UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl)
Molecular regulation of death receptor- and DNA damage-induced apoptosis
Maas, C.
Publication date
2010
Link to publication
Citation for published version (APA):
Maas, C. (2010). Molecular regulation of death receptor- and DNA damage-induced
apoptosis.
General rights
It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s)
and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open
content license (like Creative Commons).
Disclaimer/Complaints regulations
If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please
let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material
inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter
to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You
will be contacted as soon as possible.
Chapter
Manuscript in preparation
Chiel Maas, Lambertus W. van de Kooij, Gleb Savich, Roderick Beijersbergen and Jannie Borst
Identification of SRP72 as an essential
regulator of TRAIL-induced apoptosis
Identification of SRP72 as an essential regulator of
TRAIL-induced apoptosis
Chiel Maas1, Lambertus W. van de Kooij1, Gleb Savich2, Roderick Beijersbergen3 and
Jannie Borst1,4
1Division of Immunology, The Netherlands Cancer Institute, 1066 CX Amsterdam, The Netherlands
2Current address: Lineberger Comprehensive Cancer Center, University of North Carolina, Chapel Hill, NC 27599, USA
3Division of Molecular Carcinogenesis, The Netherlands Cancer Institute, Amsterdam, the Netherlands
4Correspondence to Jannie Borst: j.borst@nki.nl
TRAIL is a death receptor ligand of the TNF superfamily with great potential as an anti-cancer therapeutic. In contrast to its close relatives Fas/CD95 ligand and TNFα, TRAIL can selectively kill tumor cells, leaving most normal untransformed cells unharmed and causing very low toxicity in vivo. Currently, the molecular basis underlying its tumor cell specificity is not entirely clear. By means of a large loss-of-function RNAi screen in breast carcinoma MCF-7 cells, we identified signal recognition particle 72 (SRP72) as a factor uniquely regulating TRAIL-induced apoptosis. Depletion of SRP72 by RNAi blocked TRAIL-induced apoptosis but did not affect the response to Fas ligand or TNFα. Whereas SRP72 deficiency mediated a strong reduction in cell surface levels of DR4, this did not mediate the resistance to TRAIL. Rather, SRP72 RNAi rendered cells unable to efficiently form the DR5 death inducing signaling complex (DISC), hampering activa-tion of Caspase-8 at the receptor tail and further inducactiva-tion of apoptosis. Interestingly, SRP72 is more highly expressed in tumor cells than in untransformed cells, which might (at least partly) explain their differential sensitivity to TRAIL.
Tumor necrosis factor (TNF)-related apoptosis inducing ligand (TRAIL) is a death receptor ligand of the TNF family, with high potential as a cancer therapeutic. Unlike its close relatives Fas ligand and TNFα, TRAIL preferentially induces apoptosis in tumor cells, while leaving most normal cells untouched [1,2]. While severe toxicity has been observed with Fas ligand and TNFα following their systemic administration [3-6], which halted their clinical application, no overt side-effects have been documented
in vivo for TRAIL. At non-toxic levels, TRAIL
could effectively kill different transferred tumor cells in vivo [1,2]. As a result, different TRAIL receptor agonists are currently being tested in various phase I and II clinical trials,
as monotherapies and in combination with conventional therapeutics [7].
TRAIL can bind five receptors; Death Receptor 4 (DR4), Death Receptor 5 (DR5), Decoy Receptor 1 (DcR1), Decoy Receptor 2 (DcR2) and Osteoprotegerin. Whereas DR4 and DR5 signal apoptosis, DcR1, DcR2 and Osteoprotegerin are non-apoptotic and behave as decoy receptors [8]. Binding of TRAIL to DR4 or DR5 results in receptor trimerization and formation of the death-inducing signaling complex (DISC), through recruitment of FADD and Caspase-8. This results in auto-catalytic processing of Caspase-8, which subsequently cleaves and activates the effector caspases . Caspase-8 also cleaves BH3-only protein Bid, which mediates
Introduction
mitochondrial permeabilization and cytosolic release of several pro-apoptotic factors, further enhancing effector caspase activation [9-11]. Effector caspases subsequently cleave a large subset of proteins and irreversibly induce cell demise.
It is not yet entirely clear why TRAIL selectively kills tumor cells. Differences in the expression levels of decoy receptors DcR1 and DcR2 has been suggested to underlie the differential TRAIL sensitivity of untransformed and tumor cells. Although DcR1 and DcR2 do confer resistance to TRAIL when overexpressed [12], a clear correlation between their expression levels and TRAIL sensitivity in healthy and tumor cells has not been found [13]. Interestingly, a recent study has shown that enhanced expression of O-glycosyltransferases might render tumor cells more sensitive to TRAIL. The level of O-glycosylation of DR4 and DR5 was shown to determine their capacity to cluster and mediate apoptosis and expression levels of O-glycosyltransferase GALNT14 was found to correlate with TRAIL sensitivity in different tumor cell-lines [14]. However, GALNT14 expression levels did not predict TRAIL sensitivity in all cell lines studied, indicating that additional factors exist that regulate the response to TRAIL. To find novel modulators of TRAIL-induced apoptosis, we performed a clonogenicity-based RNAi screen in breast carcinoma MCF-7 cells, in which we targeted 7.914 different genes with 23.742 short hairpin (sh)RNA constructs. Hereby, we identified Signal Recognition Particle 72 (SRP72) as a crucial regulator of TRAIL-induced apoptosis. Silencing of SRP72 expression by RNAi inhibited both apoptosis and clonogenic elimination of TRAIL-treated MCF-7 cells. SRP72 RNAi mediated specific downregulation of cell surface levels of DR4, not affecting those of DR5. However, in the cells studied TRAIL induced apoptosis almost entirely via DR5, indicating that SRP72 RNAi inhibits DR5-mediated apoptosis as well. Interestingly, responses to Fas ligand and TNFα were unaffected, indicating that SRP72 specifically regulates TRAIL-induced apoptosis.
Identification of SRP72 as a regulator of TRAIL-induced apoptosis
To identify new regulators of TRAIL-induced apoptosis, we performed a clonogenicity-based RNAi screen. Breast carcinoma MCF-7 cells were chosen for the screen as these cells are well characterized for their response to death receptor ligands. MCF-7 cells, normally devoid of Caspase-3, were reconstituted with Caspase-3 to render them sensitive to IZ-TRAIL. Only 1 in 5.000 MCF-7Casp-3 cells was found to be spontaneously resistant to 50 ng/ ml IZ-TRAIL (data not shown). The NKI shRNA library, containing 23.742 shRNA constructs targeting 7.914 different genes (3 shRNAs/
Results
Figure 1. Schematic outline of the TRAIL RNAi screen.
