The role of Type I Restriction-Modification systems in the occurrence of phase
variation in Streptococcus suis.
Joep Korsten
10796983
04-07-2018
Abstract
Streptococcus suis is an important porcine pathogen, causing various diseases in pigs. It is also known for its zoonotic capabilities and can cause meningitis and septicaemia in humans. The virulence of a certain strain of S. suis depends on the presence of virulence factors. A mechanism known for its association with virulence factors and migration capabilities in bacteria is phase variation. Different morphologies were found in S. suis cultures on Todd-Hewitt agar, implying the occurrence of phase variation. These different morphologies were absent on blood media. Phase variation is a reversible alteration in gene expression and is known be caused by recombination in the methyltransferases of restriction-modification systems in other bacteria. The recombination within hsdS domain of a specific type I restriction-modification system featured in clonal complex 20 strains of S. suis, SsuCC20P is investigated for a connection with the distinctive morphologies. There is a clear difference in presence of certain recombinations in the type I restriction-modification system in SsuCC20P between cultures on blood agar and Todd-Hewitt agar. Besides this, the connection between recombination in the type I restriction-modification system of S. suis and the occurrence of phase variation remains unclear.
Introduction
Streptococcus suis is a major porcine pathogen and is associated with a wide variety of diseases in pigs. Examples of these diseases caused by this bacterium are bacterial septicaemia, endocarditis, pneumonia and arthritis (Staats et al., 1997). S. suis is however also carried asymptomatically by around 80% of healthy pigs (Lun et al., 2007). Besides being a porcine pathogen, S. suis is increasingly being isolated from other mammals (Gottschalk et al., 2010). S. suis is capable of zoonosis and is considered to be a notable pathogen in humans, causing diseases such as bacterial meningitis and septicaemia (Lun et al., 2007). Most human infections occur in those who come in direct contact with pigs on a regular basis, such as pig farmers or butchers. The infection in humans can be caused by an infected animal, as well as a healthy carrier of S. suis (Palmieri, Varaldo and Facinelli, 2011).
S. suis is a gram-positive coccus which can grow under aerobic as well as anaerobic conditions. It appears as a single cell, as diplococcus or as a short chain (Gottschalk et al., 1989). Over the years, 29 serotypes have been identified based on the capsular polysaccharides of the bacterium. The infections in humans are mostly caused by S. suis serotype 2 (Goyette-Desjardins et al., 2014). S. suis naturally resides in the tonsils and nasal cavities of pigs, as well as the genital and gastro-intestinal tract (Robertson and Blackmore, 1989). The bacterium is usually transmitted between pigs nasally or orally via pigs carrying S. suis (Arends et al., 1984).
The zoonotic capabilities a strain of S. suis possesses, depends on multiple factors. The amount of virulence factors correlates with the zoonotic ability of the strain (Willemse et al., 2016). Virulence factors may vary from the ability to form biofilm to the expression of fimbriae, a capsular polysaccharide as well as many others. An important mechanism which may have a substantial influence on the expression of these virulence factors, is phase variation. It is a mechanism typically associated with bacterial surface structures and migration between different host tissues (Atack et al., 2018). Phase variation is a form of alteration in the expression of bacterial phenotypes. In phase variation, the expression of a certain gene can be influenced in two ways: either the gene is ON or OFF or the gene could be altered, which results in a varying functional protein (Atack et al., 2018).The switch in gene expression induced by phase variation, is generally known to be reversible (Henderson, Owen and Nataro, 1999). The switching of gene expression is generally a random event, which occurs at a very high frequency: usually about 1 change per 103 cells per generation (Van Der Woude and
Bäumler, 2004). This results in a population with strong phenotypical heterogeneity. Despite the randomness in occurrence, phase variations may be a programmed event, because of the specific organisation in the genome. Due to this, certain events have a much higher occurrence than others (Robertson and Meyer, 1992).
Two different morphologies were observed on a S. suis culture: opaque and translucent colonies. To validate this observation, 147 S. suis isolates were cultured on Todd-Hewitt Broth agar and blood agar plates. After 3 days of incubation, 117 out of 147 THB agar cultures showed opaque colonies on a translucent overlay. There were no distinct morphologies visible on the blood agar plates (personal communication, Kees van der Ark, Medical Microbiology, AMC Amsterdam). The question that arises after these remarkable observations is what the mechanism is behind the reversible switch between morphologies observed, as well as the possible influence on zoonotic capabilities and virulence.
