Latitudinal differences in the circadian system of Nasonia vitripennis Floessner, Theresa
DOI:
10.33612/diss.102037680
IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below.
Document Version
Publisher's PDF, also known as Version of record
Publication date: 2019
Link to publication in University of Groningen/UMCG research database
Citation for published version (APA):
Floessner, T. (2019). Latitudinal differences in the circadian system of Nasonia vitripennis. University of Groningen. https://doi.org/10.33612/diss.102037680
Copyright
Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).
Take-down policy
If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.
Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum.
Chapter 5
In search of the hymenopteran circadian light
resetting mechanism
Abstract
Circadian light reception and the transduction pathway of light information in the circadian system is unknown in hymenopteran insects. In Drosophila melanogaster, cryptochrome (d-CRY) functions as a photo-sensitive clock component, but in hymenoptera, cryptochrome is a photo-insensitive mammalian ortholog (m-CRY). In mammals, circadian light resetting and entrainment is caused by light induced transcription of the period genes (per). Due to similarities between the hymenopteran and mammalian cryptochrome, we tested the hypothesis that hymenopteran circadian light resetting would also be mediated through light induction of clock genes. We tested this in two European Nasonia vitripennis (hymenoptera) lines, known to be different in photoperiodic response and light sensitivity. We measured RNA levels of seven putative circadian clock genes during the application of a 4-h light pulse at ZT14 and ZT20. There was no indication of light induction for per or any other gene. Because we previously described higher circadian light sensitivity in the northern Nasonia line, we created partial expression profiles of opsin genes in northern and southern Nasonia line. Differences in gene expression level in the second half of the subjective night showed a trend that was opposite to our expectations with lower opsin expression levels in the northern line than in the southern. Our results emphasize the importance to further explore circadian light resetting in hymenopterans.
Authors: Theresa S.E. Floessner1, Roel van Eijk1, Domien G.M. Beersma1, Roelof A. Hut1
Introduction
Organisms on Earth live in a constantly changing environment most noticeable by the daily light-dark cyclewith a period length of 24 hours. An endogenous circadian clock times daily behaviour and physiological processes and uses light as the strongest Zeitgeber (time giver) to entrain to the environmental 24 h cycle. The core circadian clock of most animals resides in the brain, is genetically determined and shows homologies between species. The general functionality for most circadian systems is based on interlocked transcriptional-translational feedback loops (Hall 2003; Hardin 2005), where clock-proteins either activate or inhibit their own transcription or the transcription of other clock genes (Gallego and Virshup 2007).
In Drosophila melanogaster, central elements of the molecular ‘core clock’ are the genes period (per) and timeless (tim1) (Hardin et al. 1990; Sehgal et al. 1994). Their transcription is initiated by the transcription factors Clock (clk) (Allada et al. 1998) and cycle (cyc) (Rutila et al. 1998) in the late morning. per and tim mRNA become translated followed by phosphorylation of PER and consequently its destabilization and degradation. Throughout the day TIM is permanently degraded due to its interaction with the photo-sensitive protein cryptochrome (d-CRY) (Myers et al. 1996; Zeng et al. 1996), the main photoreceptor of the circadian system in Drosophila (Emery et al. 1998; Stanewsky et al. 1998). In darkness and therefore in absence of active d-CRY, TIM and PER dimerize and are phosphorylated by doubletime (DBT) and other kinases (Kloss et al. 1998; Price et al. 1998; Syed et al. 2011) to form a trimer. In the middle of the night the protein-complex translocates into the nucleus where it binds to CLK-CYC and inhibits transcription of per and tim1. At dawn d-CRY starts to degrade cytoplasmic TIM again and PER gets destabilized and degrades via phosphorylation. Consequently CLK-CYC reactivate the transcription of per and tim1 and the entire cycle starts again. In another interlocked loop CLK-CYC are transcription factors of PAR Domain Protein 1 ɛ ( pdp1ɛ) (Cyran et al. 2003) and vrille (vri) (Blau and Young 1999), that later acts either as clk transcription activator (by PDP1ɛ) or inhibitor (by VRI). In a third feedback loop CLK-CYC activate the transcription of clockwork orange (cwo) (Kadener et al. 2007; Lim et al. 2007; Matsumoto et al. 2007) which acts as a repressor of per and tim1 transcription (Zhou et al. 2016). These feedback-loops control many following processes by their temporal organization of so call ‘clock controlled genes’ or further regulations of post-translational modification.
