Bachelor Thesis of Chemistry
How the quinone pool regulates ArcBA activity
regulation of the respiratory system of Escherichia coli
by
Judith J. Strik
2nd of July 2014
Research institute
Supervisor
Swammerdam Institute of Life Sciences
dhr. prof. dr. Klaas J. Hellingwerf
Research group
Daily supervisor
2
Populair wetenschappelijke samenvatting
In de huidige tijd waarin de hoeveelheid natuurlijke hulpbronnen zoals olie afnemen, wordt de vraag naar alternatieve bronnen steeds groter. Een mogelijk alternatief is het gebruik van bacteriën die voor de mens nuttige stoffen produceren. Een bacterie die bijvoorbeeld ethanol produceert (een biobrandstof) is Escherichia coli (E.coli) (1). Deze bacterie vormt tijdens de stofwisseling ook allerlei andere bruikbare stoffen, zoals melkzuur en vitamine K (2). Echter, de hoeveelheden van dergelijke stoffen zijn afhankelijk van de omstandigheden waarin de bacterie groeit. E.coli kan namelijk verschillende stofwisselingsroutes aannemen, afhankelijk van de aanwezigheid van zuurstof.
Er zijn drie stofwisselingsroutes te onderscheiden. In een zuurstofrijke omgeving gebruikt E.coli de
citroenzuurcyclus dat CO2 produceert. In een zuurstofloos milieu kan E.coli twee alternatieve routes
volgen: in aanwezigheid van nitraat vormt het organisme veel acetaat en in afwezigheid van zowel nitraat als zuurstof wordt de fermentatie route gevolgd waarbij acetaat, ethanol en formaat worden gevormd (3).
Op dit moment is er nog weinig bekend over de optimale omstandigheden voor de productie van dergelijke ‘nuttige’ stoffen. Daarom is het noodzakelijk om te weten hoe E.coli deze stofwisselingsroutes reguleert. Bij E.coli gebeurt deze regulatie door middel van twee systemen die het zuurstofniveau meten. Ten eerste, het Fnr eiwit meet direct het zuurstofniveau en is onder zuurstofrijke omstandigheden actief. Ten tweede, meet het ArcA eiwit indirect zuurstof en is vooral actief bij de zuurstofloze en fermentatie routes. De regulering van dit ArcA is bij dit onderzoek bekeken.
Het ArcA eiwit is onderdeel van een tweedelig systeem: ArcBA. Hierbij wordt het ArcA eiwit gereguleerd door het ArcB eiwit. Het ArcB eiwit wordt op zijn beurt geactiveerd door chinonen, dat zijn elektronen dragers (celmembraan gebonden). Deze chinonen kunnen zowel in geoxideerde als gereduceerde toestand voorkomen (4). In E.coli spelen drie chinonen een belangrijke rol: ubichinon (UQ), menachinon (MK) en dimethylmenachinon (DMK). Er wordt aangenomen dat gereduceerde chinonen ArcB activeren (5).
Deze hypothese is onderzocht aan de hand van experimenten met verschillende E.coli stammen. Bij culturen in exponentiële groeifase is elke 30 minuten het zuurstofniveau met 20% gedaald en daarbij gekeken naar onder andere de activiteit van het ArcA eiwit. Deze experimenten hebben uitgewezen dat DMK inderdaad in staat is om ArcA te activeren in een zuurstofloos milieu. Dit betekent dat het ArcBA systeem door zowel UQ als DMK gereguleerd kan worden. Dat is een mooi resultaat, maar er is nog voldoende werk voordat E.coli als levende productie cel gebruikt kan worden!
3
Abstract
The facultative nature of Escherichia coli (E.coli) ensures that it can switch in metabolic modes. This switch is depended on oxygen level, which is measured by two systems. The Fnr protein measures oxygen level directly and the two –component ArcBA system senses oxygen availability. The latter system is looked into in this research. It is known that ArcB histidine kinase fosforylates the ArcA protein and thereby activates. The hypothesis is that reduced quinones are able to activate ArcB. Therefore, the redox state of the quinone pool in the respiratory system of E.coli is researched in conditions of decreasing oxygen level. The quinone pool consists of three main quinones which are ubiquinone, menaquinone and dimethylmenaquinone. Experiments include the growth of batch fermentor cultures under glucose limited conditions for a decreasing air level over time. Both ArcA activity and the quinone pool were observed. From the growth of AV36 (dimethylmenaquinone only producing strain) it can be concluded that dimethylmenaquinone is able to activate ArcA under anaerobic conditions. Additionally, experiments with batch cultures of the wild type MG1655 under stress of fermentation products are done. This has proven that fermentation products such as ethanol and lactate do not influence the growth rate of E.coli. Upon addition of formic acid a significant amount of ethanol was formed which could be caused by a switch to the fermentative mode. Finally, an attempt of cloning a mutant strain which only produces menaquinone is described. However, this cloning has not been successful thus far.
4
Table of Contents
Populair wetenschappelijke samenvatting ... 2
Abstract ... 3
Introduction ... 5
Chapter 1: Batch fermentor cultures ... 8
Chapter 2: Batch cultures ... 16
Chapter 3: Mutant strain ... 19
Conclusion ... 24
References ... 25
5
Introduction
Escherichia coli (E. coli) is a gram-negative proteobacterium, and one of the most studied organisms on Earth (6). E. coli is a short non-sporing rod shaped bacterium, see figure 1, and is an almost universal inhabitant in the human gut and other warm-blooded animals. The organism is also used in synthetic biology in order to regulate the production of metabolites, like ethanol and lactate, which might be used as a bio-fuel (1). At the moment there is an increasing demand for such energy substitutes, due to the growing world population, climate change and depletion of resources. Therefore, knowledge on the physiology of E. coli is important, not only from fundamental interests but also as a key in obtaining high yield of metabolites (5).
Research on E.coli has shown so far that the physiology of the organism is influenced by the availability of oxygen and therefore how the respiratory machinery functions (7). E. coli is known as a metabolically versatile bacterium, which can obtain three different metabolic modes: aerobic respiration, anaerobic (nitrate) respiration and fermentation (3). Respiration in all kinds of organisms and mitochondria is the process of electron transfer which acquires energy. The respiratory chain consists of a series of enzyme complexes and associated cofactors which are electron carriers (8). This facultative nature of bacteria such as E. coli means that there are capable of growth under both aerobic and anaerobic conditions (9). The three different metabolic modes are shown in figure 2.
Figure 2: The metabolic modes of E.coli: (A) aerobic respiration, (B) anaerobic (nitrate) respiration and (C) fermentative pathway. Picture taken from Trotter et al., 2011 (3)
It is shown that the respiratory chain of E.coli is regulated by quinones which are present as membrane-associated that are able to carrier electrons (10). Electrons are generated during heterotrophic breakdown of an energy source (such as glucose) and are subsequently brought to quinones which serve as substrate for the reduction of terminal acceptors. Electron transfer goes from an electron donor like NADH to quinones, which thereby carry electrons by cytochrome oxidases towards electron acceptors (11).
In an aerobic environment oxygen is the final electron acceptor, but alternatively nitrate, fumarate or DMSO can be used as terminal acceptors (5). Dehydrogenases together with cytochrome oxidases are able to pump protons through the membrane and thereby creating the protonmotive force, as
Figure 1: Microscopic picture of Escherichia coli. Source: Sadava et al., 2011 (6)
6
described in the chemiosmotic theory (12). The proton motive force releases energy that is used by the organism for e.g. ATP synthesis.