Restriction-modification systems might be responsible for the phase variation occurring in S. suis, due to their variable methylation properties. DNA methylation is increasingly becoming a common feature found in the genome of over 90% of the studied prokaryotes (Blow et al., 2016). Methylation in genomes is mainly facilitated by methyltransferases. Methyltransferases add a methyl group to a specific base in the DNA molecule. This reaction protects the DNA from the degradation by a restriction enzyme of the bacterium (Robertson and Meyer, 1992). In many bacteria, these methyltransferases are present within a restriction-modification system. Four different types of R-M systems have been identified. These types differ in the composition of their subunits, as well as other factors, like the DNA-cleavage position and specificity of the sequence (Roberts et al., 2003). Initially, the function of R-M systems was to protect the bacterial genome from invading bacteriophages (Bickle, Brack and Yuan, 1978). Interestingly, many bacterial genomes contain phase-variable DNA methyltransferases, which are associated with R-M systems (Vasu and Nagaraja, 2013). Streptococcus. pneumoniae, a close relative of S. suis, also possesses these phase-variable DNA methyltransferases (Manso et al., 2014). Phase variation in methyltransferases can happen in two ways. In one of the two ways phase variation happens in methyltransferases is through simple sequence repeats (SSRs). Due to slipstream mispairing, the number of repeats vary, resulting in a shift of the reading frame. This produces a truncated, full-length or non-functional protein, which has an effect on the methylation pattern or activity of the R-M system (Atack et al., 2018). The other way phase variation occurs in methyltransferases is through recombination of inverted repeats (IRs). This recombination will result in different gene compositions, which in its turn leads to multiple variations of a single protein (Moxon, Bayliss and Hood, 2006; Tan et al., 2016).
In this research the focus will mostly be on investigating Type I R-M systems. These systems consist of three host specificity determinant (hsd) genes coding for a Restriction (R) subunit, Modification subunit (M) and two Specificity (S) subunits. The specificity subunit determines the sequence that is recognized for both the restriction and the modification activity (Price et al., 1989; Murray, 2000). While the R & M subunit genes are stable, the hsdS genes are highly variable and recombines or inverts often. This will result in a variety of methylation patterns and thus influence gene expression (De Ste Croix et al., 2017). According to Willemse & Schultz there is a specific Type I R-M system only present in S. suis strains of Clonal Complex 20, which is a clonal complex known for its zoonotic capabilities. The newly found Type I R-M system is named SsuCC20P accordingly (Willemse and Schultsz, 2016). A very similar type I R-M system is present in S. pneumonia, named the Spn556II locus. The recombination possibilities within this R-M system were investigated and mapped (Li et al., 2016). The specific R-M system in S. suis, along with the other Type I R-M systems mapped by Willemse & Schultz, might have a notable influence in phase variation of S. suis. The phase variation is
associated with migration between host tissues, which probably has an effect on virulence (Li et al., 2016). Therefore, this research will be dedicated to the investigation of the recombination and inversion of Inverted repeats in Type I Restriction-Modification systems in S. suis. The main focus of this research will be the type I R-M system in SsuCC20, but the type I systems in SsuPORF1273P and SsuPORF1588P will be discussed shortly as well.
Materials and methods
Isolates
S. suis strain 861160, (serotype 2 and CC20), is used in this research. The strain was cultured on Todd-Hewitt Broth (THB) agar or Blood agar plates (BAP) at 37°C. Initially, colonies were selected and picked from a culture incubated at 37°C for two days and used directly in the PCR.
DNA extraction
DNA extraction was performed as described in the protocol used (Espinosa et al., 2013). According to Espinosa et al. the sample should be heated to 100°C for five minutes and then incubated at -20°C for ten minutes before commencing with the PCR program. These extra steps would facilitate DNA release from S suis. For later experiments, a different protocol was adopted. It was decided to use isolated DNA of S. suis cultures.
The DNA isolation was done with Wizard® Genomic DNA Purification Kit (Promega, Madison, Wisconsin) according to manufacturer’s protocol. The protocol for gram-positive bacteria was followed, which came with the kit, was used to isolate DNA from S. suis (supplementary figure 1).
Polymerase Chain Reactions
The Polymerase Chain Reactions were done with the Promega GoTaq® G2 Flexi DNA polymerase kit (Promega, Madison, Wisconsin). The preparation of the PCR is done according to the instructions of the manufacturer (Promega, Madison, Wisconsin). The components and their final concentration can be found in table 1. The cycling program is made according to the instruction of the manufacturer (Promega, Madison, Wisconsin) and can be viewed in table 2. The PCR programs are performed in the Biometra Thermocycler. All the primers designed for these PCR experiments are listed in supplementary table 1.
Table 1: The components and their final concentrations used in the polymerase chain reactions in this research
Component Final volume (µl) Final concentration (50 µl per reaction) 5X Green GoTaq® Reaction Buffer 10 1X MgCl2 5 1,5 mM GoTaq® DNA Polymerase 0,25 1,25 U Forward primer 1 1mM Reverse primer 1 1 mM dNTPs 1 0,2 mM each dNTP Water 31,75
-Table 2: The standard polymerase chain reaction cycling program used in this research
Step Time Temp Cycle
Initial denaturation 2 min 95°C 1
Denaturation 0,5 min 95°C 35
Annealing 0,5 min 55°C 35
Extension 1kb/min 72°C 35
Final extension 5 min 72°C 1
Pause - 4°C
-The gel used for the gel electrophoresis consisted of 1% agarose and 0.005% ethidium bromide. -The gels were running for 90 minutes on 150V. The primers used in this research are displayed in supplementary table 4 and a schematic overview is shown in figure 1.