A network of about 150 ‘clock neurons’ form the core of the circadian pacemaker in the fly brain. Different neuronal clusters control different processes and behaviours and communicate via peptidergic signalling of the neuropeptide pigment-dispersing factor (PDF) as well as ion transport peptide (ITP) (Lin 2004; Hermann-Luibl et al. 2014) and other substances. In principle, it is thought that light in Drosophila can penetrate the cuticle to activate d-CRY in these clock neurons leading to entrainment of the core clock in the brain. Alternative circadian light input pathways work through visual photoreceptors in the compound eyes, H-B eyelet and ocelli, although re-entrainment to phase shifts, based solely on these pathways, takes longer (Yoshii et al. 2015). Transmission of light information into the neuronal circuit occurs mainly via PDF.
Photopigments of the visual system are G-protein coupled receptors containing an opsin molecule and a light absorbing chromophore. The amino acid sequence of the opsins leads to
variation in spectral properties. In Nasonia, three opsin genes have been identified, with predicted peak absorbance of their proteins: UV-opsin at 300-400 nm (NasoniaBase NV10460-RA), short wavelength opsin (sw-opsin) at 400-500 nm (NasoniaBase NV11914-RA) and long wavelength opsin (lw-opsin) at 500-600 nm (NasoniaBase NV11485-RA). This seems to be roughly in line with electrophysiological photosensitivity measurements in another hymenopteran, the solitary bee species Osmia rufa (Menzel et al. 1988).
The mammalian clock is also based on a negative feedback loop. During the day the transcription factors and heterodimer of CLOCK and BMAL1 activate the transcription of per1, per2 and per3 as well as m-cry1 and m-cry2 and their proteins together with CK1δ and CK1ε to inhibit their own transcription by interacting with the CLOCK-BMAL1 dimer, similar to the Drosophila loop. The mammalian clock resets through a non-visual circadian photoreceptor melanopsin (Berson 2003) which is expressed in retinal ganglion cells (RGCs), that receive additional rod and cone signals (Provencio et al. 2000, 2002; Panda et al. 2002; Ruby et al. 2002), and transmit photic signals into the suprachiasmatic nucleus (SCN) (Gooley et al. 2001; Hannibal et al. 2002; Hattar et al. 2002) via the retinohypothalamic tract (RHT). The neuronal response of the SCN leads to immediate induction of per1 and subsequently per2 through a CREB signalling pathway (Albrecht et al. 1997; Shearman et al. 1997; Shigeyoshi et al. 1997; Travnickova-Bendova et al. 2002).
In honeybees, Apis mellifera, more similarities to the mammalian than to the fly clock had been found (Rubin et al. 2006; Weinstock et al. 2006). The genome of the honeybee encodes the photo-insensitive mammalian cry (m-cry) but not the photo-sensitive Drosophila cry (d-cry) nor tim (Rubin 2006). Further clock components known from the Drosophila clockwork had been identified like per, cyc, clk, tim2, vri and PDP1 (Rubin 2006, Weinstock 2006) and a possible feedback loop could have been created which is similar to the mammalian loop. Here a CYC-CLK dimer activates the transcription of per and am-cry which protein products later act like a repressor for CYC and CLK. Additionally, a non-visual opsin has been identified in the brain of honeybees, the so called pteropsin, that might be involved in vertebrate-like light detecting systems (Velarde et al. 2005).