Thus, under aerobic conditions an energy source such as glucose is completely oxidized to CO2 and
acetate (3). However, under anaerobic conditions without another terminal electron acceptor such as nitrate, i.e. fermentation, glucose is converted to acetate, ethanol and formate. The energy that is conserved by anaerobic respiration is less than for aerobic respiration because glucose is only partially oxidized and acetate is excreted as a so-called overflow metabolite (3). In the absence of oxygen or another external electron acceptor ATP synthesis occurs at substrate fosforylation which is less energy conserving (13). How the cell can regulate the transition of aerobic to anaerobic conditions is researched intensively and within E. coli two systems are recognized. The Fnr protein measures the oxygen concentration directly in the cell and thereby serves as an activator of genes which are involved in anaerobic respiration. In addition, the ArcBA system measures oxygen availability indirectly by transcriptional regulation (13). Within this research the focus will be on understanding the last protein system.
The Arc (Anoxic Redox Control) system consists of two-components (A and B) which can regulate the activity of metabolic pathways as a result of oxygen activity. The ArcB sensor is a histidine kinase that can activate ArcA by kinase activity, i.e. ArcA is fosforylated and thereby activated (4). Research showed that ArcB can be activated by autofosforylation under reducing (oxygen poor) conditions, whilst this process in inhibited under oxidizing conditions. Furthermore, it is found that ArcB autofosforylation is inhibited by oxidized quinone electron carriers (14). Maximal kinase activity was also found under anaerobic conditions which is consists with this hypothesis. Therefore, it is suggested that reduced quinones are able to regulate the kinase activity of the ArcB sensor in E. coli (see also figure 3). The quinone pool for the respiratory chain of E. coli consists of three quinones: ubiquinone (UQ), dimethylmenaquinone (DMK) and menaquinone (MK). They differ in midpoint potentials and therefore each quinone plays a different role in the metabolic modes. Ubiquinone (110 mV) is mostly involved in aerobic and nitrate respiration. In addition, menaquinone (-80 mV) and its precursor, dimethylmenaquinone (36 mV) are involved in anaerobic respiration (5, 15).
It appears that the ArcBA system aims to restore the redox balance, i.e. redox homeostasis, by the system’s regulation of the metabolic pathways. It is known that the redox state of the quinones, together with the size of the quinone pool, influence this regulation. More specifically, for ubiquinone is it shown already that it is able to oxidize cysteine residues of the ArcB enzyme, thereby activating the sensor (16). Additionally, for menaquinone it is also suggested to play an important
Figure 3: Model for ArcB activity by aerobiosis level (adapted from Malpica et al., 2004 (16): at 0% aerobiosis ArcB is activated, i.e. reduced cysteine residues and for a shift from anaerobic conditions to aerobic conditions the cysteine residues of ArcB are oxidized and therefore its kinase activity inactivated (4)
7
role in ArcB activation by reducing ArcB activity (4) . Because research showed that it is not likely that ubiquinone is the only regulating quinone, it seems other additional factors are involved (4). In general it is found that ArcB regulation is a not a linear response system, when compared to the concentration of reduced quinones and the oxygen level.
Furthermore, it is also suggested that the redox state of the respiratory system of E.coli is influenced by the formation of metabolites. The presence of metabolites, like acetate, will probably decrease the internal pH of the cell, likewise to what Salmond et al. (1984) observed (17). Therefore, the redox state will be altered, which is shown to influence ArcB activity(5). Metabolites like D-lactate, acetate and pyruvate have proven to enhance ArcB autofosforylation (18). Additionally, it is said that these metabolites act as sensors for the ArcB histidine kinase. For D-lactate it is shown that it functions as an allosteric effector which accelerates ArcB activity (19).
This research focuses on the regulation of the ArcBA system in E.coli under glucose limited conditions. The activation of this system is being researched by growth of E.coli strains in batch fermentor cultures for a decreasing air level, as described in Chapter 1. Additionally, batch cultures of wild type E.coli are grown under stress with fermentation products, in order to research the regulation of ArcBA under these conditions and at the same time the formation of metabolites (Chapter 2). Finally, it was attempted to synthesize an E.coli mutant strain which only produces menaquinone, in order to find to which extend this quinone is regulation the ArcBA activity. The cloning experiment is described in Chapter 3, which is followed by a general conclusion on this research.
8
Chapter 1: Batch fermentor cultures
Aim
This research aimed to show how the quinone pool regulates the ArcBA activity in E. coli, in order to proof the hypothesis that reduced quinones activate the ArcBA system for measuring the oxygen availability. It is being researched whether dimethylmenaquinone (DMK) is also able to activate ArcB kinase, as is suggested in the work by Sharma et al., 2013 (5). This hypothesis is tested by cultures of E. coli strains grown in batch fermentors in exponential growth under glucose limited conditions. For decreasing oxygen levels, at time intervals of 30 minutes, the ArcA activity is measured along with the composition of the quinone pool. Additionally, the composition of the metabolites formed, the growth rate and the dry weight content were measured for cell growth analysis.
Experimental methods
In a 2 L fermentor (Applikon biotechnology: Delft, Netherlands) E. coli strains were grown with a
constant dilution rate of 0.2 L h-1 of Evans medium (20). To this medium 20 µL selenite (30 mg mL-1),
1 mL thiamine (0.3 g mL-1) and silicone antifoam (0.5 mL) were added. Glucose was added as a
carbon source at a final concentration of 20 mM. The cells were grown in 1 L medium under stirring
with 600 rpm, a temperature of 37 °C and an oxygen supply of 0,500 L min-1. The pH was set at a
value of 6.9 by titration with 4 M NaOH. For the experiments cells were grown in exponential phase by addition of extra glucose (final concentration 50 mM). Samples were taken every 20 minutes of
the metabolites and OD600. After approximately 2 hours, when the exponential state was reached,
samples were taken while every 30 minutes the air supply decreased with 20 %. Aerobiosis is determined according to Alexeeva et al. (2002) by setting the standard of 100% aerobiosis equal to
an O2 level of 20,95% (21). Samples were taken for OD600, metabolites, ArcA activity, quantity of
quinones and dry weight content.
OD600 The growth rate of the strains was calculated on basis of the OD600, according to Monod (22).
This is the optical density of the culture at a wavelength of 600 nm by use of spectro-photometric apparatus (Lightwave II; Isogen: De Meern, Netherlands).
Metabolites Next, analysis of the metabolic fluxes is done by HPLC Triathlon with an organic acid
column (Phenomex, Torrance, CA, USA) with 7,2 mM H2SO4 and a temperature of 45°C. Data was
obtained by Azur software (St. Martin D’Heres, France). Sample preparation is done by addition of 100 µL of 35% perchloric acid to 1 mL sample and after mixing putting this on ice for 10 minutes. Afterwards, 55 µL of 7M potassium hydroxide was added and vortexed thoroughly. The samples were centrifuged at 15000 rpm for 3 minutes and the supernatant was filtered by a 0.45 µm syringe filter into HPLC sample bottles.