Figure 1: A schematic overview of the primer placement in the HsdS subunits. The red and yellow bars represent the inverted repeats where recombination is possible. The primers are designed to cover every subunit, thus making it possible to investigate the recombination of each of them.
A
hsdS1
hsdS2
RecombinasehsdS3
hsdS4
FA1
RA2
FA3
RA4
FA4
FA5
RA5
RA6
FA2
RA3
FA6
RA7
In this research, many different polymerase chain reactions were conducted. The primer combinations were varied in each of the conducted experiment.
Quantitative Polymerase Chain Reactions
The qPCRs were prepared with the Roche LightCycler® 480 SYBR Green I Master kit. The preparation and concentration of each of the components in every reaction were done according to the instructions of the manufacturer (Roche, Penzberg, Bavaria). The components, their concentrations and cycling programs can be found in supplementary table 3. Firstly, the components were added to a 96 well plate and mixed well. After this, the 96 well plate was centrifuged for 2 minutes on 1500 g. The reactions were conducted in the Roche LightCycler® 480 instrument. Conversion of the raw data from the LightCycler® was done with the accessory software. After this conversion, LinReg was used to determine the baselines and analyse the results (Ruijter et al., 2009). The primer combinations were varied in each of the conducted experiments. Figure 2 shows an overview of the primers for the qPCR on the hsdS locus. The primers designed for the qPCR experiments are listed in supplementary table 1.
Figure 2: A schematic overview of the primer placement in the hsdS subunits. The red and yellow bars represent the inverted repeats where recombination is possible. The primers are designed to cover every inverted repeat, thus making it possible to investigate the recombination of each of them.
Results
Direct colony PCR from THB of SsuCC20
HsdS genes were amplified using the primers as shown in figure 1. The first experiments were conducted to determine whether the PCR program and preparations were correct for S. suis. Figure 3 shows the first colony PCR of the research. The second lane from the left side shows an amplicon of approximately 600 base pairs. This corresponds with the expected length of the 599 base pair target. Positive control 2 (PC2) is the only one of the two positive controls which yields an amplicon. This positive control will be used for the next experiments, while the other one is discarded. The third lane from the left has no visible amplicon, even though there was an expected target of 3691 bp.
hsdS1 hsdS2 Recombinase hsdS3 hsdS4
FD2 FDcon FD3 FD4
FD1
Figure 3: direct colony PCR of SsuCC20 hsdS region from S. suis. The primer pairs are displayed at the top of the figure. PC1 & PC2 are two positive controls. NC is the negative control. The numbers under the primer pairs represent the length in base pairs of the target amplicon.
After the initial results with colony PCR, more primers were used to see if this experiment can be successful with more primers in use. Figure 4 displays a series of primer pairs used in a direct colony PCR of S. suis. The combination of FA1 and RA2 shows an amplicon of approximately 600 bp, which corresponds with the actual target length of 599 bp. The result of the combination of FA1 and RA3 also corresponds with the expected amplicon. When no recombination would occur in the hsdS region, none of the first five lanes, which only consist of two forward primers per reaction, should yield an amplicon. However, FA1 + FA2 and FA1 + FA5 both have a visible amplicon in their lane. The first combination has an amplicon of 500-600 bp and the amplicon of FA1 + FA5 is about 600 bp in length. All of the combinations with an expected amplicon higher than 1160 bp did not show a result.
Figure 4: direct colony PCR of SsuCC20 HsdS region from S. suis. The primer pairs are displayed at the top of each lane, as well as the target amplicon length. NC = negative control. PC = positive control.
PCR of SsuCC20 from isolated DNA
Direct colony PCR did not produce amplicons longer than approximately 1160 bp, which is not favourable for the goal of the experiment. Thus, the protocol was changed to PCR with DNA isolated from S. suis cultures on Todd-Hewitt agar as template. With these PCRs, the recombination possibilities can be visualised. Figure 5 shows the first successful PCR from isolated S. suis DNA. All of the individual experiments were done with the combination of the non-recombining ‘5- end FA1 primer together with a primer on every subunit. Almost every lane has at least one amplicon. In every case, two forward primers yielded a visible result, except for the combination of FA1 + FA6. The approximate amplicon lengths are displayed in table 3.
Figure 5: PCR of SsuCC20 hsdS region from isolated S. suis DNA. The primer pairs used are displayed above their corresponding lane, as well as the expected amplicon length. NC = negative control. PC = positive control.