MCF-7Casp-3 cells were transduced with the NKI shRNA library
and were plated at a density of 150.000 cells per 15 cm dish. Cells were left untreated or were treated with 50 ng/ml Iso-leucine-zippered (IZ)-TRAIL twice, on day 1 and 4 after plat-ing. After 15 days, surviving cells were collected. ShRNA in-serts from untreated and TRAIL-treated cells were recovered by PCR and fluorescently labeled. Labeled PCR products were combined and hybridized to oligonucleotide arrays recognizing the different shRNAs present in the NKI shRNA library.
MCF-7Casp-3 cells
Transduction with shRNA library
Control TRAIL 15 days
Recovery of shRNAs by PCR and identification with oligonucleotide array
gene) [15], was stably transduced into MCF-7Casp-3 cells. Cells were left untreated or were treated with 50 ng/ml Isoleucine-zippered (IZ)-TRAIL for 15 days. Genomic DNA was isolated from untreated and TRAIL-treated cells and shRNAs were recovered by PCR. PCR-products were amplified, fluorescently labeled and hybridized to oligonucleotide arrays recognizing all shRNAs present in the NKI library (Figure 1). The relative abundance of each shRNA present in TRAIL-treated cells was compared with that in untreated cells. ShRNAs significantly enriched in TRAIL-treated cells were considered to mediate TRAIL resistance and thus target proteins essential for TRAIL-induced apoptosis. The screening approach was validated by the selection of a Caspase-8 shRNA. In addition, two SRP72 shRNAs were found to be enriched in TRAIL-treated cells. The fact that 2 different shRNAs emerged from the screen that targeted
SRP72 immediately validated it as a regulator of TRAIL-induced apoptosis.
SRP72 regulates TRAIL-induced apoptosis and clonogenic elimination
To show that SRP72 is indeed a modulator of TRAIL-induced apoptosis, we transduced MCF-7Casp-3 cells with each of the SRP72 shRNA constructs identified in the RNAi screen. SRP72 mRNA (Figure 2a) and protein expression (Figure 2b) were efficiently silenced by shRNAs 1 and 2. To examine the effect of SRP72 RNAi on TRAIL-induced apoptosis, we monitored Caspase-3 cleavage by flow cytometry in control and SRP72 RNAi cell-lines after 3 h treatment with 25, 50 or 100 ng/ml IZ-TRAIL. In addition, we studied the effect of SRP72 RNAi on clonogenicity following TRAIL treatment. TRAIL-induced apoptosis was significantly inhibited by SRP72 RNAi in both
Figure 2. SRP72 is a regulator of TRAIL-induced apoptosis and clonogenic elimination. MCF-7Casp-3 cells were stably
transduced (Td) with an empty RNAi vector (EV) or with the SRP72 shRNAs 1 or 2 identified in the RNAi screen. (a,b) SRP72 mRNA (a) and protein (b) levels are reduced in cells transduced with shRNA1 and shRNA2 as compared to cells transduced with EV, as demonstrated by qRT-PCR and immunoblotting on total cell lysates, respectively. Actin serves as a loading control. (c) MCF-7Casp-3
cells expressing EV, SRP72 shRNA1 or shRNA2 were exposed to the indicated dosages of IZ-TRAIL. Apoptosis levels were deter-mined as the % of cells with cleaved Caspase-3 after 3h. Data presented are expressed as mean of 3 independent experiments + S.D. (d) MCF-7Casp-3 cells expressing EV, SRP72 shRNA1 or shRNA2 were plated at 50.000 cells per 10 cm dish and treated with
50 ng/ml IZ-TRAIL for 15 days. Resistant colonies were visualized with Coomassie-blue fixing solution. Results are representative of 3 independent experiments. 0 0,2 0,4 0,6 0,8 1,0 1,2 EV SRP72 shRNA1 shRNA2SRP72 R el at iv e SR P7 2 m R N A le ve ls % cell s w ith cl ea ve d Ca sp-3 TRAIL (ng/ml) 0 10 20 30 40 50 60 70 0 25 50 100 EV SRP72 shRNA1 SRP72 shRNA2 EV SRP72 shRNA1 shRNA2SRP72 TRAIL SRP72 Actin EV shRNA1 shRNA2 63 Td: Blot: SRP72 SRP72 a b c d
cell-lines (Figure 2c). In support, both SRP72 RNAi cell-lines displayed enhanced clonogenic survival upon exposure to TRAIL (Figure 2d). This proves that SRP72 fulfils an important role in the regulation of TRAIL-induced apoptosis and clonogenic elimination.
SRP72 uniquely regulates TRAIL-induced apoptosis; it does not modulate Fas ligand- and TNFα-induced apoptosis
Next, we investigated whether SRP72 also regulates the apoptotic responses to TRAIL’s close relatives Fas ligand and TNFα. For this purpose, we exposed control and both SRP72 RNAi MCF-7Casp-3 cell-lines to 5, 10 or 20 ng/ml of the Fas ligand variant Apo010 [16], 2.5, 5, or 10 ng/ml TNFα plus 10 µg/ml cycloheximide or to 25, 50 or 100 ng/ml IZ-TRAIL as a positive
control and assessed Caspase-3 cleavage by flow cytometry as a measure of apoptosis induction. Interestingly, SRP72 deficiency did not influence both Apo010- and TNFα-induced apoptosis, while it did inhibit TRAIL-induced apoptosis in the same experiments (Figure 3). This indicates that SRP72 uniquely regulates TRAIL-induced apoptosis.
TRAIL-induced apoptosis is blocked at the level of Caspase-8 processing in SRP72-deficient cells
To study at which level SRP72 regulates the TRAIL-induced apoptosis, we analyzed the processing of different pro-apoptotic proteins by immunoblotting in control and SRP72 RNAi cells after treatment with TRAIL. Control and SRP72 RNAi MCF-7Casp-3 cells were exposed to 100 ng/ml IZ-TRAIL for 2h, 4h and 6h and the fates of Caspase-8, Bid and Caspase-9 were studied by immunoblotting. In both SRP72 RNAi cell-lines, apoptosis signaling was already found to be blocked at the level of Caspase-8 processing. Processing of Bid and Caspase-9, downstream of Caspase-8, were also blocked (Figure 4a). Caspase-3 can amplify cleavage and activation of Caspase-8 in a feedback loop [17]. To exclude the possibility that Caspase-8 processing was inhibited as a result of inhibition of Caspase-3 activity, we studied TRAIL-induced Caspase-8 processing in control and SRP72 RNAi cells in presence of 200 µM of the Caspase-3 inhibitor DEVD. Similar to what we observed before, Caspase-8 processing was also inhibited in both SRP72 RNAi cell-lines in presence of DEVD (Figure 4b). Thus, TRAIL-induced apoptosis is inhibited at the level of Caspase-8 activation or prior to that, in SRP72 deficient cells.