ArcA activity ArcA activity was measured by its fosforylation level by using Phos-Tag®- acrylamide gel
electrophoresis and subsequent Western blotting, similar to the method described by Rolfe et al., 2011 (23) . Culture samples (1 mL) were added to formic acid (final concentration 1 M) and stored for no more than 7 days at -20°C. Sample preparation for SDS-PAGE electrophoresis is done in order to
dilute to OD600 of 2.5: by addition of 61,5% 1 M formic acid; 33 % 3x protein loading dye; 5.5 % 10M
NaOH. SDS-PAGE electrophoresis is done for 15 min. (50 V: stacking phase); 40 min. (100 V); 50 min. (150 V). Thereafter, the gel was washed two times in transfer buffer with and without EDTA (1 mM)
9
for 15 min. Overnight running of the gel occurred at 20V and maximum current and subsequently the gel is developed by Western blotting as described earlier (4). Therefore, a rabbit antibody for ArcA was used and subsequently the second antibody was Goat Anti-Rabbit Peroxidase (GARPO). Quantification of ArcA protein was done by using Odyssey Fc luminescence detection with Image Studio version 1.1. software (Li-Cor, Lincoln, NE, USA). The size of the lower band is determined at 28 kD for unfosforylated ArcA and the upper band is equal to 35 kD for fosforylated ArcA (5).
Quinones Quantification of quinones was done comparable to Sharma et al., 2012 (24). Samples of 2
mL were put in 10 mL of degassed quenching solution (120 mL petroleum ether; 120 mL methanol; 55 mL acetic acid; 15 mL hexanol). The samples were kept cold and in the dark. Immediately following this, the solution was vortexed for 1 minute and subsequently centrifuged (1 min.; 2000 rpm; 4°C). Afterwards, the upper petroleum ether layer phase was concentrated by transferring the
layer to a test tube. The petroleum ether was evaporated under N2 gas and the dry extracts could be
stored at -20°C for at least 7 days while the content remains stable. For analysis, sample preparation is done by resuspension of the sample in approximately 10 drops (~1 µL) of 1-hexanol just before measuring. The measurements are done with the same apparatus as described earlier (24).
Dry weight content Dry weight content was measured by sampling 10 mL of medium and
subsequently centrifuged this for 10 min., 4000 rpm, 10°C. The supernatant was removed afterwards and the pellet was dried in a 90°C stove for at least 1 day. The mass of the dry pellet was weighted and recalculated for the volume of the batch.
These batch fermentor experiments are done for E. coli strains given in table 1.
Table 1: Strains of E.coli used in batch fermentor experiments with the known quinones which are present, as found in earlier research (see the references).
Strain Quinones present Reference
MG1655 UQ, DMK, MK For example: Bekker et al., 2010 (4)
AV33 DMK and MK Sharma et al., 2013 (5)
AV36 DMK Sharma et al., 2013 (5)
Results
Growth rate
The growth rate of the E. coli strains is determined by OD600, see figure 4 for the growth curves of the
different batch fermentor cultures. In addition, from the data in figure 4 the growth rate of cells is
assumed to be a linear correlation of OD600 and dry weight: 0,37 ± 0,09 (g/L). This means that dry
weight content (whenever no data was available) in this research is corrected by the formula of
0,37*OD600. In this research, all concentrations are given for mmoles/gram dry weight: for which the
10
Figure 4: Growth curves of batch fermentor cultures as OD600 (log absorption at λ=600 nm; vertical axis) versus time
(min.; horizontal axis). The name, date and series of batch fermentor culture for each growth curve are given in the legend.
Metabolites
For all three strains the product formation rate was determined over time, see appendix 1C for the formation rate per experiment run. The average product formation rate is determined for acetate, formate, lactate and ethanol and given in table 2.
Table 2: Average product formation rate for E.coli batch fermentor (batch) cultures of strains MG1655, AV33 and AV36. The rate is given with standard deviation (±).
Acetate (mmoles gr-1 hr-1 ) Formate (mmoles gr-1 hr-1 ) Lactate (mmoles gr-1 hr-1 ) Ethanol (mmoles gr-1 hr-1 )
Average MG1655 7,29 ± 3,37 2,30 ± 1,20 Not detected -0,19 ± 0,22
Average AV33 0,23 ± 0,08 0,64 ± 0,07 1,08 ± 0,88 0,33 ± 0,01
Average AV36 -0,07 ± 0,47 0,20 ± 0,16 0,10 ± 0,91 0,27 ± 0,68
Additionally, in appendix 1A and 1B the results of the metabolic concentrations over time are given for two experiments (in duplicate) with the E.coli wild type strain MG1655 and the two biological duplicates of AV33. The results of the average metabolic concentrations (as mmoles per gram dry weight) for the three chemostat cultures with AV36 are represented here in figure 5.
1 10 0 50 100 150 200 250 300 350 lo g ab sor p tion at λ = 600 n m ( -) time (min) MG1655 series 1 MG1655 series 2 MG1655 series 3 MG1655 series 4 AV36 series 1 AV36 series 2 AV36 series 3 AV33 series 1 AV33 series 2
11
The increase in glucose concentration (at t= 100 min.) is due to an external addition of 50 mM of glucose to the medium, because the pH decreased due to the formation of fermentation products such as ethanol (see discussion).
Quinones
The quinone pool was analysed by HPLC and detection of the quinones occurred for the napthaquinones (MK and DMK) at 248 nm and for ubiquinone (UQ) at 290 nm (5). Reduced naphtaquinones were detected by fluorescence (excitation wavelength: 238 nm; emission wavelength 425 nm). In appendix 2A the retention time of the quinones and a representative picture of the detected quinones is given. Appendix 2B shows the composition of quinones for MG1655 over time.
Figure 6, 7 and 8 show the quinone concentrations (in mmoles per gram dry weight) during decreasing aerobiosis for AV33 (DMK & MK producing) and AV36 (DMK only producing). Quinone sampling of batch fermentor with AV33 occurred with no degassed quenching solution, so no reduced forms of DMK and MK are detected. For AV36 batch fermentors also an unknown compound is detected at retention time of ~8,1 min. (assigned DMKH2), but only DMK concentrations are given in figure 6 (see discussion).
Figure 6: DMK concentrations in mmoles per gram dry weight, given at different aerobiosis levels (in %) for two biological replicates of batch fermentor cultures of E.coli AV33.
0,0 2,0 4,0 6,0 8,0 0 100 200 c o n ce n tr ation (m m o le s/gr am ) time (min) Ethanol Acetate Lactate Formate 0,00 0,10 0,20 0,30 0,40 0,50 0,60 0,70 0,80 100% 80% 60% 40% 20% 0% 100% co n ce n tr ation (m m o le s/gr ) aerobiosis (%) DMK series 1 DMK series 2 0,0 5,0 10,0 15,0 20,0 25,0 30,0 0 100 200 c o n ce n tr ation (m m o le s/gr am ) time (min) Glucose
Figure 5: Metabolic concentrations (in mmoles per gram) over time (in minutes) given for the average of three biological replicates of batch fermentor cultures of E.coli AV36: left pictures shows the glucose concentration, right picture shows the concentration of metabolites (ethanol, acetate, lactate, formate).
12
Figure 7: MK concentrations in mmoles per gram dry weight, given at different aerobiosis levels (in %) for two biological replicates of batch fermentor cultures of E.coli AV33.
Figure 8: DMK concentrations in mmoles per gram dry weight given at different aerobiosis levels (in %) for three biological replicates of batch fermentor cultures of E.coli AV36.
ArcA activity
In table 3 the detected fosforylated ArcA is given for the batch fermentor cultures of MG1655, AV33 and AV36.
Table 3: The percentage of ArcA – fosforylation is given for each strain per % of air level as detected by ImageStudio version 1.1 software (see experimental procedures).