Table 3: The results of the PCR conducted in figure 5. The true amplicon lengths are between the amount of base pairs shown in this table.
F + F Length (bp) F + R Length (bp) FA1 + FA2 500-550 FA1 + RA7 3500-3700 FA1 + FA3 2000-2300 FA1 + RA2 500-600 FA1 + FA4 1500-1600 FA1 + RA3 1000-1200 FA1 + FA5 550-600 FA1 + RA4 1700-1800 FA1 + FA6 - FA1 + RA5 1. 400-500
2. 2500-3000 FA1 + RA6 2900-3100
To truly understand the different recombination possibilities in SsuCC20 hsdS genes, another PCR was done from RA7, the non-recombining primer on the ‘3- end of the gene. The result of this experiment is shown in figure 6. Almost every lane showed a visible amplicon. The combination of RA7 + RA6 is the only experiment that did not yield a result. FA4 + FA5 is added to this experiment as well. The approximate amplicon lengths of each lane are displayed in table 4.
Figure 6: PCR of SsuCC20 hsdS region from isolated S. suis DNA. The primer pairs used are displayed above their corresponding lane, as well as the expected amplicon length. NC = negative control. PC = positive control.
Table 4: The results of the PCR conducted in figure 6. The true amplicon lengths are between the number of base pairs shown in this table.
Combinatio n R + F Amplicon Length (bp) Combinatio n R + R Amplicon Length (bp) Combinatio n F + F Amplicon Length (bp)
RA7 + FA6 450-500 RA7 + RA2 900-1100 FA4 + FA5 1000-1100 RA7 + FA5 950-1000 RA7 + RA3 1450-1550
RA7 + FA4 1800-2000 RA7 + RA4 2000-2200 RA7 + FA3 2300-2600 RA7 + RA5 1. 800-1000
2. 3000-3200 RA7 + FA2 850-950 RA7 + RA6 -
RA7 + FA1 3500-3700
These PCRs resulted in sixteen possible configurations of the hsdS genes. All of these sixteen configuration possibilities can be seen in supplementary figure 2. The sequence of each of the configurations were translated in silico using Expasy (Gasteiger et al., 2003) to see whether the recombination influences the length of the specificity subunits. Two of the configurations did not provide a single full-length specificity unit.
The PCRs done with DNA from Todd-Hewitt agar showed the recombination possibilities in h sdS of SsuCC20. Earlier in this report, the difference in morphology between colonies on blood agar plates and colonies on Todd-Hewitt agar was discussed. The next step in this research was to determine whether the recombination is different between blood and THB isolated DNA. In figure 7 is a PCR displayed, which compared DNA isolated from the two different media. In the figure it is clear to see that there is no visible difference in recombination possibilities between S. suis cultured on blood agar and on THB agar.
Figure 7: PCR of SsuCC20 hsdS region from isolated DNA of S. suis blood agar and Todd-Hewitt agar cultures. The primer pairs and their corresponding lanes are displayed under the figure. PC = positive control. NC = negative control.
PCR of SsuPORF1273P from isolated DNA
One of the other Type I restriction-modification systems in S. suis is the one in SsuPORF1273P. Recombination within this system is possible between two inverted repeats. A polymerase chain reaction was conducted to see whether this possible recombination truly happens, or if there are other recombination possibilities in this R-M system. The results of this PCR are shown in figure 8. There is an amplicon visible in the last three lanes. The combination of FB6 + RB7 functions as a positive control, as was positive in an earlier conducted experiment. The approximate lengths of the amplicons are depicted in table 5.
Figure 8: PCR of SsuPORF1273P from isolated S. suis DNA. The primer pairs used are displayed above their corresponding lane, as well as the expected amplicon length. NC = negative control.
Table 5: The results of the PCR conducted in figure 8. The true amplicon lengths are between the number of base pairs shown in this table.
Combination Amplicon length (bp)
FB1 + FB2 -FB1 + FB3 -FB3 + FB4 -FB3 + FB5 2800-3000 FB5 + FB6 1150-1250 FB6 + RB7 950-1050
PCR of SsuPORF1588P from isolated DNA
The last Type I R-M system that was studied in this research is the one in SsuPORF1588P. This restriction-modification system also has two inverted repeats in-between which recombination might be possible. The PCR is done to investigate whether this actually happens, as well as possible other recombination possibilities that have not been described before. The results of this experiment are depicted in figure 9 and the corresponding amplicon lengths can be seen in table 6.
Figure 9: PCR of SsuPORF1588P from isolated S. suis DNA. The primer pairs used are displayed above their corresponding lane, as well as the expected amplicon length. NC = negative control.
Table 6: The results of the PCR conducted in figure 7. The true amplicon lengths are between the amount of base pairs shown in this table.