DR4-, but not DR5-cell surface levels are strongly reduced in SRP72 deficient cells
As Caspase-8 activation was hampered in SRP72-deficient cells, we next assessed whether the cell surface levels of each of the TRAIL receptors, DR4 and DR5, were affected by SRP72 RNAi. Both DR4 and DR5 were detected at the surface of MCF-7Casp-3 cells by Figure 3. SRP72 is a regulator of TRAIL-induced
apop-tosis but not of Fas ligand- and TNFα-induced apopto-sis. MCF-7Casp-3 cells stably expressing EV, SRP72 shRNA1 or
shRNA2 were exposed to the indicated dosages of IZ-TRAIL, APO010 or TNFα + CHX. Apoptosis levels were determined as the % of cells with cleaved Caspase-3 after 3h. Data pre-sented are expressed as mean of 3 independent experiments + S.D. 0 20 40 60 0 25 50 100 TRAIL (ng/ml) EV SRP72 shRNA1 SRP72 shRNA2 0 20 40 60 80 0 5 10 20 APO010 (ng/ml) % cell s w ith cl ea ve d Ca sp-3 0 20 40 60 CHX CHX+2.5 CHX+5 CHX+10 TNFD (ng/ml)
flow cytometry using DR4- and DR5-specific antibodies (Figure 5a and 5b). Cell surface levels of DR4 were strongly decreased in both SRP72 RNAi cell-lines, compared to those in the control cell-line, but cell surface levels of DR5 were not affected. Thus, SRP72 selectively modulates cell surface levels of DR4.
Reduction in DR4 cell surface levels in SRP72 RNAi cells is not caused by enhanced endocytosis
Clathrin-mediated receptor endocytosis can be inhibited through the overexpression of a GTPase defective, dominant-negative point mutant of Dynamin-1 (K44A) [18,19]. We have previously found that in MCF-7Casp-3 cells, DR4 cell surface levels are selectively regulated by clathrin-mediated receptor endocytosis. Overexpression of K44A Dynamin-1 mediated a two-fold upregulation of DR4 cell surface levels, but had no effect on DR5 cell surface levels. To study whether the selective downregulation of DR4 cell surface levels we observed in SRP72 RNAi cells was caused by enhanced clathrin-mediated endocytosis, we overexpressed K44A Dynamin-1. Control (EV) and SRP72 RNAi MCF-7Casp-3 cells were transfected with empty vector (pcDNA3) or K44A Dynamin-1 together with GFP. DR4 cell surface expression was analyzed in transfected (GFP positive) cells. As observed before, DR4 cell surface levels were enhanced two-fold in control cells upon overexpression
of K44A Dynamin-1, whereas DR5 levels were unaffected (Figure 6). DR4 cell surface levels in SRP72 RNAi cells could not be restored with K44A Dynamin-1. DR5 cell surface levels remained unaffected. This indicates that SRP72 does not mediate downregulation of DR4 cell surface expression by enhancing DR4 endocytosis.
MCF-7Casp-3 cells are dependent on DR5 for
IZ-TRAIL-induced apoptosis
We next studied whether the reduction of DR4 cell surface levels mediated by SRP72 RNAi was the cause of resistance to IZ-TRAIL in MCF-7Casp-3 cells. To this end, we silenced DR4 expression with two independent transfectable siRNAs or introduced a control siRNA and tested the effect of DR4 RNAi on IZ-TRAIL-induced apoptosis. Similarly, we silenced DR5 expression with two independent siRNAs to test its level of contribution to IZ-TRAIL-induced apoptosis in MCF-7Casp-3 cells. To validate effective RNAi, cell surface levels of DR4 and DR5 were determined 72 h after transfection with each of the siRNAs. All 4 of the siRNAs efficiently silenced the cell surface expression of the targeted receptor and did not affect the other receptor (Figure 7a). Transfected cells were exposed to 50 ng/ml TRAIL for 3h and apoptosis levels were determined as the % of cells with cleaved Caspase-3. Surprisingly, DR4 RNAi did not affect the response to IZ-TRAIL,
TRAIL (100 ng/ml) Casp-8 Bid Casp-9 - 2h 4h 6h - 2h 4h 6h - 2h 4h 6h EV SRP72 shRNA1 SRP72 shRNA2 Actin Blot: Cells: Tx: 49 17 49 Casp-8 - 2h 4h 6h - 2h 4h 6h - 2h 4h 6h EV SRP72 shRNA1 SRP72 shRNA2 TRAIL (100 ng/ml) +DEVD 200 PM Actin Cells: Tx: Blot: 49
Figure 4. TRAIL-induced apoptosis is inhibited at the level of Caspase-8 processing in SRP72-deficient cells.
(a) MCF-7Casp-3 cells stably expressing
EV, SRP72 shRNA1 or SRP72 shRNA2 were treated (Tx) with 100 ng/ml IZ-TRAIL for the indicated periods of time. Full-length Caspase-8, Bid and Cas-pase-9 were detected by immunoblot-ting. Actin served as a loading control. (b) Upstream Caspase-8 cleavage is inhibited in SRP72-deficient cells. MCF-7Casp-3 cells stably expressing EV, SRP72
shRNA1 or SRP72 shRNA2 were treated (Tx) with 200 μM DEVD and 100 ng/ ml IZ-TRAIL for the indicated periods of time. Full-length Caspase-8 was de-tected by immunoblotting. Actin served as a loading control.
a
whereas DR5 RNAi mediated strong resistance (Figure 7b). This observation indicates that MCF-7Casp-3 cells are dependent on DR5 for IZ-TRAIL-induced apoptosis. Moreover, it suggests that SRP72 RNAi might not mediate resistance to IZ-TRAIL in MCF-7Casp-3 cells through the effect on DR4 cell surface expression but through an additional effect in the DR5 apoptosis pathway.
