University of Groningen Bacillus subtilis: sporulation, competence and the ability to take up fluorescently labelled DNA Boonstra, Mirjam

(1)

Bacillus subtilis: sporulation, competence and the ability to take up fluorescently labelled DNA

Boonstra, Mirjam

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below.

Document Version

Publisher's PDF, also known as Version of record

Publication date: 2017

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA):

Boonstra, M. (2017). Bacillus subtilis: sporulation, competence and the ability to take up fluorescently labelled DNA. Rijksuniversiteit Groningen.

Copyright

Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

Take-down policy

If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum.

(2)

Chapter 4 Following the fate of incoming

DNA during natural

transformation of Bacillus

subtilis with fluorescently

labelled DNA

Mirjam Boonstra, Nina Vesel, Oscar P. Kuipers.

(3)

(4)

121 Abstract

During competence Bacillus subtilis is able to take up DNA from its environment through the process of transformation. We investigated the ability of B. subtilis to take up fluorescently labelled DNA and found that it is able to take up either Fluorescein-dUTP, DyLight550 or DyLight650-dUTP labelled DNA. Transformation with labelled DNA containing an antibiotic cassette resulted in uptake of the labelled DNA and also generated antibiotic-resistant colonies. The labelled DNA co-localises with the chromosome and with ComFC and RecA. Fluorescent labelling of DNA creates the opportunity to directly study interactions of exogenous DNA with components of the competence machinery and recombination proteins. The competence machinery is conserved among naturally competent bacteria, which makes this method of labelling suitable for studying transformation of other naturally competent bacteria.

Introduction

An interesting aspect of the lifestyle of Bacillus subtilis is its ability to take up naked DNA from the environment. When nutrients are limited a sub-population of B. subtilis cells can become competent and transport the exogenous DNA to its interior. This transport occurs through a large complex consisting of multiple proteins. The transport complex is highly conserved among naturally competent bacteria and in B. subtilis it localises primarily at the pole (Hahn et al., 2005). The first step in the transport process is the binding of the extracellular DNA. Proteins necessary for the binding of DNA are the major pseudopilin ComGC, the minor pseudopilins ComCD, ComGE and ComGG, the ATPase ComGA and the membrane protein ComGB (Chung and Dubnau, 1998). The dsDNA binding protein ComEA is also required for transformation (Inamine and Dubnau, 1995; Provvedi and Dubnau, 1999). The DNA is bound in its double stranded form and in case of large molecules cleaved into fragments of 13.5-18kb by NucA (Dubnau, 1999; Dubnau and Cirigliano, 1972). One of the strands of the dsDNA is degraded by an unknown protein. In B. subtilis no preference was found for the 3'-5'or 5'-3' strand (Vagner et al., 1990).

(5)

122

Single stranded (ssDNA) is transported through the water-filled ComEC channel and transport is assisted by the helicase/ATPase ComFA (Draskovic and Dubnau, 2005; Londoño-Vallejo and Dubnau, 1993; Takeno et al., 2011). When ssDNA enters the cytoplasm it is bound and protected from degradation by SsbB and SsbA. (Baitin et al., 2008; Grove et al., 2005; Yadav et al., 2012). DprA and SsbA facilitate RecA•ATP mediated strand exchange (Yadav et al., 2012, 2014). While DNA is present on the surface of the cell it is still accessible to DNaseI, but approximately 1-1.5 minutes after addition of DNA at 37 °C the exogenous DNA becomes resistant to DNaseI and single-strand donor DNA can be retrieved from lysed cells confirming uptake of DNA (Piechowska and Fox, 1971; Davidoff-Abelson and Dubnau, 1973; Dubnau, 1999). If the foreign DNA has homology to the genome of the recipient bacterium it can be integrated into the chromosome by homologous recombination. If no homology is present, but the exogenous DNA is capable of autonomous replication it can be reconstituted as a plasmid (Kidane et al., 2012; Viret et al., 1991). The proteins involved in DNA uptake have been extensively studied; for reviews see (Chen and Dubnau, 2004; Chen et al., 2005; Kidane et al., 2012). Co-localisation of proteins is often visualised using fusions of the protein of interest to a fluorescent protein and this has been done successfully with components of the competence machinery (Hahn et al., 2005; Kaufenstein et al., 2011; Kramer et al., 2007). Visualising DNA has also been done successfully although no transfer of DNA into the cytoplasm of Helicobacter pylori or B. subtilis was detected (Stingl et al., 2010). Although transport of fluorescently labelled DNA into the cytoplasm of B. subtilis was not successful previously, we decided to try different labelling methods and dyes. We incorporated covalently bound dyes into DNA in order to be able to follow up-take and interactions of DNA with components of the competence and replication machinery. We tested several labelled nucleotides to be incorporated via PCR , i.e. DyLight650-dUTP, DyLight550-DyLight650-dUTP, Fluorescein-DyLight650-dUTP, Cy3-DyLight650-dUTP, Cy5-dUTP and Alexa Fluor 5 labelled dNTPs which were incorporated via the Klenow method. To demonstrate the usefulness of labelled DNA in studying interactions with proteins involved in transformation we also determined co-localisation with ComFC, RecA and the chromosome.