Combination Amplicon length (bp) FC1 + FC2 600-700 FC1 + FC3 50-75 FC3 + FC4 50-75 FC3 + FC5 1. 4000
2. 3000 3. 1000-1200 FC5 + FC6
-qPCR of SsuCC20 from isolated DNA
After the successful polymerase chain reactions, the recombination possibilities were made clear. It was also discovered that the same recombination happens in S. suis under the two different media conditions: blood agar and THB agar. The next step in this research is the quantification of this recombination. It is important to understand whether there is a difference in frequency of the recombination possibilities between S. suis cultured on THB agar and blood agar. Figure 10 displays the results of the different quantitative polymerase chain reactions performed. All the results were calculated relative to the internal reference, which counts as the 100% line. Four combinations of primers did not yield any result. Notable is that four of the combinations were without results and are all featured with the RD2 primer. The results are also featured in supplementary table 2.
Figure 10: A bar plot of the qPCR results. The primer pairs who show a bar on the left side of the Y-axis (red) are more present in blood agar cultures, while the bars on the right side of the Y-axis (green) represent the primer pairs who are more present in the THB agar cultures.
Discussion & Conclusions
Colony PCR
The first experiment was done to determine whether the protocol for the direct colony PCR of Espinosa et al. was effective enough to result in a successful PCR. The combination of FWD1 + Rev2 yielded an amplicon of approximately 600 base pairs. This corresponds with the sequenced length of 599 bp. The lack of results in the other lanes show that this method of PCR preparation, by heating the sample to 100°C and freezing it in -20°C, is not as successful as was described earlier (Espinosa et al., 2013). Figure 4 shows a PCR which yields comparable results. It is clearly visible that the bigger target amplicons show consistent negative results. The harsh preparation of the S. suis colonies for PCR are probably the cause of the absence of amplicons. It is likely that the DNA of the bacteria was broken into smaller pieces due to the exposure to very high temperatures, resulting in the absence of larger target amplicons. Overall, this method seems to be insufficient to use for the PCR experiments of S. suis done in this research.
PCR of SsuCC20
After the protocol was changed and the polymerase chain reactions were conducted using isolated S. suis DNA. The longer target amplicons were, in contrast to earlier experiments, clearly amplified. It is concluded that using isolated DNA yields clear results.
The different primer combinations tested and shown in figure 5 and 6 show the recombination possibilities in SsuCC20. Using this data, it is possible to construct every achievable configuration of the hsdS genes.
The effect of the truncated specificity units on the functionality of the restriction-modification system in S. suis is unknown, but it is shown in S. pneumoniae that it results in a different methylation motif. Therefore, the R-M system will recognise and methylate different sequences (Atack et al., 2018). There are also two configurations which yield two full-length specificity subunits. This would result in a heterodimer hsdS. The effect of a heterodimer as specificity unit on the functionality of the whole restriction-modification system is not described, but it will probably result in multiple methylation
motifs within one bacterium, probably leading to broader methylation pattern. The other twelve possible configurations yield only one full-length hsdS subunit. This will result in a homodimer as specificity unit and thus one specific sequence which can be recognised by the restriction modification system. The variance between these specificity subunits is linked to differences in methylation motifs in S. pneumoniae, which is associated with the morphological switch (Li et al., 2016). This might also be the case in S. suis.
The results of the polymerase chain reactions performed in this research are very similar to the discoveries made by Li et al. In their research, they also observed amplicons when combining two forward primers. The distinctive configurations in the hsdS locus, resulted in different methylation motifs. This is probably the same case with the hsdS subunits in the SsuCC20 type I R-M system of S. suis. They even linked the expression of the hsdS subunit to the phase variation in pneumococcal colony opacity. Considering that the results of the conducted experiments in this research have many similar results as the experiments performed by Li et al. in 2016, it is predictable that the recombination inside hsdS of SsuCC20 in S. suis has the same effect on phase variation of colony opacity. However, to be sure of the link between these phenomena exists in S. suis, the same follow up experiments that were conducted by Li et. al must be performed: the substitution of recombinase for a cassette, thus locking the recombination mechanism in one configuration. These locked mutants were cultured and showed either only opaque colonies or translucent colonies, depending on the locked configuration (Li et al., 2016).
Finally, a PCR was conducted using DNA from S. suis cultured on THB agar and blood agar. It was clear that there was no visible difference in recombination possibilities between the S. suis cultured on THB agar and on blood agar. This result was rather surprising, because there was a clear difference in morphologies present on the two respective media. This raises the question if there might be a difference in occurrence or selection of certain configurations in hsdS between the two media.
PCR of SsuPORF1273P & SsuPORF1588P
The polymerase chain reaction of the type I restriction-modification system in SsuPORF1273P yielded fairly clear results. It can be concluded that there is a possible inversion of the sequence between the two inverted repeat and that there are no further recombination possibilities in this R-M system. This recombination results in a duplication of the sixteen combinations found in SsuCC20, resulting in a total amount of 32 possible configuration possibilities.