Average ArcA – P (%) Strains 100% 80% 60% 40% 20% 0% 100% MG1655 No data AV33 0,0 0,0 0,0 0,0 0,0 0,0 0,0 AV36 0,0 0,0 0,0 0,0 24,1 ± 41,7 74,4 ± 7,1 0,0 0 0,005 0,01 0,015 0,02 0,025 0,03 0,035 100% 80% 60% 40% 20% 0% 100% co n ce n tr ation (m m o le s/gr ) aerobiosis (%) MK series 1 MK series 2 0 0,5 1 1,5 2 2,5 3 3,5 4 100% 80% 60% 40% 20% 0% 100% co n ce n tr ation (m m o le s/g) aerobiosis (%) 20140417 series 1 20140417 series 2 20140430 series 1
13
In figure 8 fosforylated and un-fosforylated ArcA is shown on a Phos-Tag® gel, from the samples of AV36 (20% and 0% air level, respectively). In appendix 3 the pictures of the Phos-Tag® gels of AV33 and AV36 are given.
Figure 8: A picture of the Phos-Tag® gel of with left the fosforylated ArcA and the un- fosforylated ArcA at the right, which are samples from the batch fermentor culture of E.coli AV36 at 20% and 0% air level; quantification of the bands is given in table 3.
Discussion
Growth Rate & Metabolites
Growth has occurred in batch fermentor cultures in order to select cells which are ‘batch fermentor-like’ or K-strategist, as described by Flegr (1997) (25) . This means that under conditions of a limiting resource, such as glucose, the K-strategists show optimal adaptation and invest all their effort in the production of lesser offspring, with a higher survival rate. The growth curve of wild type E.coli is rather steep which suggests a high dilution rate of the cultures (see figure 4). This is comparable to values of growth rate described in earlier research (5). When also taken appendix 1A into account, which shows for MG1655 the metabolic concentration over time, it seems that the cultures have switched to fermentation metabolic mode. This becomes clear from the depleting glucose concentration during the experiment, and subsequent amount of ethanol and formate that is formed. The fermentation mode, according to Trotter et al. (2011) is characterized by a redox balance which is maintained by metabolites, such as ethanol and formate (3). In this case the redox pool of the quinones does not regulate the redox balance and subsequently ArcBA. Within the scope of this research, the results of these batch fermentor cultures are therefore not of interest. For future research, one should aim to reduce the growth levels of E.coli MG1655 under these conditions.
When looking at table 2 of the metabolic production rates, it is noticeable that an increasing amount of acetate is formed by reduced oxygen level (see also figure 5). This is attributable to the inverse
linear correlation of O2 level and fermentation production of acetate (26). Thus, for 100% anaerobic
conditions the formation rate of acetate will be highest, which is not reflected in the average formation rates but is visible in the concentration fluxes over time (figure 5; appendix 1A en 1B). Some metabolic production rates have negative values which are attributable to the difference in metabolic concentration over time. For example, ethanol formation decreased due to the addition of additional glucose (figure 5) which is shown in a negative value. Furthermore, the product rates show large standard deviations, which thereby reduce the reliability of the values. This is due to variation in growth conditions in the biological replicates: for example to some cultures additional glucose was added, when the cells switch to fermentative mode, e.g. for one AV36 experiment at t = 40 min. (figure 5).
14
In general, it appears that the metabolic production formation rates are rather low, see table 2, when comparing these values to literature (24, 26). However, these values are given for continuous cultures at steady-state so not fully comparable. The overall trend in increase of acetate, formate, lactate and ethanol to a decreasing level of aerobiosis is similar: with increasing aerobiosis the formation rates of these by-products decreased (26). For batch fermentor wild type cultures no lactate was detected, this is probably because lactate formation only occurs under conditions of glucose excess (26). For MG1655 it is very likely that glucose was never in excess, because the glucose concentration was quickly depleting, due to its high growth rate.
Quinones
Quinones were detected on reverse-phase HPLC and Azur software assigned peak of 8,1 min. to reduced DMK (DMKH2) (see appendix 2A). However, upon reducing DMK peaks were detected at retention times of 8,1 and 14 min. (Van Beilen, unpublished). Therefore, it is suggested that the detected quinone is not DMKH2, but a fourth quinone DDMQ which is an intermediate in the biosynthesis of UQ (27, 28). Further research should elucidate the distinction between DMKH2 and DDMQ.
The quinone pool composition of MG1655 is given in appendix 2A. From this it can be generally noted, even in fermentative metabolic mode, that the concentration of UQ is much higher than DMK and MK, which is in agreement with Bekker et al., 2007 (7). Furthermore, the quinone pool of AV33 and AV36 (figure 6, 7 & 8) shows a higher concentration (mmoles per gram) of DMK for the DMK only producing strain (AV36). Also, the concentration of MK increases over decreasing oxygen level, both observations are in agreement with data presented earlier (5). On the contrary, MK does not appear to be the most abundant quinone under anaerobic conditions as mentioned in Bekker et al. (2010) (4). One explanation for this could be that detection is limited by the low levels of MK produced.
Due to the high auto-oxidation rate of the quinones no reduced and oxidized forms were detected. Only for the wild type strain reduced UQ is observed (appendix 2B), but the AV36 culture does not observe any reduced DMK, as mentioned earlier. However, as mentioned by Sharma et al. (2013) the redox state of the quinone pool is essential to differentiate because it could verify the hypothesis as mentioned above that oxidized DMK is able to activate ArcBA(5). Therefore, for future research auto-oxidation should be counteracted.
ArcA activity
Due to technical difficulties no data could be obtained on ArcA fosforylation of strain MG1655, see table 3. Difficulties included too fast running of the gel, too high concentration of Phos-Tag® and no sufficient polymerization of the acrylamide. Furthermore, the data obtained for strain AV33, i.e. zero detection of ArcA fosforylation, might not be correct when comparing to earlier research (5). No separation of the two representative bands is observed, which might be caused by too fast running of the gel (see appendix 3). However, it appears that the procedure as described in experimental procedures obtains sufficient separation of bands, which is shown for strain AV36 (table 3).
The results show that E.coli strain AV36 has ArcA activity at 0% air level (anaerobic conditions), and one biological replicate show fosforylated ArcA at 20% air level. However, this last result might not be so valuable looking at the bands (see appendix 3: AV36 series 1).
15
It is very possible that the sample of 0% air level is leaked into the well of the sample of 20% air level (the wells are next to each other), in addition to an unclear view of the first 5 samples. Taking into account that for the other two biological replicates no ArcA activity is observed, this sample is not regarded valid. However, in all three biological replicates fosforylated ArcA activity is observed at 0% air level (table 3). This means that under anaerobic conditions, DMK is able to activate ArcBA. This result is in agreement with the observation in batch cultures done by Sharma et al.(2013): DMK is able to regulate ArcB kinase activity, just as UQ does (5). Likewise, Alvarez et al. (2013) suggest that DMK by its redox potential could play a role in disulfide bond formation and decreasing of ArcB kinase activity upon a shift from anaerobic to aerobic growth (29). This research shows that under similar conditions but in opposite directions, i.e. a shift from aerobic towards anaerobic conditions, DMK is also able to regulate ArcBA activity.
16
Chapter 2: Batch cultures
Aim
As mentioned in the introduction, the metabolic modes of E.coli produce the so-called overflow metabolites, such as acetate, ethanol and formate. It is previously reported that the presence of such metabolites, like D-lactate, acetate and pyruvate, accelerate autofosforylation of ArcB and assist in regulating ArcA activity (18). It is suggested that an additional form of regulation of ArcBA is exerted by such fermentation products (19). In this research, it is looked into how the growth rate of E. coli wild type batch cultures is influenced by the addition of these fermentation products. Additionally, information will be obtained on the composition of the metabolites that are being formed under glucose limited conditions, and if this metabolite composition regulates ArcBA.