Interestingly, cryptochromes genes in Lepidoptera, like the monarch butterfly Danaus plexippus, encode for two cry variants, the photosensitive Drosophila type and the photo-insensitive mammalian ortholog. Danaus uses lfy-like CRY to reset their circadian system (Zhu et al. 2006). The mannalian-like CRY seems to have the same role in butterflies as in honeybees and mammals, where it functions as a repressor of CYC-CLK dimer activity (Zhang et al. 2017). The parasitic wasp Nasonia vitripennis is well known for its strong seasonal photoperiodic response and strong circadian behaviour. QTL analysis of Nasonia lines from different latitudes revealed genomic regions encoding for the clock genes period, cycle and cryptochrome being involved in photoperiodic response of diapause induction (Paolucci et al. 2016). Furthermore, we could detect that the circadian system of a northern line is more light sensitive than that of a southern line (Chapter 3). As part of the order of hymenoptera, Nasonia is closely related to honeybees and both encode for the photo-insensitive mammalian-like cry and the mammalian-like tim2. However, a pteropsin gene has not been described in Nasonia, which gives room for speculations about its photic entrainment pathway.
To understand the processes underlying circadian light entrainment in hymenoptera, we aim to study light driven gene transcriptional responses in the circadian system of Nasonia vitripennis. As a first approach, we will quantify putative clock gene mRNA levels in response to a light pulse under the hypothesis that these will show similarities to the circadian light resetting mechanism in mammals. Furthermore, we investigate whether the differences in circadian light sensitivity of Nasonia lines from different latitudes are related to differential opsin genes expression levels.
Material & Methods
Experimental lines
Experiments were performed with two Nasonia vitripennis isofemale lines from Oulu, Finland (65°3’40.16’’N, 25°31’40.80’’E) and Corsica, France (42°22’40.80’’N, 8°44’52.80’’E) (Paolucci et al. 2013). These lines will be referred to as the “northern line” (isofemale line from Oulu) and “southern line” (isofemale line from Corsica). All animals were reared in a climate chamber under controlled temperature and humidity (20° C ±1° C; 50-55% RH) and a light-dark cycle of LD 16:8. The wasps used during the experiments were F1 generations of individually housed females, supplied with two Calliphora spp. pupae as hosts.
Entrainment and sample collection
Mated females at the age of three to five days were transferred into polystyrene tubes (60 mm x 10 mm) which were filled with 1 ml of agar food (30% sucrose, 1.5% agar, 0.15% nipagin); about thirty animals per tube. The tubes were placed into light-tight boxes (23 x 14 x 32 cm) in 18°C (±1 °C) and 50-55% RH. Each box was illuminated with one LED light source (ILH-GD01-NUWH-SC201, Neutral White 4000K PowerStar, Berkshire, UK; with OSRAM LCW W5AM-JZKY-4L8N Golden DragonPlus LED) of approximate 2.10*1015 photon·cm-2·s-1 intensity (high light intensity) (Fig. 1). To increase detection of immediate early gene induction by light we applied light at two different times of day, ZT14 and ZT20, and took samples during a time course up to 240 min after the onset of the light pulse. The light pulse was applied 14 h and 20 h after the last lights-off, after an entrainment period of seven days in a light-dark cycle of LD 16:8. Samples were taken at: 0 min, 15 min., 30 min., 60 min., 90 min., 120 min., 240 min. after the onset of the light pulse. Opsin gene expression profiles were determined only in dark controls. We decided to take samples in shorter intervals during the first hour of the time course as it was shown that immediate early gene induction in mice occurs within the first 30 to 60 minutes after lights-on (Shigeyoshi et al. 1997). Tubes containing dark controls as well as the first samples taken at 0 min. were wrapped into tin-foil during the last photophase of the last light-dark cycle of the entrainment. Collected samples were snap frozen in liquid nitrogen and stored in -80°C.
Figure 4 Light spectrum at 2.10*1015 photon·cm-2·s-1 intensity (high light intensity)
RNA extraction, cDNA synthesis and qPCR
Per sample, 25 heads were used for total RNA extraction with Trizol reagent (Thermo Fisher Scientific) performed by following the manufacturer’s instructions. Each sample was subjected to a DNase treatment (Thermo Fisher Scientific) to eliminate any DNA contaminations. Additionally, 1 ug of RNA was then used to synthetize cDNA with RevertAid H Minus First Strand cDNA Synthesis kit (Thermo Fisher Scientific) according to the manufacturer’s protocol and stored at -20°C. The cDNA was diluted to a concentration of 10 ng/µl and quantitative real-time PCR (qPCR) was performed following the manufacturer’s instructions of the fast SYBR Green Master Mix (2x) (Thermo Fisher Scientific). The reactions were performed with a CFX96 Real-Time PCR Detection System (Bio-Rad), each sample with a total volume of 20 µl and the following reaction conditions: 2 min at 95°C, followed by 50 cycles of 3 sec at 95°C and 30 sec at 60°C. A melting curve was measured after each completed reaction. Furthermore, technical conditions were verified by using doublets of each sample.
