of the cell from the leading and trailing edge resp. in the focal plane. At least 25 cells were measured for every condition.
3.5.5 Labelling membrane with marker
Concanavalin A-Alexa 647 conjugate (Invitrogen) was used as a marker to label the plasma membrane. Concanavalin A selectively binds to mannopyranosyl and α-glucopyranosyl residues. Cells where incubated for 10-15 minutes in 1ml of 80ng/ml Con-A in charcoal filtered PB. The excess marker was removed by washing the cells 3 times with charcoal filtered PB before measuring.
3.5.6 Single-molecule microscopy
The experimental setup for single-molecule imaging has been described in detail previously (Schmidt et al., 1995). The samples were mounted onto an inverted microscope (Zeiss) equipped with a 100x objective (NA=1.4, Zeiss). The intensity of the laser was set to 2 kW/cm2. The region-of-interest was set to 50x50 pixels with an apparent pixel-size of
220 nm. Measurements were done by illumination of the samples for 5 ms at 514 nm (Ar+-laser, Newport Spectra Physics) at intensity of 2 kW/cm2. The cells were photobleached for
a period of 2.5-5 s at an intensity of 2 kW/cm2 before a sequence of typically 100 images
with a timelag of 44 ms were taken. Use of appropriate filter combinations (DCLP 530, HQ570/80; Cy3/Cy5, Chroma Technology, and OG 530, Schott) permitted the detection of the fluorescence signal by a liquid nitrogen-cooled CCD-camera (Princeton Instruments). The total detection efficiency of the experimental setup was 8%. This setup allows imaging of individual fluorophores within a time-frame of a few milliseconds at a signal-to-background ratio of 30. Under these conditions and for millisecond integration periods, the auto-fluorescent proteins have photon emission rates of ~3000 photons/ms, saturation intensities from 6-50 kW/cm2, and photo-bleaching yields from 10-4 to 10-5. eYFP is
3.5.7 Fitting algorithm with background subtraction
Each image of an image stack contained in addition to the fluorescence signals from individual YFP molecules autofluorescence from the cell. In order to correct for autofluorescence an algorithm was developed which subtracted a sliding weighted-mean image from each image of the sequence. The weights were Gaussian distributed with a width of 40 images. By this algorithm any slow moving signal i.e. a bright vesicle was effectively removed. The algorithm was validated by simulation, containing Brownian trajectories, the corresponding fluorescent peaks, autofluorescence computed from a typical file and additional noise.
3.5.8 Fitting the cumulative possibility distributions of the square displacements
We used a model in which two populations of receptors, mobile receptors with fixed diffusion constant, D, and immobile receptors were assumed. We made the assumption that the D of the receptor was not changed with genetic background. This assumption is substantiated by our finding that the fluidity of the membrane was the same for the anterior and posterior of the cell. The square displacements of all measurements (all datasets) were stacked together and from this the D = 0.19 ± 0.02 µm2/s was calculated. Our global-fit