Experimental methods
Bacterial strains were grown in Erlenmeyer flasks of 100 mL for sufficient aeration at 37°C while shaking (200 rpm). This was done with a 5 mL of overnight culture in lysogeny broth (LB) medium (30) with 50 mM glucose, added to 20 mL Evans medium at pH 6.5 and another 50 mM of glucose. This culture was diluted two times to an optical density of 0.2 in 10 mL Evans with extra 50 mM of glucose. At the start of the experiment the culture was divided in 6 Erlenmeyer flasks and the following acids were added to a final concentration of 50 mM: see table 1. After addition of the acids,
the OD600 was measured and samples for metabolites (1 mL) and ArcA activity (1 mL in 200 µL of 6 M
formic acid) were taken and stored at -20°C. This was again repeated after one hour. Metabolites and ArcA activity identification occurred according to the protocol described in Chapter 1.
Table 4: Used fermentation products with their assigned numbers for acid stress experiment with E. coli MG1655 batch cultures. # Added compound 1 Formic acid 2 Lactic acid 3 Acetic acid 4 Ethanol 5 Sorbic acid
6 Negative control (no acid)
Results
No ArcA activity is measured for both batch cultures (see discussion). The average growth curve
17
Figure 9: The average growth curve of two series of batch cultures given as OD600 (absorption at λ=600 nm; vertical axis)
versus time (min.; horizontal axis). In the legend the added compounds (at 50 mM concentration) and negative control are described.
The metabolites are also measured: the concentration of glucose is given in appendix 4 and figure 10 gives an overview of the detected metabolites for each Erlenmeyer flask.
0,2 0,25 0,3 0,35 0,4 0,45 0,5 0 20 40 60 80
ab
sorp
tion
a
t
λ
=
60
0
n
m
(-)
time (min) Formic acid Lactic acid Acetic acid Ethanol Sorbic acidNegative control (no acid) 0 5 10 5 70 co n ce n tr ation (m m o le s/gr ) time (min)
Formic acid
Ethanol Formate 0 2 4 5 70 co cn e n tr ation (m m o le s/gr ) time (min)Lactic acid
Lactate 3 3,2 3,4 3,6 5 70 co n ce n tr ation (m m o le s/gr ) time (min)Acetic acid
Acetate 0 2 4 5 70 co n ce n tr ation (m m o le s/gr ) time (min)Ethanol
Acetate Ethanol 0 0,05 0,1 5 70 co n ce n tr ation (m m o le s/gr ) time (min)Sorbic acid
AcetateFigure 10: Metabolic concentrations (in mmoles/gram) at t = 5 and t = 70 min, given as average of two biological replicates of batch cultures of E.coli strain MG1655. Each diagram shows the metabolites detected in the culture under stress of fermentation product, i.e. formic acid, lactic acid, acetic acid, ethanol and sorbic acid, over time.
18
Discussion
From two biological replicates the average growth curve was obtained (figure 9). It shows that the growth rate of E.coli wild type is not influenced by addition of ethanol or formic acid, because it
shows an increase in cell density (OD600), similar to what is observed when no stress is applied, i.e.
the negative control. This result is as expected because ethanol and formate are also formed during exponential growth conditions, for which also no reduced growth is observed (compare to appendix 1A). For sorbic acid it is known that the growth rate of E.coli is inhibited (17), which is accordingly to the results observed. Surprisingly, for the second experiment degraded sorbic acid was used: after 14 days it showed a decoloured (brown) solution, which is probably caused by fast auto-oxidation of sorbic acid (31). So either sufficient non-degraded sorbic acid was present or the carbonyls formed in degraded sorbic acid also inhibit bacterial growth.
Upon measuring the metabolic composition of the five samples, the outcome seems rather straightforward: under addition of lactic acid, lactate is detected and so forth (figure 10). However, under addition of sorbic acid and ethanol also a small amount of acetate is observed. Increased acetate formation might be attributable to a decreasing oxygen level, for which acetate formation is known (3). During batch growth in Erlenmeyer flasks the air level is limited and therefore, the air level decreases somewhat during growth. Additionally, is it detected that significant amount of ethanol (at a concentration of >5 mmoles/gram dry weight) is formed when formic acid is added to the culture. This observation suggests that the culture has switched towards the fermentative metabolic pathway (3). This suggestion is in agreement with a small decrease in concentration of glucose (mmoles/gram dry weight), as is shown in appendix 4.
Unfortunately, no ArcA activity is detected due to technical difficulties as already mentioned in Chapter 1. It was expected that under stress conditions with lactate and acetate ArcBA would be activated, in accordance with Georgellis, Kwon and Lin (1999) (18). In the future, this experiment could be extended by optimizing of measuring ArcA activity (see Chapter 1). Additionally, aerobic batch cultures could be measured over a longer period of time when the glucose concentration becomes increasing limiting.
19
Chapter 3: Mutant strain
Aim
Finally, part of this research was aimed on obtaining an E. coli strain that only produced MK. This is done in order to find out what the role of MK is in ArcBA regulation. It is shown that DMK is an intermediate of MK synthesis (32), which makes it is impossible to engineer a knock-out mutant in order to produce only MK. Therefore, this research aimed at over expression of the gene that is responsible for the MK synthesis pathway. Earlier research suggested over expression of the gene UbiE, which is the gene responsible for the conversion of DMK to MK (5). An analogous gene is menH which encodes for the essential MK methyltransferase in Bacillus subtilis (B.su) (33).
In this research cloning is attempted at two methods: over expression of UbiE using E.coli wild type genomic DNA (gDNA) as a plasmid, and over expression of MenH with Bacillus subtilis gDNA. Such over expression is done by homologous recombination by the method according to Lee et al., 2009 (34).
Experimental methods
Genetic modification is done by gene doctoring according to Lee et al., 2009 (34). In order to engineer a MK producing strain, pDOC-KYP (including a kanamycine resistance cassette) is used as a plasmid. On this plasmid two cloning regions are located, see figure 11.
The bacterial strains and plasmids that are used for genetic modification are given in table 5.
Table 5 * Cp = chloramphenicol resistance Ap = ampicillin
Km = kanamycin Ph = phleomycin
Description * Reference
E.coli strains
MC1061 Cloning host Bekker et al., 2010 (4)
MG1655 Wild type K-12 For example Sharma et al., 2013 (5)
Donor plasmids
pDOC-KYP sacB (B.su); ApR; KmR Van Beilen, unpublished.
pDG148 Pspac-MCS; ApR; PhR; KmR Van Beilen, 2013(35)
pACBSCE I-SceI; λ-Red; CpR Lee et al., 2009(34)
gDNA B. subtilis gDNA MG1655 (E.coli)
Figure 11: Adjusted image from Lee et al., 2011 of plasmid pDOC-K with two cloning regions (CR), a kanamycine resistance cassette (KanR) and Flp1 and Flp2 recognition sites (34)
20
Cloning was attempted by amplification of genes by PCR, followed by fusion, digestion, ligation and ultimately transformation to competent E. coli strain. The strains were grown in LB medium overnight at 37°C and 200 rpm. To the medium the required antibiotics (see table 1) were added in the following final concentrations: 50 µg/mL kanamycin; 200 µg/mL ampicillin; 35 µg/mL chloramphenicol, similar to Lee et al., 2009 (34).