TRAIL-induced DISC formation is impaired in SRP72 RNAi cells
Thus, we found that MCF-7Casp-3 cells depend on DR5 for IZ-TRAIL induced apoptosis. In addition, we found that SRP72 RNAi mediates a block in IZ-TRAIL-induced apoptosis upstream of Caspase-8 in MCF-7Casp-3 cells. Since we found that cell surface levels of DR5 were not affected by SRP72 RNAi, we reasoned that a decreased ability to compose the DR5 death-inducing signaling complex (DISC) could be the cause of TRAIL resistance. The DISC is generated upon ligation of TRAIL to either DR4 or DR5 through receptor trimerization and recruitment of adaptor molecule FADD and inducer Caspases-8 and/or -10. Formation of the DISC results in activation of Caspase-8/-10, which cleave the effector caspases and BH3-only protein Bid to further promote apoptosis. We studied whether DISC formation was impaired in SRP72 RNAi cells by using an established DISC isolation procedure, which
involves stimulation with Flag-tagged TRAIL and subsequent immunoprecipitation with an anti-Flag antibody [11]. This allows for the isolation of the Flag-TRAIL activated DISC complex and visualization of its components. To test whether SRP72 RNAi also mediates resistance to Flag-TRAIL, control and SRP72 RNAi cells were exposed to 25, 50 and 100 ng/ml Flag-TRAIL for 3 h and apoptosis levels were determined as the % of cells with cleaved Caspase-3. Exposure to IZ-TRAIL was used as a positive control. SRP72 RNAi cells were more resistant to Flag-TRAIL than
DR4 DR5 FL4-H 0 10 101 102 103 104 C ou nt 140 105 70 35 0 FL4-H 0 10 101 102 103 104 C ou nt 120 90 60 30 0 0 5 10 15 20 25 EV SRP72 shRNA1 shRNA2SRP72 D R 5 M FI 0 5 10 15 20 25 EV SRP72 shRNA1 shRNA2SRP72 D R 4 M FI Sec.Ab. EV SRP72 shRNA2 Sec.Ab. EV SRP72 shRNA2
Figure 5. SRP72 deficiency mediates a strong decrease in DR4-, but not DR5-, cell surface levels. (a,b) DR4
and DR5 cell surface levels in MCF-7Casp-3
cells stably expressing EV, SRP72 shRNA1 or shRNA2 were assessed by FACS analy-sis. Data are shown as raw FACS plots for aspecific secondary antibody stainings (Sec.Ab.) and specific antibody stain-ings of EV and SRP72 shRNA2 expressing cells (a) and as bar diagrams for specific antibody stainings of EV, SRP72 shRNA1 and SRP72 shRNA2 expressing cells (b). Values on x-axis (FL-4) of raw data plots indicate mean fluorescent intensity (MFI) and on y-axis (counts) indicate number of cells. Mean MFI values of 3 independent experiments of specific antibody stainings are depicted in (b). 0 10 20 30 40 50 60 70
+EV2 +dnDynEV1 shRNA1SRP72
+EV2 SRP72 shRNA1 +dnDyn M FI EV1 DR4 DR5
Figure 6. Decrease in DR4 cell surface levels in SRP72-deficient cells is not caused by enhanced endocytosis. MCF-7Casp-3 cells stably expressing EV or SRP72 shRNA1 were transfected with an empty vector (EV2) or with the same vec-tor carrying dominant-negative (K44A) Dynamin-1, together with a vector carrying GFP. Cell surface expression of DR4 and DR5 of transfected (GFP-positive) cells was assessed by FACS analysis. Values indicate mean fluorescent intensity (MFI) and are respresentative of 2 independent experiments.
a
to IZ-TRAIL (Figure 8a). Next, we studied the relative contributions of DR4 and DR5 to apoptosis induced by Flag-TRAIL. For this purpose, we treated DR4 and DR5 RNAi cells with 80 ng/ml Flag-TRAIL, or 100 ng/ml IZ-TRAIL as a positive control, and determined the level of apoptosis as the % of cells with cleaved Caspase-3. Whereas the response to IZ-TRAIL was again found to be almost entirely dependent on DR5, the response to Flag-TRAIL was found to rely more on DR4 than on DR5 (Figure 8b). With the DISC isolation procedure
we found that SRP72 RNAi cells were less able to form a DISC than control cells. Control and SRP72 RNAi cells were exposed to 60 ng/ml pre-crosslinked Flag-TRAIL for 1, 2 and 4 h, after which the Flag-TRAIL-bound DISC was immunoprecipitated with anti-Flag antibody and DISC-components FADD and Caspase-8 were visualized by immunoblotting. FADD and Caspase-8 were found to be recruited less efficiently to the DISC in SRP72 RNAi cells (Figure 8c). Thus, a reduced capacity to form the DISC appears to underlie the TRAIL resistance imposed by SRP72 deficiency.
SRP72 expression is elevated in cancer cells
A major question is why many cancer cells are sensitive to TRAIL and normal cells are not. Differences in expression of factors specifically regulating the TRAIL response are likely underlying their differential sensitivity. Recently, expression of O-glycosylation enzyme GALNT14 has been shown to correlate with TRAIL sensitivity. The level of glycosylation of DR4 and DR5 was found to determine their capacity to cluster and mediate apoptosis [14]. Similarly, enhanced expression of SRP72 in cancer cells might render them more sensitive to TRAIL. We compared SRP72 expression in cancer vs. normal cells with the GeneSapiens gene expression database (wwww.genesapiens.org) and found that SRP72 expression is indeed elevated in many types of cancer (Supplementary Figure 1). It would be interesting to see whether SRP72 expression also correlates with TRAIL sensitivity in these different cancer types.
With an unbiased clonogenicity-based RNAi screen, we identified SRP72 as an important regulator of TRAIL-induced apoptosis. Out of 23.742 shRNA constructs introduced into breast carcinoma MCF-7Casp-3 cells, two independent shRNA constructs targeting SRP72 mRNA were identified to promote clonogenicity after TRAIL treatment, validating SRP72 immediately as
0 60 120 180
C
siRNA siRNA1DR4 siRNA2DR4 siRNA1DR5 siRNA2DR5
DR 5 MFI 0 20 40 60 80 100 120 140 C
siRNA siRNA1DR4 siRNA2DR4 siRNA1DR5 siRNA2DR5
R el . % c el ls w ith cl ea ve d C as p-3 0 30 60 90 C
siRNA siRNA1DR4 siRNA2DR4 siRNA1DR5 siRNA2DR5
DR
4
MFI
a
b
Figure 7. MCF-7Casp-3 cells are dependent on DR5 for
apoptosis induction by IZ-TRAIL. DR5 RNAi completely
abrogates IZ-TRAIL induced apoptosis, while DR4 RNAi has no effect. MCF-7Casp-3 cells were transfected with Control, DR4 or
DR5 siRNAs. (a) DR4 and DR5 RNAi were validated by assess-ing DR4 and DR5 cell surface levels by FACS analysis, 72 h after transfection. Values indicate mean fluorescent intensity (MFI) and are representative of 3 independent experiments. (b) Transfected cells described in (a) were exposed to 50 ng/ ml TRAIL for 3h and apoptosis levels were determined as the % of cells with cleaved Caspase-3. Apoptosis levels in C siRNA transfected cells are set at 100% and those in DR4 and DR5 siRNA transfected cells are depicted as relative percentages of these levels. Data presented are expressed as mean of 3 independent experiments + S.D.