(6)

123 Results

DNA uptake

Because under nutrient-limited conditions in the lab only 5-25% of the B. subtilis 168 population becomes competent we used a Pxyl-comK

over-expression strain. By growing the cells in competence medium with fructose as a carbon source we relieved repression of the xylose promoter and reduced the amount of xylose required for induction of ectopic comK. Under these conditions approximately 80% of the population became competent. Labelling of DNA was done either directly through PCR as for Fluorescein-dUTP, Cy3-dUTP and Cy5-dUTP labelled DNA or indirectly by PCR with aminoallyl dUTP and subsequent labelling with amino reactive DyLight650 or DyLight550. Incorporation of Alexa Fluor 5 from the Bioprime total genomic DNA labelling module was done by use of the Klenow reaction. All the dyes were covalently bound to the nucleotides and both strands of the DNA were labelled. The template used was pDG1664 with a concentration of 100ng, and an erythromycin marker plus the flanking thrC regions were amplified. A negative control was taken in which all components were the same, except that no enzyme was added. Amplified PCR or Klenow products were incubated for 2hrs with DpnI to remove all template DNA. Transformation of the negative control did not yield resistant colonies confirming that treatment with DpnI removes all template DNA. A positive control using an amplified product with normal dNTPs was also taken to confirm competence of the cells. Label incorporation of Fluorescein-dUTP, Cy3-dUTP and Cy5-dUTP (measured with a Nanodrop ) generally lies between 1.4-4.6% for Fluorescein-dUTP, 1.4-3% for DyLight650-dUTP, and between and on average 7% for Alexa Fluor 5. Transformation with Fluorescein, DyLight550 and DyLight650 labelled DNA resulted in resistant colonies. Transformation with Alexa Fluor 5 labelled DNA did not result in resistant colonies. Transformation with Cy3 or Cy5 labelled DNA is also possible, but is much lower in particular for Cy5.

(7)

124

Because transformation with Fluorescein labelled DNA and DyLight labelled DNA resulted in the highest number of colonies we compared the transformation efficiency with unlabelled DNA. The transformation efficiency of the labelled dyes is about 3X lower than that of unlabelled DNA (S. table1). As mentioned previously when B. subtilis successfully takes up DNA it becomes resistant to DNaseI treatment. We therefore treated all samples with 10U of DNaseI for ten minutes at 37 °C after which the cells were washed and prepared for microscopy. DyLight650-DNA, Fluorescein-DNA bind to competent B. subtilis (Img. s1, S. Img 1.). Alexa Fluor 5 labelled DNA also binds in a DNaseI resistant manner, but as mentioned previously transformation does not result in resistant colonies. To confirm that DNA binds preferentially to competent cells we incubated B. subtilis amyE::Pxyl-comK-PcomG-gfp with DyLight650 labelled DNA. The

PcomG-gfp construct in this strain is an indicator for competence, with

competent cells expressing gfp (Smits et al., 2005). Image 3a shows that labelled DNA binds only to the competent cells and that no binding is present to non-competent cells. Image3b shows that B. subtilis amyE::Pxyl

-comK grown in LB does not bind labelled DNA which is expected as competence is very low when B.subtilis is grown in LB. These results show that labelled DNA only binds to competent cells and confirms that the bound DNA is resistant to DNaseI. We also performed the same experiment with Streptococcus pneumoniae D39 to see if competent S. pneumoniae is also capable of binding labelled DNA and indeed competent S. pneumoniae binds labelled DNA in a DNaseI resistant manner (Img. 2).

(8)

125

To further determine if the labelled DNA is truly internalised we took advantage of the pH sensitivity of Fluorescein. Fluorescein has a very low fluorescence at a pH below 5. When cells transformed with labelled DNA and fixed with 2% formaldehyde are put in PBS buffer at pH 7.4 some foci can be seen localising on the border of the cells.

Img. 1. Comparison of

competent and non-competent

B. subtiltis transformed with

labelled DNA. (A). B. subtilis amyE::Pxyl-comK-PcomG-gfp transformed with dylight650 labelled DNA. The labelled DNA (red foci) only binds to the competent (blue) cells. (B). B.

subtilis grown in LB and incubated with labelled DNA. No labelled DNA can be seen binding to the non-competent cells grown in LB.

Img. 2. Competent Streptococcus pneumoniae D39 incubated with

DyLight650 labelled DNA. Labelled DNA binds to competent S. pneumoniae in a DNaseI resistant manner.

(9)

126

When the cells are exposed to a 10mM sodium acetate buffer at pH4 resulting in a low pH outside the fixed cells foci are only seen inside the cells with no foci localising on the outer edge of the cells (S. Img. 2). These results combined with the fact that transformation with fluorescently labelled DNA yields resistant colonies show that labelled DNA is successfully taken up by the cells. In previous studies 1-4 foci per cell of competence proteins were found (Kaufenstein et al., 2011). After 1hr of incubation we also find 1-4 foci per cell for the labelled DNA with the majority 77.6% having 1 focus, 18.4% 2 foci, 3.7% 3 foci and 0.3% having 4 foci, while rarely a cell is found with more foci (Img. 3, S1.table2). The localisation of the DNA differs with that of the foci of components of the competence machinery. In studies into the localisation of the components of the competence machinery the majority of the foci are localised at the pole with only 4-15% (average 7.7%) depending on the protein localised near the centre of the cell (Kaufenstein et al., 2011). In cells fixed with 2% formaldehyde the labelled DNA is more often (28-23%) localised near the centre of the cell and co-localises with the chromosome in 21-22% of the cases. (S. table 3,4). Single foci localise an average of 47% in the centre of the cell and 39% at the pole.

Img. 3. Number of DyLight650 labelled DNA foci.

Generally 1-4 foci per cell are found for the labelled DNA with the majority of cells having 77.6% having 1 focus, 18.4% 2 foci, 3.7% 3 foci and 0.3% having 4 foci of a total of 599 cells rarely a cell is found with more foci.