Genetic modification was done as following, and all primer sequences and annealing temperatures are given in table 3: Firstly Para-menH (Bacillus subtilis) was transformed to E. coli MC1061. This was done by amplification of Para with Para_FW and Para_RV with pACBSCE as template, next to amplification of menH with menH_FW and menH_RV and gDNA of Bacillus subtilis as template. All enzymes were used according to the manufactures instructions: see appendix 5 for the used PCR conditions and reaction composition. Afterwards the PCR products were cleaned with MSB® Spin PCRapace (Stratec, Germany). MenH was extended by rePCR by using Postpara_FW and menH_RV primers. The product was also cleaned and subsequently fused the extended menH and Para by PCR;
first 5 cycli without primers (Tann is 55°C) and then 35 cycli with the primers PostPara_FW and
menH_RV (Tann is 51°C). Both ParaMenH and pDOC-KYP were digested by NheI and EcoRI restriction
enzymes (ParaMenH) and EcoRI (for 30’); AvrII and BamHI subsequently (for 15’). All digestion reactions are at water bath of 37 °C under stirring (100 rpm). Composition of digestion reactions is given in appendix 5. The digested DNA was cleaned and used for ligation reaction for 0.5 h at room temperature and 1 h at 37°C (for composition see appendix 5). Afterwards, it was attempted to transform ParaMenH to electric competent E.coli MC1061 by heat shock transformation, following Lee et al., 2009 (34).
Secondly, Pspac-ubiE was attempted to clone likewise. Pspac was amplified with Pspac_FW and Pspac_RV with pDG148 as template and ubiE was amplified with ubiE_FW and ubiE_RV and E.coli MG1655 gDNA. Both fragments were cleaned and digested with AvrII for 30’. These fragments were
cleaned, ligated and another PCR done with primers Pspac_FW and ubiE_RV (Tann is 61°C). After
another clean-up the fragments were digested with HindIII and BamHI for 35’. The products were cleaned-up, ligated and transformed to competent E.coli MC1061 as described previously. The cells were grown overnight on LB plates with 50 µg/mL kanamycin; 35 µg/mL chloramphenicol; 50 mM glucose. Thereafter, colony PCR was done according to the protocol in appendix 5, with annealing temperatures of 58°C (PspacUbiE) and 51°C (ParaMenH); for 30 cycli of 2’.
Plasmids were isolated using a QIAprep Spin MiniPrep Kit (Qiagen, Netherlands). The nucleotide sequens (table 6) are previously verified by sequencing (Van Beilen, unpublished). Concentrations of clean up products are determined by concentration measurement (Nanodrop, ND-1000 spectrophotometer, Isogen life sciences, Netherlands).
21
Table 6: The primers used for cloning are given with the associated annealing temperature for PCR.
Results
For the cloning of the mutant strain of E.coli which only forms MK genes were amplified as written in the experimental procedures. In table 7 the number of base pairs of the amplified genes is given (Van Beilen; unpublished). The results of the fusion after amplification of the genes is given in figure 12 for ParaMenH and in figure 13 for PspacUbiE. Figure 14 shows a DNA marker (1 kb GeneRuler®).
Table 7: Name of gene with number of base pairs (Van Beilen, unpublished)
Name primer Sequence (5’-3’) Remarks Tann(°C)
Para_FW AATGGGCTAGCacttttcatactc Amplify the Para from
pACBSCE
55
Para_RV CCTGCTTCCTCCTTACTAGTCCAAAAAAACGGGTATG Amplify the Para from
pACBSCE
PostPara_FW gtttttttggactagtaaggaggaagcaggtATG Cloning any gene after Para 51
menH_FW ggaggaagcaggtATGCAGGACTCAAAAGAACAGCG Amplify MenH (Bsu) 51
menH_RV caagaattcTCATTTCCATCCGATATG Amplify MenH (Bsu)
Pspac_FW cccAAGCTTACACAGCCCAGTCCAG Amplify the promoter region 65
PspacMCS_RV CTATTCCCCGGGGTCGACGGATCCGAATT CCTAGGAATTGTTATCCGCTCACAATTCC
Amplify the promoter region
ubiE_FW CGCAcctaggAAGGAGGAAGCAGGTATGGTGGAT
AAGTCACAAGAAAC
Amplify the ubiE from MG1655
55
ubiE_RV CGCGGATCCCGTCACTAAAGGTTTAAAAGGC Amplify the ubiE from
MG1655 Base pairs Para 357 MenH 702 UbiE 756 Pspac 256
Figure 12: left DNA marker, right ParaMenH
Figure 13: left DNA marker, right Pspac-UbiE
Figure 14: DNA marker GeneRuler ® (1 kb) Number of base pairs right for each corresponding band
22
Both ParaMenH and PspacUbiE were transformed once to competent E.coli MC1061 cells and grown overnight on LB plates. The cells with ParaMenH showed one colony for which a colony PCR is done, see figure 15. Furthermore, on plates with MC1061 with PspacUbiE four colonies had grown and the result of the colony PCR is shown in figure 16. After plasmid isolation of ParaMenH transformed to MC1061 from an overnight plate colony, the concentration of the plasmid was 16,9 ng/µL.
Discussion
Thus far the synthesis of an E.coli mutant strain, with an over expression of either ParaMenH or PspacUbiE which aims to provide a MK producing strain, is not successful. As shown in the results, the fusion of genes did seem successful. However, the fusion of PspacUbiE showed also smaller bands (at ~250 bp, 500 bp, and 750 bp) when only one band at 1012 bp was expected. This might be attributable to the used reverse primer (Pspac_RV): this primer has no restriction site for AvrII restriction enzyme. Therefore, it is suggested to use another reverse primer (PspacMCS: multiple cloning site) (van Beilen, unpublished). Because of this unsuccessful fusion, the transformation of PspacUbiE to competent MC1061 has not worked yet, which is also visible in the results of figure 16. The fusion of ParaMenH seemed successful because one band that was obtained appears to be the right number of base pairs. This band (with some other smaller bands) is also visible in figure 15 of the colony PCR. However, because only one colony was grown overnight it seems that the transformation has failed. After plasmid isolation the yield was too low (16,9 ng/µL) in order to continue, e.g. by transformation to competent E.coli wild type cells.
Figure 15: from left to right - DNA marker, colony MC1061 with ParaMenH, positive control (ParaMenH),
negative control (pDOC-KYP).
Figure 16: from left to right - DNA marker, five colonies MC1061 with Pspac-UbiE, negative control (pDOC-KYP).
23
In this research cloning is attempted as suggested by earlier research, by over expression of UbiE (5). Other research such as Kong and Lee (2011) shows that it is possible by synthetic biology to increase MK concentration in E.coli strains up to a five-fold compared to wild type (2). But the research showed that also DMK concentrations increased, which is not aimed for in this research. Additionally, it is mentioned that UbiE gene is also involved in ubiquinone synthesis thus over expression of this gene, will most likely lead into a E.coli strain which produced both MK and UQ producing strain (27, 32). Therefore, the use of the menH gene from B.su might be a better alternative. This gene is known to play a role in the biosynthesis of dimethylmenaquinone to menaquinone, but there is no competition with ubiquinone synthesis, as in E.coli (33). It should be attempted to improve the cloning scheme as described in this research by optimizing annealing temperatures of PCR and different use of primers as suggested earlier.
24
Conclusion
This research aimed to show how the size and the redox state of the quinone pool influences the regulation of the metabolic pathway of E.coli. This research is build up in three different chapters in which different experiments are described that all contribute to main aim of this research.