a true hit. When individually introduced, both shRNAs induced efficient SRP72 RNAi and mediated resistance to TRAIL-induced apoptosis and clonogenic elimination. SRP72 is part of the larger signal recognition particle (SRP) complex, which consists of 5 other proteins (SRP9, SRP14, SRP19, SRP54, SRP68) and a single RNA subunit. The SRP complex binds to newly synthesized secretory and membrane proteins carrying a signal peptide and regulates their import into the endoplasmic reticulum (ER), hereby controlling their secretion and transport to the plasma membrane, respectively. Previously, SRP72 was identified in an RNAi screen with transfectable synthetic siRNAs to specifically regulate apoptosis mediated via the TRAIL receptor DR4, not via DR5, in both cervical carcinoma HeLa cells and colon carcinoma HCT15 cells [20]. Subsequently, silencing of either SRP72 or SRP54 was shown to mediate a dramatic reduction in DR4-, but not DR5-, cell surface levels and resistance
to a DR4-specific agonistic antibody and recombinant TRAIL. In agreement, we find in breast carcinoma MCF-7Casp-3 cells that SRP72 RNAi abrogates the membrane expression of DR4 but not DR5 and mediates resistance to apoptosis induction by isoleucine-zippered (IZ)-TRAIL. In addition, we show that SRP72 deficiency also enhances clonogenicity of IZ-TRAIL-exposed tumor cells. This implicates that the SRP complex is a generally important regulator of DR4 membrane transport and apoptosis induction by TRAIL. Furthermore, Ren et al. report that SRP72 deficiency does not influence the levels of Fas ligand and TNFα receptors (Fas and TNF-R1, respectively) and, correspondingly, cell death mediated upon their activation. Consistently, we find that apoptosis in response to Fas ligand and TNFα is unaffected in SRP72 deficient cells. The SRP complex thus specifically regulates TRAIL-mediated apoptosis. This finding has important implications for future anti-cancer therapy Figure 8. TRAIL-induced DISC formation is impaired in SRP72-deficient cells. (a) SRP72 RNAi cells are more resistant to
Flag-TRAIL than to IZ-TRAIL. MCF-7Casp-3 cells stably expressing EV, SRP72 shRNA1 or SRP72 shRNA2 were exposed to the
indi-cated dosages of IZ-TRAIL or Flag-TRAIL. Apoptosis levels were determined as the % of cells with cleaved Caspase-3 after 3h. Data presented are expressed as mean of 3 independent experiments + S.D. (b) MCF-7Casp-3 cells are more dependent on DR4
than on DR5 for Flag-TRAIL-induced apoptosis. MCF-7Casp-3 cells were transfected with Control, DR4 or DR5 siRNAs. Transfected
cells were exposed to 100 ng/ml IZ-TRAIL or 80 ng/ml Flag-TRAIL for 4 h and apoptosis levels were determined as the % of cells with cleaved Caspase-3. Data shown are representative of 3 independent experiments. (c) DISC formation upon exposure to Flag-tagged TRAIL is impaired in SRP72 RNAi cells. MCF-7Casp-3 cells stably expressing EV or SRP72 shRNA2 were treated (Tx)
with Flag-TRAIL precoupled to biotinylated anti-Flag antibody for the indicated periods of time. TRAIL-bound receptor complexes were isolated using streptavidin-conjugated sepharose beads. Protein levels of p53/p55 Caspase-8 pro-form, its cleavage p41/43 product and FADD in the immunoprecipitated DISC were detected by immunoblotting.
0 10 20 30 40 C DR4
siRNA1siRNA2DR4 siRNA1DR5 siRNA2DR5 0 20 40 60 0 25 50 100 EV SRP72 shRNA1 SRP72 shRNA2 TRAIL (ng/ml) % cell s w ith cl ea ve d Ca sp-3 0 10 20 30 40 50 60 C DR4
siRNA1siRNA2DR4 siRNA1DR5 siRNA2DR5
% cell s w ith cl ea ve d Ca sp-3 0 10 20 30 40 50 60 70 0 20 40 80 FLAG-TRAIL (ng/ml) EV SRP72 shRNA1 SRP72 shRNA2 Flag-TRAIL 60ng/ml Blot: - 1h 2h 4h - 1h 2h 4h EV SRP72 shRNA2 Caspase-8 63 49 38 FADD 28 Tx: Cells: a b c
with TRAIL-receptor targeting therapeutics, as SRP72 levels might be an informative biomarker for TRAIL sensitivity in tumors.
It remains unclear why disruption of the SRP complex, by RNAi of one of its components, specifically impairs the membrane transport of DR4, and not that of DR5. We have previously found that DR4 has a higher turn-over at the plasma membrane than DR5 and is continuously being internalized by means of clathrin-mediated endocytosis (Verbrugge et al, unpublished). We examined the possibility that enhanced internalization of DR4 in SRP72 deficient cells was the cause of its selective downregulation at the plasma membrane. By abrogating clathrin-mediated receptor internalization with dominant-negative Dynamin-1, we excluded this option. As previously observed by Ren et al., selective impairment of ER-import of DR4 appears to underlie its decreased membrane expression instead. SRP54-deficient cells displayed reduced ER-import of DR4, but not of DR5 [20]. Possibly, DR5 has higher affinity for the SRP complex than DR4 and, as a result, can still be imported into the ER and transported to the plasma membrane in presence of low SRP levels. If this is the case, exchange of the signal peptide of DR4 with that of DR5 would be expected to restore membrane targeting of DR4 and impede that of DR5.
Ren et al. also observed that a significant amount of DR4 was arrested in the trans-Golgi network (TGN) in SRP54-deficient cells. As ER import of DR4 was disturbed, this pool could not have been de novo-synthesized DR4 destined for the plasma membrane. Rather, it might have been DR4 endocytosed from the plasma membrane and targeted to the TGN for recycling. As the signal peptide is cleaved off from newly synthesized proteins upon entering of the ER, SRP54 can probably not regulate this retrograde transport of DR4 directly. Therefore, we suspect that SRP54 RNAi mediates DR4 accumulation in the TGN indirectly, by inhibiting the import of TGN-resident proteins required for further retrograde transport of DR4. Whereas Ren et al. concluded that DR5-mediated apoptosis was not affected by silencing
of SRP72 or SRP54, our results suggest that apoptosis via DR5 is also inhibited by SRP72 RNAi. By individually silencing DR4 and DR5, we found that IZ-TRAIL-induced apoptosis in MCF-7Casp-3 cells proceeds almost entirely via DR5. As SRP72 RNAi strongly impaired the response to IZ-TRAIL in these cells, we conclude that SRP72 also regulates DR5-mediated apoptosis. Although not as clear as with DR4, the response to DR5 agonistic antibody also appears to be inhibited in stable SRP54 and SRP72 RNAi cell-lines in the study of Ren et al. This effect might however become increasingly prevalent when clonogenicity is assessed in these cell lines. In our study, inability to efficiently form the DR5 death-inducing signaling complex (DISC) appeared to underlie this resistance to IZ-TRAIL. However, results were difficult to interpret because the response to the Flag-tagged TRAIL used for the DISC isolation procedure depended more on DR4 than DR5. This is in contrast to the response to IZ-TRAIL, which almost entirely depended on DR5 in MCF-7Casp-3 cells. Further analysis should reveal whether SRP deficient cells indeed have difficulties with DR5 DISC formation and what is the cause of this. O-glycosylation by the Golgi-resident O-glycosyl-transferase GALNT14 has recently been shown to enhance the ability of DR4 and DR5 to cluster and mediate apoptosis [14]. Possibly, SRP72 RNAi also impairs the import of GALNT14 into the Golgi apparatus, hereby mediating a reduction in O-glycosylation of the TRAIL receptors and hampering their ability to cluster and form the DISC.