(10)

127

Image 4 shows examples of the different types of localisation of Fluorescein-dUTP, DyLight650-DNA show the same localisation patterns as Fluorescein labelled DNA (S table 4). A higher percentage of localisation near the centre of the cell and co-localisation with the chromosome of labelled DNA is in accordance with the expectation that the labelled DNA is internalised. An interesting question is if the competence machinery can take up multiple DNA molecules at once. Although labelling with one type of dye creates DNA foci it is not possible to determine with regular fluorescent microscopy how many DNA molecules there are in one focus. Therefore to answer this question we mixed DyLight650-DNA and Fluorescein-DNA in equal amounts and incubated the competent cells with the mixture of labelled DNA. After 1hr their co-localization is only present in 8% of the cells containing foci (Img. 5). In 15 % of the cells the foci are located close to each other, but don't overlap completely. 46% of the cells have a single Fluorescein focus and 32% have a single DyLight650 focus.

Img. 4. Localisation of foci (A). pole 34%. (B). Centre 23% C: Centre co-localising with chromosome 22%. (D). Pole

(partially) co-localising with the chromosome 7%. (E). Two foci at the pole 2%. (F). Two foci at the centre 3%. (G).One focus at the pole one at the centre 3%. (H). Foci at the division site 5%. The chromosome was stained with DAPI.

(11)

128

These results combined with the observation that 77% of the cells only have one DNA focus when incubated with one type of coloured DNA indicates that generally only one molecule is taken up at a time. The fact that co-localisation of the 2 colours of DNA only occurs in 8% of the cases indicates that parallel transport is rare. B. subtilis does seem to be able to take up multiple DNA molecules at once, but this is less common (Img. 3).

Co-localisation

To determine whether labelled DNA co-localises with specific components of the competence machinery we investigated co-localisation with ComFC-GFP and RecA-YFP. After 10min of incubation with DNA and subsequent fixing with 2% formaldehyde, washing and treatment with DNaseI, 33% of the cells contain DNA foci, 26% ComFC-GFP foci and in 6% of the total number of cells co-localisation of foci can be seen. In the cells containing both ComFC-GFP and DyLight 650-DNA foci, co-localisation occurs in 23% of the cells (Img6 A-C), S table5). As the labelled DNA successfully co-localises with the competence machinery we were interested if we could also see it co-localise with the recombination protein RecA, i.e. whether DyLight650-DNA also co-localises with RecA-YFP.

Img. 5. Co-localisation of DyLight650 DNA with Fluorescein labelled DNA. (A). Dylight650-DNA localising next to

Fluorescein-DNA 14% (B). Overlapping DyLigt650 and Fluorescein-DNA foci 8% C. Single Fluorescein-DNA focus 46%. (D). Single DyLight650-DNA focus 32%.

This image was changed from the draft of the thesis to improve quality in the print editon.

(12)

129

For this experiment the BD4477 strain was used which contains a RecA-YFP fusion (Kramer et al., 2007). After 15 minutes of incubation with DyLight650-DNA 7% of the cells show clear RecA-YFP foci and 51% show Dylight650 foci. After 1hour 44% of the cells have Dylight650 foci and 14% have RecA-YFP foci. Of the cells showing both RecA-YFP and DyLight650 foci co-localisation occurs in 26% of the cells at 15 minutes and 15% after 1 hour of incubation (S. Img. 3, tables 6&7). RecA is the main protein responsible for homologous recombination during transformation and Kidane and Graumann saw filamentous forms of RecA being formed on addition of exogenous DNA, this form is likely the form RecA takes when actively searching for homologous regions (Kidane and Graumann, 2005). We also see the filamentous form of RecA and this form can be seen to co-localise with the labelled DNA (Img. 6 G-I). Labelled DNA thus successfully co-localises with competence and recombination proteins, and can be seen to co-localise with the DAPI stained chromosome.

We were therefore curious if we could also see the labelled DNA co-localise at a specific locus on the chromosome. Because we used labelled DNA capable of integrating into the thrC locus on the chromosome it should be possible to see the labelled DNA co-localising with this locus. A ParB-GFP or ParB-mKate protein fusion construct with the original parS site in the parB gene was therefore cloned into the thrC locus of B. subtilis. After 10 min of incubation with DNA and subsequent fixing with 2% formaldehyde and treatment with DNaseI, Fluorescein-DNA co-localises with ParB-mKate at 4%. When incubating for 1hr 9% co-localisation can be seen (Img6 D-F), S.Tables 10 & 11,). Similar co-localisation percentages can be seen for labelled DyLight650-DNA and ParB-GFP, which shows 3%. co-localisation at 10min and 7% co-co-localisation after 1hr incubation (S. Img. 4 tables 8 & 9). The co-localisation of labelled DNA with the thrC locus is much lower than the co-localisation with ComFC and RecA, although there is an increase after 1hr incubation. It is possible that the ParB protein is displaced from the chromosome when homologous recombination takes place, and this could explain the lower level of co-localisation compared to localisation with ComFC and RecA.

(13)

130 Discussion

By covalent fluorescent labelling of DNA we developed a method that can be used to study the interaction of incoming DNA with components of the competence and replication machinery during transformation.

Img. 6 A-C. Co-localisation of DyLight650 labelled DNA with ComFC-GFP 10min after addition of DNA. (A). Overlay of ComFC-ComFC-GFP and

Dylight650DNA. (B). ComFC-GFP. (C). Dylight650-DNA. Of cells containing both DNA and ComFC foci co-localisation occurs in 23% of the cells.