The PCR done of the type I R-M system in SsuPORF1588P showed no results that would indicate possible recombination within the hsdS locus. The FC3 + FC5 primer combination yielded unclear results, which resemble specific binding of one of the primers. It is probably the result of non-specific binding of the FC5 primer, because this primer also lacked result when it was used in other
primer combinations. To be sure if there is no possible recombination, this primer should be redesigned, and the experiment repeated.
qPCR of SsuCC20
The quantitative polymerase chain reactions performed in this research presented remarkable results. The goal of these experiments is to determine whether there is a difference in selection or occurrence of the found configurations of hsdS genes between S. suis cultured on THB agar and S. suis cultured on blood agar. The results of the last two qPCR experiments performed are used in this research. Even though these experiments were conducted according to the protocol, it is notable that four primer combinations used did not produce any result. The similarity between these experiments is that they all featured the RD2 primer. After many negative results, it can be concluded that this primer is not working properly, but the reason of this is yet to be investigated.
Despite this missing data, it is still possible to draw some conclusions out of the results. It is remarkable that there are many differences between the frequency of each of the primer combinations in S. suis cultured on THB agar and blood agar. Table 7 displays the 2log fold change between THB and blood cultures and figure 10 is a bar plot displaying the differences more clearly. The combination of FD1 + RD1 is nearly 28 times more frequent in THB than in blood cultures, while FD1 + RD3 is almost 9 times more frequent in blood cultures than in THB cultures. With this information, it is safe to conclude that there is indeed a difference in hsdS between S. suis cultured on the two different media. However, it is not possible to determine the frequency of the different complete hsdS configuration, because all of the primer pairs can be present in two unique configurations. For example, the combination of FD2 + FD3 is present in both of the configurations displayed in figure 11. Besides these two options, the hsdS3 subunit can also be inverted, which adds another 2 phases in which this primer pair is present.
A hsdS3 hsdS2 Recombinase S1 hsd hsdS4
FD3
Figure 11: a schematic representation of two configuration possibilities which both contain the FD2 + FD3 primer pair. A) Because of the recombined and inverted hsdS1 subunit, FD2 is also flipped and functions as a reverse primer. B) Because of the inversion of hsdS2 and recombinase, the FD3 is flipped and functions as a reverse primer.
This also applies to all of the other primer pairs, so that makes it impossible to determine the frequency of each of the possible configuration with this data. Nevertheless, it is most valuable to know that there is a definite difference in hsdS configuration between S. suis cultured on THB agar and S. suis cultured on blood agar.
Based on all of the observations in this research, the link between type I restriction-modification systems and the occurrence of phase variation in S. suis remains unclear. When locked mutants are made similarly to the ones in S. pneumoniae, the relation can be determined (Li et al., 2016). The influence of phase variation on the virulence in S. suis should also be investigated. Translocation experiments with the locked mutants could point out if phase variation has an effect on the migrating capabilities in S. suis.
References
Arends, J. P. et al. (1984) ‘Carrier rate of Streptococcus suis capsular type 2 in palatine tonsils of slaughtered pigs’, Journal of Clinical Microbiology.
Atack, J. M. et al. (2018) ‘Phasevarions of Bacterial Pathogens: Methylomics Sheds New Light on Old Enemies.’, Trends in microbiology. England. doi: 10.1016/j.tim.2018.01.008.
Bickle, T. A., Brack, C. and Yuan, R. (1978) ‘ATP-induced conformational changes in the restriction endonuclease from Escherichia coli K-12.’, Proceedings of the National Academy of Sciences of the United States of America. United States, 75(7), pp. 3099–3103.
Blow, M. J. et al. (2016) ‘The Epigenomic Landscape of Prokaryotes’, PLoS Genetics. doi: 10.1371/journal.pgen.1005854.
B hsdS1 ase bin om Rec S2 hsd hsdS3 hsdS4
FD3 FD2
Espinosa, I. et al. (2013) ‘Evaluation of simplified DNA extraction methods for Streptococcus suis typing’.
Gasteiger, E. et al. (2003) ‘ExPASy: The proteomics server for in-depth protein knowledge and analysis’, Nucleic Acids Research. doi: 10.1093/nar/gkg563.
Gottschalk, M. et al. (1989) ‘Description of 14 new capsular types of Streptococcus suis’, Journal of Clinical Microbiology.
Gottschalk, M. et al. (2010) ‘Streptococcus suis: A new emerging or an old neglected zoonotic pathogen?’, Future Microbiology. doi: 10.2217/fmb.10.2.
Goyette-Desjardins, G. et al. (2014) ‘Streptococcus suis, an important pig pathogen and emerging zoonotic agent-an update on the worldwide distribution based on serotyping and sequence typing’, Emerging Microbes and Infections. doi: 10.1038/emi.2014.45.