Overall expression levels of DR4 and DR5 have been shown not to correlate with TRAIL sensitivity in healthy and cancer cells. Many normal untransformed cell types express DR4 and/or DR5 but are generally insensitive to TRAIL [13]. Also, some cancer cell types express normal levels of DR4 and/or DR5 but have downregulated plasma membrane levels and are resistant to TRAIL as a result [21-23]. In fact, in general the majority of death receptors resides in intracellular compartments, such as the TGN, and not on the plasma membrane [13,24,25]. Therefore, rather than the overall expression
levels, the cell surface expression of DR4 and/ or DR5 might be important determinants of sensitivity to TRAIL receptor agonists. Since the SRP regulates membrane levels of DR4 but also modulates apoptosis via DR5, SRP72 and other SRP subunits could be valuable biomarkers for sensitivity to TRAIL receptor agonists. Our results suggest that tumors with low SRP levels will be clonogenically resistant not only to TRAIL but also to DR4 and DR5-targeting agonistic antibodies. Combination strategies with therapeutics that can enhance membrane expression of DR4 or can facilitate DISC formation might restore sensitivity to TRAIL in these tumors. DNA-damaging regimens might be particularly suitable for this purpose, as they can do just this [26-28]. Interestingly, we noticed that tumor cells appear to express higher levels of SRP72 than untransformed cells. Perhaps, this contributes to their differential sensitivity to TRAIL.
This work was supported by grant NKI 2008-4110 from the Dutch Cancer Society. We thank Jasper Mullenders and Mandy Madiredjo for advice and experimental assistance, Dr. Rene Bernards and co-workers for making the retroviral RNAi library available and personnel of the NKI Robotics and Screening Center (NRSC) and flow cytometry facility of the Netherlands Cancer Institute for experimental assistance.
Cells and stimulation
Breast carcinoma MCF-7 cells stably expressing human Caspase-3, empty RNAi vector, or the SRP72-targeting shRNAs 1 or 2 were generated by retroviral transduction. MCF-7Casp-3
cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM), supplemented with 8% fetal bovine serum, 2 mM L-glutamine and antibiotics. Isoleucine-zippered TRAIL (IZ-TRAIL) [29] and Apo010 [30] were kindly provided by Dr. H. Walczak (Imperial College London, London, UK) and TopoTarget (Lausen, Switzerland), respectively. FLAG-tagged TRAIL was from Alexis (Lausen, Switzerland). Biotinylated anti-FLAG mAb (clone M2), TNFα and cycloheximide (CHX) were from Sigma-Aldrich (St Louis, MO, USA). DEVD-CHO was from Bachem (Weil am Rhein, Germany). For apoptosis assays, clonogenic assays and immunoblotting experiments, cells were stimulated
with the indicated dosages of IZ-TRAIL, FLAG-tagged TRAIL, Apo010 or TNFα+CHX for the indicated time periods and incubated at 37°C with 5% CO2.
Constructs
The Netherlands Cancer Institute (NKI) shRNA library (23.742 shRNA constructs targeting 7.914 different genes, cloned into the retroviral RNAi vector pRETRO-SUPER) was kindly provided by Dr. R. Bernards and co-workers [15]. SRP72 shRNAs were cloned into pRETRO-SUPER [31]. The complementary sense and antisense of the SRP72 short hairpin RNAs (shRNA) had the following targeting sequences: SRP72 shRNA1: 5’ GTTTCAAGGAAGCTTTGAA 3’ and SRP72 shRNA2: 5’ CAGAGGAGGCTTTGCAACT 3’. Both constructs were verified by dideoxynucleotide sequencing. DR4- and DR5-targeting synthetic siRNAs (Dharmacon, Lafayette, CO, USA) had the following targeting sequences: DR4 siRNA1: 5’ CAACAAAACTGGCCGGAAC 3’, DR4 siRNA2: 5’ GAACATAGCCCTTTGGGAG 3’, DR5 siRNA1: 5’ TCATGTATCTAGAAGGTAA 3’ and DR5 siRNA2: 5’ CAAGGTCGGTGATTGTACA 3’.
Retroviral gene transduction and siRNA transfection
To produce retrovirus, LZRS and pRETRO-SUPER constructs were transfected into the 293T human embryonic kidney cell-derived packaging cell-line Phoenix-Ampho (provided by Dr.G.P.Nolan), using FuGENE 6 transfection reagent according to manufacturer instructions (Roche Molecular Biochemicals, Mannheim, Germany). After 48h, virus-containing supernatant was harvested. Cells were incubated twice with fresh virus supernatant, for 8 hours and overnight. The next day, virus supernatant was removed and cells were cultured in fresh medium. Cells were selected 3 days after transduction with 200 µg/ml zeocin (Invitrogen, Carlsbad, CA, USA) (LZRS-IRES-Zeocin/pBR-Caspase-3 construct) or 1 µg/ml puromycin (Sigma-Aldrich) (pRETRO-SUPER constructs). Transfections of synthetic siRNAs were performed according to manufacturer’s instructions (Dharmacon).
ShRNA barcode screen
MCF-7Casp-3 cells were stably transduced with the NKI shRNA
library. Transduced cells were selected with 1 µg/ml puromycin for 5 days. Of selected cells, 24 million cells were plated at a density of 150.000 cells per 15 cm dish and were treated with 50 ng/ml Isoluecine-zippered TRAIL (IZ-TRAIL) at 37°C with 5% CO2. After 15 days, resistant colonies were collected
and genomic DNA was isolated with DNAzol (Invitrogen). PCR amplification of the shRNA inserts was performed with the Expand Long Template PCR system (Roche), using the following primers: pRS fwd 5’CCCTTGAACCTCCTCGTTCGACC 3’ and pRS rev 5’ GAGACGTGCTACTTCCATTTGTC 3’. PCR products were digested with EcoRI/XhoI and recloned into pRETRO-SUPER. The acquired set of shRNA vectors was stably transduced into MCF-7Casp-3 cells. Cells were treated with 50
ng/ml IZ-TRAIL and resistant colonies were collected. Genomic DNA was isolated and shRNAs were amplified by PCR with the following primers: pRS-T7-fwd 5’ GGCCAGTGAATTGTAATA-CGACTCACTATAGGGAGGCGGCCCTTGAACCTCCTCGTTCGA CC 3’, containing a T7 RNA polymerase promoter sequence,
Acknowledgements
and pRS8-rev 5’ TAAAGCGCATGCTCCAGACT 3’. PCR products were checked on gel and isolated with a gel extraction kit (Qiagen). Linear RNA amplification was performed using the Megascript T7 kit (Ambion). Purified RNA probes (RNeasy, Qiagen) were labeled with cyanine-3 (Cy3) or cyanine-5 (Cy5) fluorescent groups using the Universal Linkage System (ULS, Kreatech Biotechnology) and purified over a Kreapure spin column (Kreatech Biotechnology) as described previously [32]. Fluorescently labeled RNA probes from untreated and IZ-TRAIL-treated cells were combined and hybridized to oligonucleotide arrays in 40µl of hybridization mixture (25% formamide, 5x SCC, 0.01% SDS and 25% Kreablock (Kreatech Biotechnology). Samples were heated to 100 °C for 5 min and applied to the array. Microarrays were hybridized for 18 h at 42 °C , washed and scanned using Agilent microarray scanner. Quantification of the resulting fluorescent images was performed with Imagene 5.6 (BioDiscovery), local background was subtracted, and data were normalized [33] and 2log transformed.