Chapter 1 showed the results of batch fermentor E.coli cultures under glucose-limited conditions for a decreasing air level. The cultures are grown in exponential state which is reflected in the composition of metabolites over time. It was found that under these conditions the wild type E.coli switches to a fermentative mode. Additionally, cultures of AV33 (a strain that produces both naphtaquinones: DMK & MK) show significant amount of DMK production, and a lower amount of MK. For strain AV36 (DMK only producing) ArcA activity is observed under anaerobic conditions. This is in agreement with results of Sharma et al., 2013: both DMK and UQ are able to regulate ArcB kinase activity (5). Furthermore, for this strain a fourth quinone might be detected but further research is needed to confirm that hypothesis. In future work one should aim to distinguish between the both redox states of DMK in order to elucidate more on the regulation of ArcBA by the quinone pool of the respiratory system of E.coli.
In Chapter 2 the results are given for batch cultures of the wild type E.coli strain under stress of fermentation products. This experiment showed that the growth rate is inhibited by the addition of sorbic acid (in agreement with Salmond et al., 1984 (17)) and lactic acid. In the case of formic acid it appears the organisms have switched to the fermentative mode, as described in Trotter et al., 2011 (3). Unfortunately, no ArcA activity is measured which was aimed for in this experiment. In order to proof the hypothesis that fermentation products influence the autofosforylation of ArcB, valuable measurements of ArcA activity are needed. This research could attribute to the knowledge of the (additional) regulation of ArcBA by metabolites (18, 19).
Finally, in Chapter 3 it is described how it was attempted to create a mutant strain of E.coli which only produces MK. It showed that over expression of the genes PspacUbiE and ParaMenH by transformation to competent E.coli cells has not been successful thus far. Plasmid extraction of overnight plate colonies and subsequent colony PCR showed no satisfactory results. Therefore, further research is needed to optimize this cloning scheme as described in the experimental procedures. A MK only producing strain is needed in order to elucidate on the regulation of ArcBA by the menaquinone pool, which was suggested in earlier research (4, 5, 7).
In conclusion, this research aimed to give insight in the regulation of ArcBA sensory system which functions as a regulator for metabolic pathways as a result of oxygen level. Most importantly, it has shown unambiguously that DMK is able to regulate ArcB kinase activity under anaerobic conditions. This result contributes to knowledge of the respiratory system of E.coli and thereby it adds to a better understanding of the physiology of the organism. Physiological analysis is, among others, necessary for the creation of modified organisms for the production of useful (synthetic) biological purposes, for example by production of metabolites as a bio-fuel or vitamin K (MK-8) (2, 5).
25
References
1. Trinh CT. 2012. Elucidating and reprogramming Escherichia coli metabolisms for obligate
anaerobic n-butanol and isobutanol production. Appl. Microbiol. Biotechnol. 95:1083–94. 2. Kong MK, Lee PC. 2011. Metabolic engineering of menaquinone-8 pathway of Escherichia coli
as a microbial platform for vitamin K production. Biotechnol. Bioeng. 108:1997–2002. 3. Trotter EW, Rolfe MD, Hounslow AM, Craven CJ, Williamson MP, Sanguinetti G, Poole RK,
Green J. 2011. Reprogramming of Escherichia coli K-12 metabolism during the initial phase of
transition from an anaerobic to a micro-aerobic environment. PLoS One 6:e25501. 4. Bekker M, Alexeeva S, Laan W, Sawers G, Teixeira de Mattos J, Hellingwerf K. 2010. The
ArcBA two-component system of Escherichia coli is regulated by the redox state of both the ubiquinone and the menaquinone pool. J. Bacteriol. 192:746–54.
5. Sharma P, Stagge S, Bekker M, Bettenbrock K, Hellingwerf KJ. 2013. Kinase Activity of ArcB
from Escherichia coli Is Subject to Regulation by Both Ubiquinone and Demethylmenaquinone. PLoS One 8:e75412.
6. Sadava DE, Hillis DM, Heller HC, Berenbaum M. 2011. Life. The Science of Biology10th editi.
W.H.Freeman.
7. Bekker M, Kramer G, Hartog AF, Wagner MJ, De Koster CG, Hellingwerf KJ, Teixeira de Mattos MJ. 2007. Changes in the redox state and composition of the quinone pool of
Escherichia coli during aerobic batch-culture growth. Microbiology 153:1974–1980.
8. Moran LA, Horton HR, Scrimgeour KG, Perry MD. 2012. Principles of BiochemistryFifth Edit.
Pearson.
9. Tran QH, Unden G. 1998. Changes in the proton potential and the cellular energetics of
Escherichia coli during growth by aerobic and anaerobic respiration or by fermentation. Eur. J. Biochem. 251:538–43.
10. Kroger A, Dadak V, Klingenberg M, Diemer F. 1971. On the Role of Quinones in Bacterial
Electron Transport. Differential Roles of Ubiquinone and Menaquinone in Proteus rettgeri. Eur. J. Biochem. 21:322–333.
11. Kroger A, Dadak V. 1969. On the Role of Quinones in Bacterial Electron Transport. The
Respiratory System of Bacillus megaterium. Eur. J. Biochem. 11:328–340.
12. Mitchell P. 1961. Coupling of Phosphorylation to Electron and Hydrogen Transfer by a
Chemi-Osmotic type of Mechanism. Nature 191:144–148.
13. Alexeeva S, de Kort B, Sawers G, Hellingwerf KJ, de Mattos MJ. 2000. Effects of limited
aeration and of the ArcAB system on intermediary pyruvate catabolism in Escherichia coli. J. Bacteriol. 182:4934–4940.
14. Georgellis D, Kwon O, Lin ECC, Wong M, Akerley BJ, Wong SM. 2001. Redox Signal
Transduction by the ArcB Sensor Kinase of Haemophilus influenzae Lacking the PAS Domain. J. Bacteriol. 183:7206–7212.
26
15. Holländer R. 1976. Correlation of the function of demethylmenaquinone in bacterial electron
transport with its redox potential. FEBS Lett. 72:98–100.
16. Malpica R, Franco B, Rodriguez C, Kwon O, Georgellis D. 2004. Identification of a
quinone-sensitive redox switch in the ArcB sensor kinase. Proc. Natl. Acad. Sci. U. S. A. 101:13318–23.
17. Salmond CV, Kroll RG, Booth IR. 1984. The Effect of Food Preservatives on pH Homeostasis in
Escherichia coIi. J. Gen. Microbiol. 130:2845–2850.
18. Georgellis D, Kwon O, Lin ECC. 1999. Amplification of Signaling Activity of the Arc
Two-component System of Escherichia coli by Anaerobic Metabolites. J. Biol. Chem. 274:35950– 35954.
19. Rodriguez C, Kwon O, Georgellis D. 2004. Effect of D -Lactate on the Physiological Activity of
the ArcB Sensor Kinase in Escherichia coli 186:2085–2090.
20. Evans CGT, Herbert D, Tempest DW. 1970. The continuous culture of microorganisms: 2.
Construction of a chemostat. Methods Microbiol. 2:277–372.
21. Alexeeva S, Hellingwerf KJ, Teixeira De Mattos MJ. 2002. Quantitative Assessment of Oxygen
Availability : Perceived Aerobiosis and Its Effect on Flux Distribution in the Respiratory Chain of Escherichia coli. J. Bacteriol. 184:1402–1406.
22. Monod J. 1949. The Growth of Bacterial Cultures. Annu. Rev. Microbiol. 3:371–394.
23. Rolfe MD, Ter Beek A, Graham AI, Trotter EW, Asif HMS, Sanguinetti G, de Mattos JT, Poole
RK, Green J. 2011. Transcript profiling and inference of Escherichia coli K-12 ArcA activity
across the range of physiologically relevant oxygen concentrations. J. Biol. Chem. 286:10147– 10154.
24. Sharma P, Teixeira de Mattos MJ, Hellingwerf KJ, Bekker M. 2012. On the function of the
various quinone species in Escherichia coli. FEBS J. 279:3364–73.