D-F. Co-localisation of ParB-mKate with Fluorescein labelled DNA.(D). Overlay of mKate and FLuorescein-DNA. (E).

ParB-mKate. (F). Fluorescein-DNA.

G-I. Co-localisation of the filamentous form of RecA-YFP with DyLight650 labelled DNA. (G). Overlay of RecA-YFP and

DyLight650-DNA. (H). RecA-YFP. (I). Dylight650-DyLight650-DNA.

(14)

131

We show that Fluorescein-DNA and DyLight650 labelled DNA are successfully taken up by competent B. subtilis. Labelled DNA does not bind to non-competent B. subtilis in a DNaseI resistant manner, confirming specificity of binding to competent cells. The DNaseI resistance, the presence of fluorescein-DNA foci inside the cells at pH4 and the formation of antibiotic resistant colonies after transformation with DyLight650 and Fluorescein-DNA show that B. subtilis can successfully be transformed with the modified DNA albeit at a slightly lower efficiency than non-labelled DNA. It is unknown if the lower transformation efficiency is the result of reduced uptake, lower integration rates or if the labelled DNA results in mutations in the resistance cassette/promoter. The observation that AlexaFluor5-DNA which has the highest label incorporation does bind to B subtilis in a DNaseI resistant manner, but does not result in resistant colonies, indicates that it is either the recombination process and/or an increased mutation rate that causes deficient transformation. If the presence of foreign nucleotides in the transformed DNA leads to mutations in the integrated DNA the level of dye incorporation should also be taken into account as higher label incorporation could result in more mutations and lower transformation efficiency. Stingl et al. fluorescently labelled DNA using Cy3, but this labelling method did not result in uptake of labelled DNA by B. subtilis (Stingl et al., 2010).

We also attempted transformation with Cy3 and Cy5 labelled DNA, using a different labelling method, but even with the hypercompetent strain only very few resistant colonies were formed. Our success with Fluorescein, Dylight650 and Dylight550 labelled DNA is likely not only the result of differences in structure, but also in the charge of these molecules. DyLight650 and DyLight550 are negatively charged and have a higher solubility in water compared to Cy5 and Cy3. During transformation negatively charged DNA is transported through the water filled ComEC channel. Therefore, the charge and solubility of the dye along with its size likely are important factors in the ability of the competence machinery to take up modified DNA. After determination of successful transformation we also looked at co-localisation of labelled DNA with ComFC, RecA and the chromosome.

(15)

132

Localisation of the labelled DNA differs from that of the components of the competence machinery with a much higher number of cells with foci localised inside the cells being found for DNA compared to the competence proteins further indicating successful internalisation. The labelled DNA co-localises at an average of 22% with the chromosome. Although labelled DNA is more often localised in the centre of the cell, the labelled DNA can be seen to co-localise with ComFC with 23% co-localisation after 10min. Labelled DNA also co-localises with RecA during transformation with 26% co-localisation after 15 minutes and 15% co-localisation after 1hr. We also observed formation of the active filamentous form of RecA (Kidane and Graumann, 2005) in the presence of labelled DNA. The Co-localisation with specific sites on the chromosome however is lower than co-localisation with the chromosome and ComFC and RecA. After 10 min of incubation only 3-4% of co-localisation with the thrC is found. When cultures are incubated with the labelled DNA for 1hr the percentage of co-localisation is slightly higher, i.e. 7-9%. The low level of co-co-localisation with the specific locus compared to the entire chromosome, could be the result of displacement of the ParB-GFP or ParB-mKate foci by the recombination machinery. Use of a time-lapse microscopy in combination with short imaging times might be a way in which co-localisation and potential ParB displacement could be visualised. When competent B. subtilis is transformed with both DyLight650-DNA and Fluorescein-DNA, full co-localisation of the two is only seen in 8% of the cells and in15 % of the cells the foci are located close to each other. The majority of the cells have either only a DyLight650 focus 32% or a Fluorescein focus 46% indicating that generally DNA is transpored in serial manner rather than in parallel. Further investigation using super-resolution microscopy can more difinitively determine how many DNA molecules are in one focus.

Labelling of DNA through incorporation of fluorescent-nucleotides can be a powerful method to investigate all phases in the process of transformation. The labelled DNA binds to competent cells in a DNaseI-resistant manner not only for B. subtilis, but also for competent S. pneumoniae.

(16)

133

The ability of both B. subtilis and S. pneumoniae to bind labelled DNA in a DNAseI resistant manner combined with the high level of conservation of the competence machinery and recombination proteins among naturally competent species makes it likely that these labelling methods can also be used for studies in other bacteria. Transformation with labelled DNA can be used to gain further insights into the interactions of DNA with the transport and recombination proteins. It can also potentially be used to follow the entire transformation process from uptake to recombination to expression of the integrated DNA. Not only can labelled DNA be used to study the transport and integration of homologous DNA, but it can also be used to study uptake and reconstitution of plasmid DNA. Many fluorescent dyes can also be used for super-resolution microscopy (Dempsey et al., 2011) which further opens up possibilities, such as a more accurate determination of the number of DNA molecules transported during competence. In short we conclude that labelled DNA is primarily taken up at the pole as it can be seen to co-localise with ComFC at the pole. Our results indicate that generally one molecule of DNA is taken u at a time, and that uptake may occur in a serial rather than parallel manner. The DNA is rapidly taken up and can be seen to also localise with the (actively searching) form of RecA. Labelled DNA also co-localises with the chromosome, with co-localisation with a specific locus increasing over time.