We could identify seven putative clock genes and four opsin genes. Elongation factor 1α (EF1α) is an established internal control which was shown to be a non-cyclic housekeeping gene in Nasonia vitripennis (Bertossa et al. 2014). Primers were designed based on the published whole genome sequence on NCBI by Primer-BLAST (NCBI, Bethesda, USA) and ordered from Biolegio (Nijmegen, NL) and Invitrogen (USA). Primers used in qPCR targeted the Nasonia vitripennis genes period (per, NCBI Ref. Seq. XM_016988928.1, fwd.:
TCTCGTCGCCTTCTTCCAAC, rev.: ATCGGGATCGACGTAGGACA), timeless 2 (tim2,
NCBI Ref. Seq. XM_008207133.2, fwd.: CGCCGCTATGCAGTGTTTT, rev.:
TATCGGGACTTCTCTCGGC), nv-cryptochrome (nv-cry, NCBI Ref. Seq.
TCGGGCTATCACGTTCTGGA), cycle (cyc, NCBI Ref. Seq. XM_008217573.1 fwd.: GAAGCGTCGAAGGGACAAGA, rev.: GACGACGAAGACGAAACCCT), clock (clk, NCBI Ref. Seq. XM_008216216.2, fwd.: GGCGAAGGTACGTCGTGTTA, rev.: CTGCTGGTCGCGAAGTTTTC), pigment dispersing factor (PDF, NCBI Ref. Seq.
XM_016989199.1, fwd.: TTCGTTTTCGGAGCCATCCT, rev.:
TGGGGTGCCAACAATAACCT), double time (DBT, NCBI Ref. Seq. XM_016983222.1, fwd.: GCGGAACAGAGGGTGACTAC, rev.: CCTTTCTTTCCCAGCCCCAT), long
wavelength opsin (lw-opsin, NCBI Ref. Seq. NM_001170908.1, fwd.:
GCCAAGAAGATGAACGTCGC, rev.: TACCAGCCCAGTTGATGACG), short wavelength opsin (sw-opsin, NCBI Ref. Seq. XM_001604572.4, fwd.: CACATCGGCCTCGCTCTTAT, rev.: TGATGAACAGGTTCGACGGG), UV opsin (UV-opsin, NCBI Ref. Seq.
XM_001608024.4, fwd.: GTCAGAACAAGGACCAGGCA, rev.:
CGATCAGGGACATCACTCCG), rhodopsin (rho, NCBI Ref. Seq. XM_016983507.1, fwd.: ATCGCCCTCACTAGACCCT, rev.: AAGGAGGAAAGGTCAGCGT) and elongation factor
1a (EF-1a, NCBI Ref. Seq. XM_008209960.1, fwd.: CACTTGATCTACAAATGCGGTG,
rev.: CCTTCAGTTTGTCCAAGACC).
Data analysis and Statistics
Specificity of amplification was checked by means of melting curve analysis; sterile water (non-template control) during cDNA synthesis served as negative control. Relative RNA abundance as well as individual efficiency were calculated with LinRegPCR (Ramakers et al. 2003; Ruijter et al. 2009) using the Δ∆Cq method, where Ef1α was used as reference. Data were potted as fold change relative to t0 for each biological replicate. Statistical comparison was performed by a two-way analysis of variance (ANOVA) followed by a post-hoc test in Excel using α = 0.05.
Results
Light induction of clock genes
Light induction of putative clock genes per, tim2, nv-cry, cyc, clk, pdf and dbt was measured. At two different time points, ZT14 and ZT20, we applied a light pulse and measured relative RNA abundance during the first 240 min. Additionally, we were interested in opsin expression (rho, sw-opsin, lw-opsin and UV-opsin) and their possible correlation with different circadian light sensitivity observed between the northern and southern line.