Henderson, I. R., Owen, P. and Nataro, J. P. (1999) ‘Molecular switches--the ON and OFF of bacterial phase variation.’, Molecular microbiology. doi: 10.1046/j.1365-2958.1999.01555.x.
Li, J. et al. (2016) ‘Epigenetic Switch Driven by DNA Inversions Dictates Phase Variation in Streptococcus pneumoniae’, PLoS Pathogens. doi: 10.1371/journal.ppat.1005762.
Lun, Z. R. et al. (2007) ‘Streptococcus suis: an emerging zoonotic pathogen’, Lancet Infectious Diseases. doi: 10.1016/S1473-3099(07)70001-4.
Manso, A. S. et al. (2014) ‘A random six-phase switch regulates pneumococcal virulence via global epigenetic changes’, Nature Communications. doi: 10.1038/ncomms6055.
Moxon, R., Bayliss, C. and Hood, D. (2006) ‘Bacterial Contingency Loci: The Role of Simple Sequence DNA Repeats in Bacterial Adaptation’, Annual Review of Genetics. doi:
10.1146/annurev.genet.40.110405.090442.
Murray, N. E. (2000) ‘Type I Restriction Systems: Sophisticated Molecular Machines (a Legacy of Bertani and Weigle)’, Microbiology and Molecular Biology Reviews. doi: 10.1128/MMBR.64.2.412-434.2000.
Palmieri, C., Varaldo, P. E. and Facinelli, B. (2011) ‘Streptococcus suis, an emerging drug-resistant animal and human pathogen’, Frontiers in Microbiology. doi: 10.3389/fmicb.2011.00235.
Price, C. et al. (1989) ‘Basis for changes in DNA recognition by the EcoR124 and EcoR124/3 type I DNA restriction and modification enzymes.’, Journal of molecular biology. England, 205(1), pp. 115–125.
Roberts, R. J. et al. (2003) ‘A nomenclature for restriction enzymes, DNA methyltransferases, homing endonucleases and their genes’, Nucleic Acids Research. doi: 10.1093/nar/gkg274.
Robertson, B. D. and Meyer, T. F. (1992) ‘Genetic variation in pathogenic bacteria’, Trends Genet. Robertson, I. D. and Blackmore, D. K. (1989) ‘Prevalence of Streptococcus suis types 1 and 2 in domestic pigs in Australia and New Zealand.’, The Veterinary record. England, 124(15), pp. 391–394. Ruijter, J. M. et al. (2009) ‘Amplification efficiency: Linking baseline and bias in the analysis of quantitative PCR data’, Nucleic Acids Research. doi: 10.1093/nar/gkp045.
Staats, J. J. et al. (1997) ‘Streptococcus suis: Past and present’, Veterinary Research Communications. doi: 10.1023/A:1005870317757.
De Ste Croix, M. et al. (2017) ‘Phase-variable methylation and epigenetic regulation by type I restriction-modification systems’, FEMS microbiology reviews. doi: 10.1093/femsre/fux025. Tan, A. et al. (2016) ‘The capricious nature of bacterial pathogens: Phasevarions and vaccine development’, Frontiers in Immunology. doi: 10.3389/fimmu.2016.00586.
Vasu, K. and Nagaraja, V. (2013) ‘Diverse Functions of Restriction-Modification Systems in Addition to Cellular Defense’, Microbiology and Molecular Biology Reviews. doi: 10.1128/MMBR.00044-12. Willemse, N. et al. (2016) ‘An emerging zoonotic clone in the Netherlands provides clues to virulence and zoonotic potential of Streptococcus suis’, Scientific Reports. doi: 10.1038/srep28984.
Willemse, N. and Schultsz, C. (2016) ‘Distribution of Type I Restriction–Modification Systems in Streptococcus suis: An Outlook’, Pathogens. doi: 10.3390/pathogens5040062.
Van Der Woude, M. W. and Bäumler, A. J. (2004) ‘Phase and antigenic variation in bacteria’, Clinical Microbiology Reviews. doi: 10.1128/CMR.17.3.581-611.2004.
Appendix
Supplementary figure 1: DNA isolation protocol from manufacturer (Promega, Madison, Wisconsin) used in this research.
Supplementary table 1: The primers used in this research.