Experimental procedures

PCR reaction for labelling with Fluorescein

1μl of 1mM fluorescein-12-dUTP (Thermo Fisher Scientific) and 2μl dNTP mix (1mM dATP, dCTP, dGTP, 0.5mM dTTP (Thermo Fisher Scientific), 0.5 μl DreamTaq DNA polymerase (Thermo Fisher Scientific) 5μl DreamTaq buffer, 1μM prMB013 and 1μM prMB014, 100ng PDG1664 (Guérout-Fleury et al., 1996) total volume 50μl. 35 cycles of a standard Dreamtaq PCR protocol was used. A longer extension time of 3min was used for a 2300bp product. After PCR samples were incubated for 2hrs with 0.5μl DpnI (FastDigest Thermo Fisher Scientific).

(17)

134

PCR samples were purified using a Machery-Nagel PCR kit. Samples were stored at -20 ⁰C Samples were protected from light at all times. The label incorporation of Fluorescein-dUTP lies between 1-3 pmol measured by nanodrop.

Labelling with Dylight650

1μl dNTP mix (10mM dGTP, dCTP, dATP, 5mM dTTP, 5mM aminoallyl-dUTP (Thermo Fisher Scientific) 0.25 μl Dreamtaq (Thermo Fisher Scientific 5μl Dreamtaq buffer, 1μM prMB013 and 1μM prMB014, 100ng template. Total volume 50μl, to obtain a high enough amount of product, 8 times 50μl reactions are needed. The PCR program was the same as for Fluorescein. Samples were incubated for 2hrs with 0.5μl DpnI Samples were purified with a Machery-Nagel PCR kit PCR kit The second wash step was done with 80% ethanol and the samples were eluted with 60μl 0.1M NaHCO3 pH9. Samples were incubated for 3hrs with DyLight650 or

DyLight550 (Thermo Fisher Scientific). Samples were purified with a Machery-Nagel PCR kit. Labelling resulted in an incorporation of 1-3 pmol as measured by Nanodrop.

Labelling with Alexa Fluor 5

Bioprime total genomic DNA labelling module (Thermo Fisher Scientific) was used. Labelling with Alexa Fluor5 dNTP was done according to the manufacturers protocol, but replacing the manufactures primer solution with specific primers prMB013 and prMB014. pDG1664 was used as template. Labelling resulted in an incorporation of between 5 and 9pmol as measured by Nanodrop.

Labelling with Cy5/Cy3

Labelling with Cy3/Cy5-dUTP (Jena Bioscience) was done according to the manufacturers protocol using pDG1664 as template and prMB013 and prMB014 as primers. Labelling resulted in an incorporation of 1-2 pmol as measured by Nanodrop.

(18)

135 Growth conditions

For the competence experiments A medium adapted from (Spizizen 1958) and (Konkol et al., 2013) 18ml demi water, 2ml 10X competence medium stock (0.615M K2HPO4 . 3H2O, 0.385M KH2PO4, 20% fructose, 10ml

300mM Tri-Na-citrate, 1ml 2% ferric NH4 citrate, 1g casein hydrolysate

(Oxoid), 2g potassium glutamate) 100μl 2mg/ml tryptophan, 67μl 1M MgSO4.With the exception of BD4477 (Kramer et al., 2007) which was

grown using glucose as a carbon source. For the co-localisation experiments of ComFC-GFP, RecA-YFP, ParB-GFP and ParB-mKate the total volume was scaled up to a final volume of 20ml. For these experiment the following conditions were used. A single colony was diluted 103_-105_fold

in PBS or 1X Spizizen solution to ensure that the cultures are in the exponential growth phase/early stationary after overnight growth. 100μl of the diluted sc colony solution was added to 20ml medium 5μg/ml chloramphenicol in 100 ml Erlenmeyer flasks and grown at 37 Celsius 220rpm. The overnight cultures were diluted to an OD600 of 0.05 in 20ml medium without antibiotics. The Pxyl-comK strains were induced with 0.5%

xylose after 4hrs of growth. The Pspank-parB strains were also induced with

1mM of IPTG after 4hrs of growth. Sample preparation

Cultures were incubated with DNA. At the desired time point for harvesting the samples were incubated with 10U DNaseI in 400μl culture (Sigma-Aldrich) for 10 minutes at 37°C. The samples were spun down (5000g) and washed with 1X PBS. For fixing cells (20 minutes at room temperature) a 2% formaldehyde solution made from paraformaldehyde dissolved in 1X PBS (pH7.4) was used. To protect the dyes samples were protected from light exposure.

Slide preparation

Cells were immobilised using 1.5% agarose in 1X PBS, 10mM sodiumacetate buffer pH4 or by polyacrylamide. Polyacrylamide slides were made with 500μl 40% acrylamide, 1.5ml 1X PBS, 20μl 10% ammonium persulfate and 2μl TEMED.

(19)

136

A gene frame (Thermo Fisher Scientific or Westburg) was stuck on a glass object carrier and the polyacrylamide was added and covered with another object carrier. The slide was left to solidify after which the top slide was removed and the solidified gel was washed 3x with 30 minutes with PBS. The gel was kept in PBS until needed and cut in smaller pieces when necessary. Microscopy was performed on a GE-healthcare OlympusIX71DV or DVelite microscope. Images were deconvolved with the Softworks imaging software. Analysis, colour assignment and overlay images were created using ImageJ and saved as RGB Tiff. Images were put to a 300 pixels/inch CMYK format with Adobe photoshop.