With a light pulse applied at ZT14 we could not find significant differences in RNA abundance between the illuminated animals and the dark controls (Fig. 2). Although we found an interaction effect in per of the northern line (two-way ANOVA pinteraction < 0.02), we could
not identify differences between treatments for any time point (Fig. 1A). Furthermore, in the northern line we did not get differences in RNA abundance levels for tim2 or nv-cry (Fig. 2C, E). In the southern line we did not find any significant differences between the illuminated and dark control groups for per, tim2 and nv-cry (Fig. 2B, D, F). Comparing gene
expression level of the northern and southern line during the light pulse starting at ZT14, per levels differed with an overall higher RNA abundance in the southern line than in the northern (two-way ANOVA n = 31, F1, 16 = 16.38, p < 0.001) but not over the time points (two-way ANOVA n = 31, F1, 16 = 0.77, p > 0.6) (Fig. 2A, B).
Figure 2 Light induction of clock genes per, tim 2 and nv-cry at ZT14. Relative RNA abundance of per, tim2
and nv-cry of the northern (A, C, E) and southern line (B, D, F) in response to a light pulse applied at ZT14 comparing groups illuminated (triangles; open triangles represent the two different biological replicates, solid triangles represent the average) and dark control (circles; open circles represent the two different biological
replicates, solid circles represent the average) in a time course of 240 min., pintac (p-value of two-way ANOVA
Additionally, there were no differences between lines for tim 2 and nv-cry expression (Fig. 1C, D, E, F). Similar results were obtained by comparing the dark control condition between the lines (Fig. 1); also here RNA abundance for per was different between lines (two-way ANOVA n = 31, F1, 16 = 15.31, p < 0.001) but not time points (two (two-way ANOVA n = 31, F7, 16 = 2,20, p > 0.09) (Fig. 2A, B). There were no further significant differences between the lines in expression levels for the other genes.
Figure 3 Light induction of clock genes cyc, clk, dbt and pdf at ZT14. Relative RNA abundance of cyc, clk,
dbt and pdf of the northern (A, C, E, G) and southern line (B, D, F, H) in response to a light pulse applied at ZT14 comparing groups illuminated (triangles; open triangles represent the two different biological replicates, solid triangles represent the average) and dark control (circles; open circles represent the two different biological
replicates, solid circles represent the average) in a time course of 240 min. ptreat (p-value of two-way ANOVA
testing for treatment-light or dark control), pintac (p-value of two-way ANOVA testing for interaction of lines and
Additionally, for the illuminated groups at ZT14, neither in the northern nor in the southern line we saw any significant differences between the light conditions in RNA abundance for cyc, clk or pdf (Fig. 3A, B, C, D, G, H). For dbt the northern line also showed no significant differences (Fig. 3E) but in the southern line (two-way ANOVA pline < 0.02,
pinteraction < 0.004) with a significant difference 240 min. after lights-on (Fig. 3F). Comparing
lines in their light condition we do not see significant differences for the expression levels of cyc, clk, pdf and dbt (Fig. 3).
Figure 4 Light induction of clock genes per, tim 2 and nv-cry at ZT20. Relative RNA abundance of per, tim 2
and nv-cry of the northern (A, C, E) and southern line (B, D, F) in response to a light pulse applied at ZT20 comparing groups illuminated (triangles; open triangles represent the two different biological replicates, solid triangles represent the average) and dark control (circles; open circles represent the two different biological replicates, solid circles represent the average) in a time course of 240 min., ptp (p-value of two-way ANOVA
When applying light at ZT20, samples were taken over a time span of 240 min. Measured RNA abundance showed no indication for light induced gene expression (Fig. 4). In the northern line we found significant differences in per RNA abundance between the time points (two-way ANOVA ptime point < 0.001) but not between light and dark control (Fig. 4A). Similar
for tim 2; significant differences between time points (two-way ANOVA ptime point < 0.03) but
not between the light treatment (Fig. 4C). nv-cry RNA abundance showed no differences between time points nor treatment (Fig. 4E). In the southern line we could not identify any significant differences between the illuminated and the dark control groups neither for per nor for tim 2 or nv-cry (Fig. 4B, D, F). For the light pulse at ZT20, per gene expression differed significantly between lines (two-way ANOVA n = 27, F1, 14 = 32.86, p < 0.001) and time points (two-way ANOVA n = 31, F6, 16 = 4.08, p < 0.02) with higher RNA abundance level in the southern than in northern line; we see the same in the dark controls (between lines: two-way ANOVA n = 27, F1, 14 = 61.14, p < 0.001; between time points: two way ANOVA n = 27, F6, 14 = 8.9, p < 0.001). But no significant differences in the other genes between illuminated and dark control (Fig. 4).