25. Flegr J. 1997. Two Distinct Types of Natural Selection in Turbidostat-like and Chemostat-like
Ecosystems. J. Theor. Biol. 188:121–126.
26. Steinsiek S, Stagge S, Bettenbrock K. 2014. Analysis of Escherichia coli Mutants with a Linear
Respiratory Chain. PLoS One 9:e87307.
27. Aussel L, Loiseau L, Hajj Chehade M, Pocachard B, Fontecave M, Pierrel F, Barras F. 2014.
ubiJ, a new gene required for aerobic growth and proliferation in macrophage, is involved in coenzyme Q biosynthesis in Escherichia coli and Salmonella enterica serovar Typhimurium. J. Bacteriol. 196:70–9.
28. Lee PT, Hsu AY, Ha HT, Clarke CF. 1997. A C-methyltransferase involved in both ubiquinone
and menaquinone biosynthesis : isolation and identification of the Escherichia coli ubiE gene. J. Bacteriol. 179:1758–1754.
29. Alvarez AF, Rodriguez C, Georgellis D. 2013. Ubiquinone and menaquinone electron carriers
represent the yin and yang in the redox regulation of the ArcB sensor kinase. J. Bacteriol.
27
30. MacWilliams MP, Liao M-K. 2013. Luria Broth (LB) and Luria Agar (LA) Media and Their Uses
Protocol.
31. Arya SS. 1980. Stability of sorbic acid in aqueous solutions. J. Agric. Food Chem. 28:1246–
1249.
32. Wissenbach U, Ternes D, Unden G. 1992. An Escherichia coli mutant containing only
demethylmenaquinone, but no menaquinone: effects on fumarate, dimethylsulfoxide, trimethylamine N-oxide and nitrate respiration. Arch. Microbiol. 68–73.
33. Benkovic SJ, Baker SJ, Alley MRK, Woo Y-H, Zhang Y-K, Akama T, Mao W, Baboval J,
Rajagopalan PTR, Wall M, Kahng LS, Tavassoli A, Shapiro L. 2005. Identification of borinic
esters as inhibitors of bacterial cell growth and bacterial methyltransferases, CcrM and MenH. J. Med. Chem. 48:7468–76.
34. Lee DJ, Bingle LEH, Heurlier K, Pallen MJ, Penn CW, Busby SJW, Hobman JL. 2009. Gene
doctoring: a method for recombineering in laboratory and pathogenic Escherichia coli strains. BMC Microbiol. 9:252.
28
Appendices
Appendix 1A
Metabolites chemostat culture MG1655
0 1 2 3 4 5 6 7 8 0 10 20 30 co cn e n tr ation (m m o le s/gr am ) time (min)
M1655 20140404
acetate series 1 acetate series 2 glucose series 2 formate series 2 0 5 10 15 20 25 30 35 0 50 100 150 200 250 co n ce n tr ation (m m o le s/gr am ) time (min)MG1655 20140605
glucose series 1 glucose series 2 acetate series 1 acetate series 2 formate series 1 formate series 2 lactate series 1 ethanol series 1 ethanol series 229
Appendix 1B AV33
Metabolites chemostat culture AV33
Appendix 1C Acetate (mmoles/gr/hr) Formate (mmoles/gr/hr) Lactate (mmoles/gr/hr) Ethanol (mmoles/gr/hr) MG1655 20140404 series 1 9,85 1,78 x x MG1655 20140404 series 2 10,97 x x x MG1655 20140606 series 1 5,86 3,96 x -0,41 MG1655 20140606 series 2 2,47 1,17 x 0,03 Average MG1655 7,29 2,30 -0,19 Standard deviation 3,37 1,20 0,22 AV36 20140417 series 1 0,10 0,40 0,30 1,20 AV36 20140417 series 2 -0,60 0,00 -1,10 0,00 AV36 20140427 series 1 0,30 0,20 1,10 -0,40 Average AV36 -0,07 0,20 0,10 0,27 Standard deviation 0,47 0,16 0,91 0,68 AV33 20140520 series 1 0,17 0,69 1,70 0,34 AV33 20140520 series 2 0,28 0,59 0,45 0,32 Average AV33 0,23 0,64 1,08 0,33 Standard deviation 0,08 0,07 0,88 0,01 0 5 10 15 20 25 30 35 40 0 100 200 300 400 co n ce n tr ation (m m o le s/gr am ) time (min)
AV33 20140520
Glucose series 1 Glucose series 2 Lactate series 1 Lactate series 2 Acetate series 1 Acetate series 2 Formate series 1 Ethanol series 1 Formate series 2 Ethanol series 230
Appendix 2A Quinones
Assigned peaks by Azur software detection λ (nm) RT (min)
DMKH2 245 8,1
UQH2 290 10,4
UQ 290 18,0
DMK 245 29,5
MK 245 35,3
Quinones found in E.coli at the preferred detection wavelength (λ, in nm) and retention times (RT, in min.).
E.coli MG1655 detection of quinones by HPLC: 248 nm
Appendix 2B 0 50 100 150 200 250 300 350 400 0 10 20 30 40 50 60 co n ce n tr ation (m m o le s) time (min) DMK series 1 DMK series 2 MK series 1 MK series 2 UQH2 series 1 UQH2 series 2 UQ series 1 UQ series 2
31
Appendix 3 ArcA activity AV33
Protein marker 100% 80% 60% 40% 20% 0% 100% Aerobiosis (for both pictures same sequens)
AV36
Protein marker 100% 80% 60% 40% 20% 0% 100% 100% 80% 60% 40% 20%
Marker 0% 100% 100% 80% 60% 40% 20% 0% 100% aerobiosis
32
Appendix 4
Appendix 5
PCR protocol and composition
PCR protocol for amplification
Temperature Time Remark
initial denaturation 94°C 3 minutes
denaturation 94°C 30 seconds 40x cycles
annealing See table 1 (2 minutes/kb)
extension
final extension 72°C 5 minutes
pause 4°C ---
PCR composition (1 reaction)
Concentration Amount (µL)
Pfy polymerase 2,5 U/ µL 0,5
Pfy buffer + MgSO4 (10x) 5
dNTP mix 2 mM 2
Template differs 2
Forward primer 10 pmol/µL 1
Reverse primer 10 pmol/µL 1
H2O - 38,5 Total 50 0 1 2 3 4 5 6 5 70 co cn e n tr ation (m m o le s/gr am ) time (min)
Glucose
Blanco Formic acid Lactate Acetic acid Ethanol Sorbic acid33
Colony PCR composition (1 reaction)
Concentration Amount (µL) Taq polymerase 5 U/ µL 0,5 Taq buffer (10x) 5 MgCl2 5 dNTP mix 2 mM 2 Template differs 2
Forward primer 10 pmol/µL 1
Reverse primer 10 pmol/µL 1
H2O - 33,5
Total 50
Digestion reaction
Digestion reaction composition (1 reaction)
Concentration Amount (µL)
Digestion buffer (10x) 2
Restriction enzymes - 1 for each
DNA differs differs
H2O - 20 – above amounts
Total 20
Ligation reaction
Ligation reaction composition (1 reaction)
Concentration Amount (µL)
T4 ligase 1000 u/µL 0,5
T4 ligation buffer (10x) 2
Digested DNA differs differs*
H2O - 30 – above amounts
Total 30
Concentration of digested DNA for ligation reaction is calculated according to: MI = mass insert (ng) Mv = mass vector (ng) LI = length insert (bp) Lv = length vector (bp)