Strain construction

The 168 amyE::pxyl-comK-cm_comFC-gfp-tet strain was obtained by USER cloning. It consists of a fusion of gfp-DSM with a flexible linker from JWV500 (Kjos et al., 2015) using primers prMB94 & prMB62 to comFC prMB97 & prMB89 followed by the pBEST309 tetracyclin region (Itaya, 1992) primers prMB93 & prMB100 and the upstream flanking region of comFC prMB88 & prMB62. The different components of the construct were obtained by PCR with pfux7 (Nørholm, 2010), treated with USER enzyme (NEB), ligated overnight at 4°C and transformed directly into 168 amyE::pxyl-comK-cm for integration into the native locus. The strain was checked for proper integration by PCR and sequenced. B. subtilis 168_amyE::Pxyl-comK _thrC::Pspank-parB-gfp and B. subtilis 168

amyE::Pxyl-comK_thrC::Pspank- parB-mkate2 were created by

amplification of parB-mkate2 from pMK17 and parB-gfp from pMK11 (Kjos et al., 2015; Raaphorst et al., 2016) with primers 133 and 134. parB-gfp and parB-mkate were cloned into pMB002 using NheI and HindIII (FastDigest Thermo Scientific) ligated with T4 ligase (Thermo Scientific) and transformed into E.coli DH5-α and sequenced. B. subtilis 168 amyE:: Pxyl-comK was transformed with mkate or

pMB002-parB-gfp. B. subtilis 168 amyE:: Pxyl-comK _Pcomg-gfp was created by

transformation with chromosomal DNA from B. subtilis 168 PcomG-gfp

(20)

137

strains genomic context reference

B. subtilis 168 Pxyl-comK amyE::PxylR-PxylA-comK, trpC2

cmr

(Hahn et al., 1996)

B. subtilis 168 Pxyl-comK-PcomG

-gfp

amyE:: PxylR-PxylA-comK -PcomG

-gfp, trpC2 cmr kmr

This study, made by Claudio Tiecher

B. subtilis 168 Pxyl

-comK_comFC-gfp

amyE::PxylR-PxylA

-comK_comFC-gfp, trpC2 cmr tetr

This study

B. subtilis 168 Pxyl-comK_Pspank

-parB-gfp

amyE:: PxylR-PxylA-comK_

thrC::Pspank parB-gfp, trpC2

cmreryr

This study

B. subtilis 168 Pxyl

-comK_parB-mkate2

amyE:: PxylR-PxylA-comK_

thrC::Pspank parB-mkate2, trpC2

cmreryr

This study

B. subtilis 168 BD4477 recA-yfp_amyE::Pspank-cfp-yjbF,

his leu met cmr, spr

(Kramer et al., 2007) B.subtilis 168 PcomG-gfp PcomG-gfp km

r (Smits et al., 2005) Primers ID name sequence prMB013 PDG1664-ery_F GGGAACGGTTGGAGCTAATG prMB014 PDG1664-ery-R TTCCGGGAACAGTGACAGAG prMB62 U-yvyF-R GATTTTAGAAUTGATTCTGTTTTTATGCCGATATAATC prMB88 U-comFC-R TTAAGCTCGAUTATGGTGTGGAAACTGGAAG prMB89 comFC-flank-F TGCATGCCTGUCATAGTATCCGGCACTGTTG prMB93 tetL-R TTCTAAAATCUTTCCTGTTATAAAAAAAGGATCAATTTTG prMB94 P2-mcherry-F GATCCGGATUCTGGTGGAGAAGCTGCAGCTAAAG prMB97 P2-U-comFC-mcherry-F ATCCGGATCUGCTTCTGATCAAGGTAAAAG prMB100 tetL-mcherry-F TAAGAATTCGUATGAACAGCTTATTTACATAATTCAC prMB108 P3-gfp-dsm-R CGAATTCTTAUTTACTTATAAAGCTCATCCATGCCGTGAGTG 133 GATCAAGCTTGAGTACTGATTAACTAATAAGGAG 134 TACTAGCTAGCGCTATCAAAAGAATCTTGC

(21)

138 References

Baitin, D.M., Gruenig, M.C., and Cox, M.M. (2008). SSB Antagonizes RecX-RecA

Interaction. J. Biol. Chem. 283, 14198–14204.

Chung, Y.S., and Dubnau, D. (1998). All Seven comG Open Reading Frames Are Required

for DNA Binding during Transformation of Competent Bacillus subtilis. J. Bacteriol. 180, 41–45.

Davidoff-Abelson, R., and Dubnau, D. (1973). Conditions Affecting the Isolation from

Transformed Cells of Bacillus subtilis of High-Molecular-Weight Single-Stranded Deoxyribonucleic Acid of Donor Origin. J. Bacteriol. 116, 146–153.

Dempsey, G.T., Vaughan, J.C., Chen, K.H., Bates, M., and Zhuang, X. (2011). Evaluation of

fluorophores for optimal performance in localization-based super-resolution imaging. Nat. Methods 8, 1027–1036.

Draskovic, I., and Dubnau, D. (2005). Biogenesis of a putative channel protein, ComEC,

required for DNA uptake: membrane topology, oligomerization and formation of disulphide bonds. Mol. Microbiol. 55, 881–896.

Dubnau, D. (1999). Dna Uptake in Bacteria. Annu. Rev. Microbiol. 53, 217–244.

Grove, D.E., Willcox, S., Griffith, J.D., and Bryant, F.R. (2005). Differential Single-stranded

DNA Binding Properties of the Paralogous SsbA and SsbB Proteins from Streptococcus pneumoniae. J. Biol. Chem. 280, 11067–11073.