Clonogenic survival assay
For clonogenic survival assays with the different MCF-7Casp-3
cell-lines, 50.000 were plated in 10 cm polystyrene cell culture dishes (BD Biosciences, Erembodegem, Belgium). Once attached, cells were exposed to 50 ng/ml IZ-TRAIL and cultured for 15 days at 37°C with 5% CO2. Next, surviving colonies were
fixed with 75% MeOH / 25% acetic acid and stained with 50% MeOH / 10% acetic acid / 0.2% Coomassie blue solution.
Flow cytometry
Assessment of cleaved Caspase-3 protein levels by FACS was performed as follows: After stimulation, all cells were collected, either directly from the medium or via trypsinization, and fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS). Subsequently, cells were washed twice with in PBS + 1% bovine serum albumin (BSA) and once with permeabilizing buffer (PBS with 0.1% saponin and 0.5% BSA). Next, cells were incubated for 20 min with permeabilizing buffer and stained for 1 h with rabbit anti-active Caspase-3 antibody (1:50, clone C92-605, BD Biosciences, Erembodegem, Belgium). Cells were washed 3 times with permeabilizing buffer and stained for 1 h with AlexaFluor 647-conjugated goat anti-rabbit immunoglobulin (Ig) (1:100; Molecular Probes, Leiden, the Netherlands). After 3 more washes with permeabilizing buffer, cells were analyzed by flow cytometry with a FACSCalibur (BD Biosciences, Franklin Lakes, NJ) and FCS Express software (De Novo Software, Thornhill, Canada). Cellular debris was excluded from analysis. For analysis of TRAIL receptor levels by FACS, we collected cells through 20 min incubation with PBS + 2 mM EDTA at 37 °C. Cells were washed once with PBS and were incubated on ice for 1 h with biotinylated anti-TRAIL R1 mAb DJR1 or anti-TRAIL R2 mAb DJR2-4 (1:250 and 1:500; eBioscience, San Diego, Ca, USA) in PBS + 1% BSA. Cells were washed 3 times with ice-cold PBS + 1% BSA and incubated for 1 h with streptavidin-allophycocyanin conjugate (1:200; Molecular Probes) in PBS + 1% BSA. Cells were washed again 3 times with ice-cold PBS + 1% BSA. Samples were gated on live cells and were analyzed with a FACSCalibur (BD Biosciences) and FCS Express software (De Novo Software).
DISC isolation
DISC isolation was performed as described before, with some minor changes [11]. 12 x 4 million EV- or SRP72 shRNA2-expressing MCF-7Casp-3 cells were plated in 10 cm polystyrene
cell culture dishes (BD Biosciences, Erembodegem, Belgium). Once attached, cells were exposed to 60 ng/ml FLAG-tagged TRAIL pre-complexed to 300 ng/ml biotinylated anti-FLAG antibody M2 (Sigma) for the indicated time periods at 37°C with 5% CO2. Cells were put on ice, washed twice with
ice-cold PBS and solubilized in Triton X-100 lysis buffer (30mM Tris-HCl pH 7.5, 150 mM NaCl, 1% Triton X-100, 10% glycerol and protease inhibitors). Lysates were cleared twice by centrifugation at 14.000 rpm and resulting protein complexes were precipitated by overnight incubation at 4 °C with 50 µl streptavidin-conjugated sepharose beads (Zymed, San Fransisco, CA, USA). Beads were washed 5 times with lysis buffer before elution of the protein complexes from the beads with reducing SDS sample buffer.
Immunoblotting
Of total cell lysates, samples were prepared containing 30 µg total cellular protein, as determined by BioRad protein assay (BioRad, Munchen, Germany). Proteins were separated on 4-12% NuPage Bis-Tris gradient gels (Invitrogen) in MES buffer, according to manufacturer’s instructions. Subsequent immunoblotting was performed as described [34]. Proteins were detected with the following antibodies: mouse anti-Caspase-8 mAb C15 (1:1000; Alexis Biochemicals, Lausen, Switserland), mouse anti-Caspase-9 mAb 9508 (1:1000; Cell Signaling Technology, Danvers, MA, USA), mouse anti-FADD mAb 610399 (1:250; BD biosciences) rabbit anti-Bid pAb (1:250; rabbit serum, home made, but available from BD Biosciences), rabbit anti-PARP pAb 9542 (1:2000; Cell Signaling Technology) and mouse anti-Actin mAb C4 (1:10,000, Chemicon International Temecula, CA, USA). Second-step antibodies were horseradish peroxidase (HRP)-conjugated swine anti-rabbit Ig (1:7500) and rabbit anti-mouse Ig (1:7500, both from Dako A/S, Glostrup, Denmark). The enhanced chemiluminescence (ECL) kit was from Pierce Biotechnology (Rockford, IL, USA)
[1] Ashkenazi, A., Pai, R.C., Fong, S., et al. (1999) Safety and antitumor activity of recombinant soluble Apo2 ligand. J Clin Invest 104, 155-162.
[2] Walczak, H., Miller, R.E., Ariail, K., et al. (1999) Tumoricidal activity of tumor necrosis factor-related apoptosis-inducing ligand in vivo. Nat Med 5, 157-163. [3] Creaven, P.J., Plager, J.E., Dupere, S., et al. (1987) Phase
I clinical trial of recombinant human tumor necrosis factor. Cancer Chemother Pharmacol 20, 137-144. [4] Hersh, E.M., Metch, B.S., Muggia, F.M., et al. (1991)
Phase II studies of recombinant human tumor necrosis factor alpha in patients with malignant disease: a summary of the Southwest Oncology Group experience. J Immunother (1991. ) 10, 426-431.