Figure 5 Light induction of clock genes cyc, clk, dbt, and pdf at ZT20. Relative RNA abundance of cyc, clk,
dbt and pdf of the northern (A, C, E, G) and southern line (B, D, F, H) in response to a light pulse applied at ZT20 comparing groups illuminated (triangles; open triangles represent the two different biological replicates, solid triangles represent the average) and dark control (circles; open circles represent the two different biological replicates, solid circles represent the average) in a time course of 240 min. ptp (p-value of two-way ANOVA testing
Comparison of opsin gene expression between northern and southern line
Figure 6 Light induced expression of opsins at ZT14 and ZT20. Relative RNA abundance of rho, sw-opsin,
lw-opsin and UV-opsin of the northern (solid line) and southern line (dashed line) starting at ZT14 and ZT20 in
darkness in a time course of 240 min. ptp (p-value of two-way ANOVA testing for time point), pline (p-value of
We determined opsin gene expression levels of the northern and southern line to identify possible correlation with different circadian light sensitivity observed between the lines (Chapter 3). Samples were taken in darkness, over a time span of 240 min, starting at ZT14 (Fig. 3A, B, C, D) and ZT20 (Fig. 3E, F, G, H).
The sample collection starting at ZT14 did not show strong variation between the lines (Fig. 6). We could not find significant differences in RNA abundance in rho and lw-opsin but in sw-opsin (Fig. 6A, C) for lines (two-way ANOVA pline < 0.008), as well as in UV-opsin
(two-way ANOVA pline < 0.003) (Fig. 6B, D); for both we found higher RNA levels in the northern
line than in the southern. In samples collected after ZT20 we found greater variation in RNA abundance between the lines (Fig. 6). The southern line expressed higher rho RNA levels than the northern line (two-way ANOVA pline < 0.001) (Fig. 6A). The same for sw-opsin (two-way
ANOVA pline < 0.001, ptime point < 0.005), also significant for the time point ZT21 (Fig. 6F) and
for UV-opsin (two-way ANOVA ptime point < 0.04) at ZT21 (Fig. 6H). lw-opsin did not show
significant differences between the lines (Fig. 6G).
Discussion
Nasonia’s circadian light resetting does not occur by light induced gene induction of per or any other tested clock gene
Circadian light resetting in insects is well studied for example in Drosophilida or Lepidoptera. Here CRY is the photo-sensitive clock element that entrains (or resets) the circadian clock by interfering directly with the core loop of the molecular clock by TIM and subsequent PER degradation. The N. vitripennis’ ortholog of CRY is photo-insensitive and thereby shows functional homology to the mammalian m-CRY. Experiments by Shigeyoshi et al. 1997 in mice showed that light pulses during the dark phase lead to an immediate induction of per1 transcription within the first 30 min. of the pulse, resulting in phase shifts and phase resetting of the clock. To identify possible homologies of the circadian light resetting pathway between Nasonia and the mammalian clock system, we quantified RNA abundance of seven putative clock genes during light pulses applied at ZT14 and ZT20 with a time span of 240 min. Further, darkness RNA levels of four opsin genes at ZT14 and ZT20, were quantified to explain differences in light sensitivity of a northern and a southern European N. vitripennis line, showing different circadian light sensitivity (Chapter 3).