Guérout-Fleury, A.-M., Frandsen, N., and Stragier, P. (1996). Plasmids for ectopic

integration in Bacillus subtilis. Gene 180, 57–61.

Hahn, J., Luttinger, A., and Dubnau, D. (1996). Regulatory inputs for the synthesis of

ComK, the competence transcription factor of Bacillus subtilis. Mol. Microbiol. 21, 763– 775.

Hahn, J., Maier, B., Haijema, B.J., Sheetz, M., and Dubnau, D. (2005). Transformation

Proteins and DNA Uptake Localize to the Cell Poles in Bacillus subtilis. Cell 122, 59–71.

Inamine, G.S., and Dubnau, D. (1995). ComEA, a Bacillus subtilis integral membrane

protein required for genetic transformation, is needed for both DNA binding and transport. J. Bacteriol. 177, 3045–3051.

Itaya, M. (1992). Construction of a Novel Tetracycline Resistance Gene Cassette Useful as

a Marker on the Bacillus subtilis Chromosome. Biosci. Biotechnol. Biochem. 56, 685–686.

Kaufenstein, M., Laan, M. van der, and Graumann, P.L. (2011). The Three-Layered DNA

Uptake Machinery at the Cell Pole in Competent Bacillus subtilis Cells Is a Stable Complex. J. Bacteriol. 193, 1633–1642.

(22)

139

Kidane, D., and Graumann, P.L. (2005). Intracellular Protein and DNA Dynamics in

Competent Bacillus subtilis Cells. Cell 122, 73–84.

Kidane, D., Ayora, S., Sweasy, J.B., Graumann, P.L., and Alonso, J.C. (2012). The cell pole:

the site of cross talk between the DNA uptake and genetic recombination machinery. Crit. Rev. Biochem. Mol. Biol. 47, 531–555.

Kjos, M., Aprianto, R., Fernandes, V.E., Andrew, P.W., Strijp, J.A.G. van, Nijland, R., and

Veening, J.-W. (2015). Bright Fluorescent Streptococcus pneumoniae for Live-Cell Imaging of Host-Pathogen Interactions. J. Bacteriol. 197, 807–818.

Konkol, M.A., Blair, K.M., and Kearns, D.B. (2013). Plasmid-Encoded ComI Inhibits

Competence in the Ancestral 3610 Strain of Bacillus subtilis. J. Bacteriol. 195, 4085–4093.

Kramer, N., Hahn, J., and Dubnau, D. (2007). Multiple interactions among the

competence proteins of Bacillus subtilis. Mol. Microbiol. 65, 454–464.

Takeno, M., Taguchi, H., and Akamatsu, T. (2011). Role of ComFA in controlling the DNA

uptake rate during transformation of competent Bacillus subtilis. J. Biosci. Bioeng. 111, 618–623.

Vagner, V., Claverys, J.-P., Ehrlich, S.D., and Méjean, V. (1990). Direction of DNA entry in

competent cells of Bacillus subtilis. Mol. Microbiol. 4, 1785–1788.

Viret, J.F., Bravo, A., and Alonso, J.C. (1991). Recombination-dependent concatemeric

plasmid replication. Microbiol. Rev. 55, 675–683.

Yadav, T., Carrasco, B., Myers, A.R., George, N.P., Keck, J.L., and Alonso, J.C. (2012).

Genetic recombination in Bacillus subtilis: a division of labor between two single-strand DNA-binding proteins. Nucleic Acids Res. 40, 5546–5559.

Yadav, T., Carrasco, B., Serrano, E., and Alonso, J.C. (2014). Roles of Bacillus subtilis DprA

and SsbA in RecA-mediated Genetic Recombination. J. Biol. Chem. 289, 27640–27652.

Londoño-Vallejo, J.A., and Dubnau, D. (1993). comF, a Bacillus subtilis late competence

locus, encodes a protein similar to ATP-dependent RNA/DNA helicases. Mol. Microbiol. 9, 119–131.

Nørholm, M.H. (2010). A mutant Pfu DNA polymerase designed for advanced

uracil-excision DNA engineering. BMC Biotechnol. 10, 21.

Piechowska, M., and Fox, M.S. (1971). Fate of Transforming Deoxyribonucleate in

Bacillus subtilis. J. Bacteriol. 108, 680–689.

Provvedi, R., and Dubnau, D. (1999). ComEA is a DNA receptor for transformation of

competent Bacillus subtilis. Mol. Microbiol. 31, 271–280.

Raaphorst, R. van, Kjos, M., and Veening, J.-W. (2016). Chromosome segregation drives

(23)

140

Smits, W.K., Eschevins, C.C., Susanna, K.A., Bron, S., Kuipers, O.P., and Hamoen, L.W.

(2005). Stripping Bacillus: ComK auto-stimulation is responsible for the bistable response in competence development. Mol. Microbiol. 56, 604–614.

Spizizen, J. (1958). Transformation of biochemically deficient strains of Bacillus subtilis by

deoxyribonucleate. Proceedings of the National Academy of Sciences, 44(10), 1072-1078.

Stingl, K., Müller, S., Scheidgen-Kleyboldt, G., Clausen, M., and Maier, B. (2010).

Composite system mediates two-step DNA uptake into Helicobacter pylori. Proc. Natl. Acad. Sci. 107, 1184–1189.

Supplementary material Chapter 4 Images

Img. 1. Binding of labelled DNA to competent B. subtilis. (A). DyLight650 labelled

DNA. (B) Fluorescein labelled DNA. C: Alexa Fluor 5 labelled DNA. Samples were incubated with 10U of DNaseI for 10minutes and washed to remove unspecific binding.