Primer name Sequence (5’-3’) Tm° Abbreviation
861160_CC20_FW1 tgcccttctccataaaaaga 61. 2 FA1 861160_CC20_FW2 tcccaaacctgaatacccata 62. 8 FA2 861160_CC20_FW3 accctatttcatcttcatccag 60. 8 FA3 861160_CC20_FW4 ccgctcgctatttccttta 61. 8 FA4 861160_CC20_FW5 tcttccaaagcgaaaaataaat 60. 5 FA5 861160_CC20_FW6 gcatcttcgtccccttaga 61. 8 FA6 861160_CC20_Rev7 agggaagaagatagcgaacc 61. 2 RA7 861160_CC20_Rev2 tatgggtattcaggtttggga 62. 8 RA2 861160_CC20_Rev3 ctggatgaagatgaaatagggt 60. 8 RA3 861160_CC20_Rev4 taaaggaaatagcgagcgg 61. 8 RA4 861160_CC20_Rev5 atttatttttcgctttggaaga 60. 5 RA5
8 861160_CC20_FW2rep gtctagcttttcaacttgagtgtagtct 62. 3 FA2r 861160_CC20_Rev2re p acagcctaagaaaaggagaataccatga 67. 3 RA2r 861160_1273_FW1 cctgaagttattattcatactgaaagagga a 65.0 FB1 861160_1273_FW2 aagtgatgactaaaatcacatcaaaa 61. 5 FB2 861160_1273_FW3 tcaatcaatgacagaatttaaacaga 62. 4 FB3 861160_1273_FW4 ggagatgacttacttgagtttgtgaata 63. 4 FB4 861160_1273_FW5 ggaaggaaaagtcaagcgaga 64. 5 FB5 861160_1273_FW6 ttgataaagtatctgacgagataaatggt 63. 6 FB6 861160_1273_Rev7 acaccgaaatcttctgaatctacttatta 63. 0 RB7 861160_1273_Rev3 tctgtttaaattctgtcattgattga 62. 4 RB3 861160_1273_Rev5 tctcgcttgacttttccttcc 64. 5 RB5 861160_1273_FW1rep gaaggcaagctcaagaagaaag 63. 3 FB1r 861160_1273_FW2rep ctttcttcttgagcttgccttc 63. 3 FB2r 861160_1588_FW1 gtaaaactgtatcacaacaacagaacag 62. 6 FC1 861160_1588_FW2 agagtgaccgcataattaaatcaa 62. 4 FC2 861160_1588_FW2N tgtaggtaaaaatccgccgtct FC2N 861160_1588_FW3 gtgacttctcgaatggctcct 64. 6 FC3 861160_1588_FW4 gaatgcccaaggtagacaagg 64. 5 FC4 861160_1588_FW5 aagcggtttggaagacctc 63. 2 FC5 861160_1588_FW6 agaactatatcctagccttcatgttctatc 62. 9 FC6 861160_1588_Rev7 ctaaaaatctactcccaaagtctttaattg 63. 1 RC7
861160_1588_Rev3 aggagccattcgagaagtcac 64. 6 RC3 861160_1588_Rev5 gaggtcttccaaaccgctt 63. 2 RC5 861160_qPCR_FW1 aaattgcagtaatcgtagcaca 61. 1 FD1 861160_qPCR_Rev1 gtaccaccgcccactattt 61. 2 RD1 861160_qPCR_FW2 agttaatcgaagtgcgcgat 63. 6 FD2 861160_qPCR_Rev2 ctggaagacaaagagttcagcta 61. 5 RD2 861160_qPCR_FW3 gctctagttgctccattgt 57. 0 FD3 861160_qPCR_Rev3 aagttatccgagttaagggatt 58. 6 RD3 861160_qPCR_FW4 agtctcacccttaggagattgt 59. 7 FD4 861160_qPCR_Rev4 ccttagaggagcaagagttgattt 62. 7 RD4 861160_qPCR_FWcon gggcgtaatacgggctattaaa 64. 4 FDcon 861160_qPCR_Revcon ttgaacgattggaaatgggtaaag 66. 4 RDcon
Supplementary figure 2: the possible configurations found in hsdS of the type I restriction-modification systems in SsuCC20p in S. suis.
Supplementary table 2:qPCR of SsuCC20 HsdS region from isolated DNA of S. suis blood agar and Todd-Hewitt agar cultures. The primer pairs are displayed on the left side of the table. The second column represents the 2log fold change of THB/blood.
Combination 2log FC FD1+RD1 4,785122 FD1+FD2 3,841778 FD4+RD4 3,783526 FD3+RD3 2,966616 RD3+RD4 2,630786 FD2 + FD3 1,320331 FD2+RD4 0,884259 FD1 + FD4 0,1644 FD3 +FD4 -2,357668 FD3 + RD1 -2,903871 FD1 + RD3 -3,14013 RD2 + RD3 -FD1 + RD2 -FD2 + RD2 -FD4 + RD2
-Supplementary table 3: The qPCR components and cycling program.
Reagent Volume Step Temp (°C) Acquisition mode Time (s) Ramp (°C/s) Water, PCR grade 3 µl Pre-incubation 95 None 300 4.4 Primer 1 1 µl Amplification 95 None 10 4.4 Primer 2 1 µl 40 cycles 53 None 20 2.2 Master Mix 10 µl 72 Single 20 4.4
DNA template 5 µl Melting Curve 95 None 5 4.4 65 None 60 2.2 97 Continuous - -Cooling 40 None 10 1.5