[5] Kondo, T., Suda, T., Fukuyama, H., Adachi, M. and Nagata, S. (1997) Essential roles of the Fas ligand in the
development of hepatitis. Nat Med 3, 409-413. [6] Ogasawara, J., Watanabe-Fukunaga, R., Adachi, M., et
al. (1993) Lethal effect of the anti-Fas antibody in mice. Nature 364, 806-809.
[7] Ashkenazi, A., Herbst, R.S. (2008) To kill a tumor cell: the potential of proapoptotic receptor agonists. J Clin Invest 118, 1979-1990.
[8] Ashkenazi, A. (2002) Targeting death and decoy receptors of the tumour-necrosis factor superfamily. Nat Rev Cancer 2, 420-430.
[9] Hughes, M.A., Harper, N., Butterworth, M., et al. (2009) Reconstitution of the death-inducing signaling complex reveals a substrate switch that determines CD95-mediated death or survival. Mol Cell 35, 265-279. [10] Medema, J.P., Scaffidi, C., Kischkel, F.C., et al. (1997)
FLICE is activated by association with the CD95 death-inducing signaling complex (DISC). EMBO J 16, 2794-2804.
[11] Sprick, M.R., Rieser, E., Stahl, H., et al. (2002) Caspase-10 is recruited to and activated at the native TRAIL and CD95 death-inducing signalling complexes in a FADD-dependent manner but can not functionally substitute caspase-8. EMBO J 21, 4520-4530.
[12] Merino, D., Lalaoui, N., Morizot, A., et al. (2006) Differential inhibition of TRAIL-mediated DR5-DISC formation by decoy receptors 1 and 2. Mol Cell Biol 26, 7046-7055.
[13] Spierings, D.C., de Vries, E.G., Vellenga, E., et al. (2004) Tissue distribution of the death ligand TRAIL and its receptors. J Histochem Cytochem 52, 821-831. [14] Wagner, K.W., Punnoose, E.A., Januario, T., et al. (2007)
Death-receptor O-glycosylation controls tumor-cell sensitivity to the proapoptotic ligand Apo2L/TRAIL. Nat Med 13, 1070-1077.
[15] Berns, K., Hijmans, E.M., Mullenders, J., et al. (2004) A large-scale RNAi screen in human cells identifies new components of the p53 pathway. Nature 428, 431-437. [16] Holler, N., Tardivel, A., Kovacsovics-Bankowski, M., et al.
(2003) Two adjacent trimeric Fas ligands are required for Fas signaling and formation of a death-inducing signaling complex. Mol Cell Biol 23, 1428-1440. [17] Slee, E.A., Harte, M.T., Kluck, R.M., et al. (1999)
Ordering the cytochrome c-initiated caspase cascade: hierarchical activation of caspases-2, -3, -6, -7, -8, and -10 in a caspase-9-dependent manner. J Cell Biol 144, 281-292.
[18] Damke, H., Baba, T., Warnock, D.E. and Schmid, S.L. (1994) Induction of mutant dynamin specifically blocks endocytic coated vesicle formation. J Cell Biol 127, 915-934.
[19] van der Bliek, A.M., Redelmeier, T.E., Damke, H., et al. (1993) Mutations in human dynamin block an intermediate stage in coated vesicle formation. J Cell Biol 122, 553-563.
[20] Ren, Y.G., Wagner, K.W., Knee, D.A., et al. (2004) Differential regulation of the TRAIL death receptors DR4 and DR5 by the signal recognition particle. Mol Biol Cell 15, 5064-5074.
[21] Cheng, J., Hylander, B.L., Baer, M.R., Chen, X. and Repasky, E.A. (2006) Multiple mechanisms underlie resistance of leukemia cells to Apo2 Ligand/TRAIL. Mol Cancer Ther 5, 1844-1853.
[22] Jin, Z., McDonald, E.R., III, Dicker, D.T. and El Deiry, W.S. (2004) Deficient tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) death receptor transport to the cell surface in human colon cancer cells selected for resistance to TRAIL-induced apoptosis. J Biol Chem 279, 35829-35839.
[23] Zhang, Y., Zhang, B. (2008) TRAIL resistance of breast cancer cells is associated with constitutive endocytosis of death receptors 4 and 5. Mol Cancer Res 6, 1861-1871.
[24] Spierings, D.C., de Vries, E.G., Timens, W., et al. (2003) Expression of TRAIL and TRAIL death receptors in stage III non-small cell lung cancer tumors. Clin Cancer Res 9, 3397-3405.
[25] Zhang, X.D., Franco, A.V., Nguyen, T., Gray, C.P. and Hersey, P. (2000) Differential localization and regulation of death and decoy receptors for TNFα-related apoptosis-inducing ligand (TRAIL) in human melanoma cells. J Immunol 164, 3961-3970.
[26] Guan, B., Yue, P., Clayman, G.L. and Sun, S.Y. (2001) Evidence that the death receptor DR4 is a DNA damage-inducible, p53-regulated gene. J Cell Physiol 188, 98-105.
[27] Verbrugge, I., de Vries, E., Tait, S.W., et al. (2008) Ionizing radiation modulates the TRAIL death-inducing signaling complex, allowing bypass of the mitochondrial apoptosis pathway. Oncogene 27, 574-584.
[28] Wu, G.S., Burns, T.F., McDonald, E.R., III, et al. (1997) KILLER/DR5 is a DNA damage-inducible p53-regulated death receptor gene. Nat Genet 17, 141-143.
[29] Ganten, T.M., Koschny, R., Sykora, J., et al. (2006) Preclinical differentiation between apparently safe and potentially hepatotoxic applications of TRAIL either alone or in combination with chemotherapeutic drugs. Clin Cancer Res 12, 2640-2646.
[30] Verbrugge, I., Wissink, E.H., Rooswinkel, R.W., et al. (2009) Combining radiotherapy with APO010 in cancer treatment. Clin Cancer Res 15, 2031-2038.
[31] Brummelkamp, T.R., Bernards, R. and Agami, R. (2002) A system for stable expression of short interfering RNAs in mammalian cells. Science 296, 550-553.
[32] Heetebrij, R.J., Talman, E.G., Velzen, M.A., et al. (2003) Platinum(II)-based coordination compounds as nucleic acid labeling reagents: synthesis, reactivity, and applications in hybridization assays. Chembiochem 4, 573-583.
[33] Quackenbush, J. (2002) Microarray data normalization and transformation. Nat Genet 32 Suppl, 496-501. [34] Tait, S.W., de Vries, E., Maas, C., et al. (2007) Apoptosis
induction by Bid requires unconventional ubiquitination and degradation of its N-terminal fragment. J Cell Biol 179, 1453-1466.
Supplementary Figure 1. Different cancer cell types seem to express higher levels of SRP72 than the healthy cells they originated
from. Data obtained from www.genesapiens.com.