(24)

141

Img. 2. Fluorescein labelled DNA localisation at pH 7.4 and pH4. (A). Fluorescein labelled DNA at pH7.4 occasionally

shows foci at the border of the cells. (B). Fluorescein labelled DNA at pH4 does not show foci at the edge of cells. The chromosome was strained with DAPI.

Img. 3. Co-localisation of RecA-YFP with DyLight650 labelled DNA. A:

Overlay of RecA-YFP and DNA. B: RecA-YFP. C: DyLight650-DNA.

(25)

142 Tables

colonies reduction efficiency

Fluorescein-DNA 745 3 DyLight650-DNA 852 2.7 Unlabelled DNA 2340 nr.foci 1 2 3 4 nr.cells 465 110 22 2 percentage 77.6 18.4 3.7 0.3

Img. 4. Co-localisation ParB-GFP with DyLight650 labelled DNA. (A).

Overlay of ParB-mKate and Fluorescein-DNA. (B) ParB-mKate. (C). Fluorescein -DNA.

Table 1. Transformation of B. subtilis Pxyl-comK with

Fluorescein-DNA, DyLight650-DNA and unlabelled DNA. The DNA contains the

erythromycin marker and thrC flanking regions from pDG1664.

Table 2. Number of DyLight650-DNA foci per cell. Number of DNA foci

after 1hr incubation with DyLight650 DNA and incubation with 10U DNaseI.

(26)

143

time pole centre

pole/ chrom.

centre/

chrom. 2pole 2centre pole/

cent. septum tot foci tot cells 15min 63 64 14 56 1 5 4 13 220 371 30min 76 57 5 35 2 4 3 4 186 500 45min 90 64 4 41 4 10 9 9 231 671 60min 58 37 6 39 4 8 8 11 171 578 75min 65 60 11 38 4 12 10 4 204 643 90min 53 65 8 46 4 26 7 14 223 559 120min 74 58 2 49 3 18 5 11 220 510 average 68 58 7 43 3 12 7 9 208 547 % 33 28 3 21 2 6 3 5 100

time pole centre

Pole/ chrom,

Centre/

chrom. 2pole 2centre

Pole/ cent. Sept. tot foci tot cells 1min 111 77 16 69 4 3 3 15 298 625 15min 112 72 21 72 5 9 10 23 324 817 30min 78 58 11 63 7 12 9 7 245 626 45min 130 80 18 65 9 20 12 15 349 736 60min 73 49 16 48 8 10 12 12 228 592 75min 73 66 43 59 3 6 12 11 273 517 Avrg. 96 67 21 63 6 10 10 14 286 652 % 34 23 7 22 2 3 3 5 100

Table 3. Localisation of Fluorescein labelled DNA. Localisation of DNA foci was

followed over time by taking a sample at each time point and the average percentage of foci types during this period were calculated. See image 4 in main text for examples of localisation.

Table 4. Localisation of DyLight650 labelled DNA. Localisation of DNA foci was

followed over time by taking a sample at each time point and the average percentage during this period was calculated.

(27)

144

total nr. cells: 3369 DNA ComFC co-localisation

total nr. foci 1104 872 197

percentage cells with foci 33 26 6

Percentage co-localisation DNA/ComFC 23

total nr. cells: 1749 DNA RecA-YFP co-localisation

percentage co-localisation DNA/RecA 26

total nr. cells: 4538 DNA RecA-YFP co-localisation

percentage co-localisation DNA/RecA 15

total nr. cells: 1252 DNA ParB-GFP co-localisation

percentage co-localisation DNA/ParB-GFP 3

Table 5. Co-localisation of DyLight650-DNA with ComFC-GFP after 10min of incubation with DNA. Co-localisation DNA/ComFC was calculated tot. nr. foci

co-localistaion/tot. nr foci ComFC

Table 6. Co-localisation of DyLight650 labelled DNA with RecA-YFP after 15min of incubation with DNA. Co-localisation DNA/RecA was calculated tot. nr. foci

co-localisation/tot. nr foci RecA

Table 7. Co-localisation of DyLight650 labelled DNA with RecA-YFP after 1hr of incubation with DNA. Co-localisation DNA/RecA was calculated tot. nr. foci

co-localisation/tot. nr foci RecA

Table 8. Co-localisation of DyLight650 labelled DNA with ParB-GFP after 10min of incubation with DNA. Co-localisation DNA/ ParB was calculated tot. nr. foci

(28)

145

total nr. cells: 1137 DNA ParB-GFP co-localisation

percentage co-localisation DNA/ParB-GFP 7

total nr. cells: 1292 DNA parB-mKate co-localisation

percentage cells with foci 36 24 1.5

percentage overlap DNA/ParB-mKate 4

total nr. cells: 2200 DNA parB-mKate co-localisation

total nr. foci 1205 1173 107

percentage overlap DNA/ParB-makte 9

Table 9. Co-localisation of DyLight650 labelled DNA with ParB-GFP after 1hr of incubation with DNA. Co-localisation DNA/ ParB was calculated tot. nr. foci

co-localisation/tot. nr foci ParB

Table 10. Co-localisation of Fluorescein labelled DNA with ParB-mKate after 10min of incubation with DNA. Co-localisation DNA/ ParB was calculated tot. nr. foci

co-localisation/tot. nr foci ParB

Table 11. Co-localisation of Fluorescein labelled DNA with ParB-mKate after 1hr of incubation with DNA. Co-localisation DNA/ ParB was calculated tot. nr. foci

(29)