Although we found significant differences in some cases between either lines or time points, we could not find a clear immediate early gene induction of the clock genes similar to mouse studies (Shigeyoshi et al. 1997). If anything, our results rather show a decrease of RNA abundance during a light pulse, than an increase (Fig. 4). This may indicate that N. vitripennis’ circadian system has to entrain by another molecular mechanism than mammals, which is not dependent on immediate early gene induction of per or another clock gene that we have tested. Perhaps nv-CRY has retained some form of photosensitivity that enables resetting of the circadian clock. This option seems unlikely, since the gene sequence and protein structure of nv-CRY shows mammalian-like functional domains but misses out on similarities with d-CRY (Bertossa et al. 2014; Buricova 2018). Alternatively, in D. melanogaster for example, visual
input pathways from the compound eyes as well as H-B eyelet and ocelli are able to rescue at least partly d-CRY-dependent light entrainment (Helfrich-Förster et al. 2001; Yoshii et al. 2015). Furthermore, other insect species are known to use different light reception strategies to entrain, as we know from Hemimetabolous like crickets (Gryllus bimaculatus) or cockroaches (Periplaneta Americana, Leucophaea maderae), where the compound eye is the most important circadian light receptor (Roberts 1965; Nishiitsutsuji-Uwo and Pittendrigh 1968; Tomioka and Chiba 1984). Lepidoptera like monarch butterflies (Danaus plexippus) express both mammalian-like and fly-like cry variants; here the fly-like CRY acts as the main circadian light receptor and degrades TIM whereas the mammalian-like CRY represses per and tim transcription mediated by CLK-CYC (Zhu et al. 2008). Furthermore, hymenoptera like honeybees (Apis mellifera) might even use another non-visual receptor, pteropsin (Velarde et al. 2005). A pteropsin ortholog could not be found in Nasonia and therefore, it is rather likely that Nasonia’s visual photoreceptors opsins are involved in circadian light reception.
Opsin RNA levels differ between the northern and southern line, but do not explain observed light sensitivity differences between the lines.
In this study, we measured RNA abundance of four opsin genes (rhodopsin, short-wavelength sensitive opsin, long-wavelength sensitive opsin and UV sensitive opsin) in a time course of four hours, starting at ZT14 and ZT20 in darkness. In the time course starting at ZT14 the differences between the lines is small (Fig. 6 A-D). The differences become bigger in the time course following ZT20, showing an overall lower RNA level of the northern line than the southern line (Fig. 6 E-H); we see the same tendency also in the per, tim 2 and nv-cry expression (Fig. 2 & Fig. 4). In Chapter 3 we show higher circadian light sensitivity in the northern line than in the southern line, therefore we expected a higher RNA abundance of the opsin genes in the northern line than in the southern line. The opsin expression patterns are thus opposite of what was expected. Perhaps synaptic modulation downstream of the photoreceptors or second messenger pathways over-compensate for the reduced opsin expression in the northern line. Further, RNA abundance was measured in darkness, it is possible that the expression profile would differ when sample collection would occur during light. Additionally, our measurement time points may have missed circadian modulation of opsin expression over time, causing additional source of variation.
We analysed two biological replicates where we also had to exclude some time points due to large intra-sample variance. Perhaps with more biological replicates we could get smoother curves and more reliable data. Variation within the treatments can be reduced by more biological replicates and the exclusion of extreme values to get clearer results. Further, technical discrepancies in the qPCR machine might also have contributed to additional variance.
Taken together, our results show that in Nasonia circadian light resetting is not reflected in clock gene induction by light. Furthermore, higher circadian light sensitivity in Nasonia from higher latitudes cannot be explained by differences in opsin gene expression levels, as we found either similar or even lower RNA abundance in the northern line compared to the southern line. Further research is required to elucidate circadian light resetting mechanisms in hymenoptera.
Acknowledgements
We kindly thankDr. Jocelien Olivier for her support with the data analysis and statistics and Anna Rensink and Dr. Elena Dalla Benetta for their help with the qPCR protocol and preliminary data analysis with LinRegPCR. This work was supported by the Marie Curie Initial Training Network programme INsecTIME [Grant number PITN-GA-2012-316790].
