Complex activation towards intestinal
pain: the potential mechanism of
fungal-induced, macrophage-derived
histamine in visceral hypersensitivity
BSc Beta-Gamma, major Biomedical Sciences
Bachelor’s Thesis/Research Project, 18 ECTS credits
Name: B.B. van Zoomeren
Student number: 11236795
Date: 1st July 2020
Research institute: Tytgat Institute for Liver and Intestinal Research, Amsterdam Medical
Center (AMC), Amsterdam
Supervisor: I.A.M. van Thiel, MSc
Senior researcher: R.M.J.G.J. van den Wijngaard, PhD UvA Examiner: prof. dr. L.W. Hamoen
2
1. Introduction
Irritable bowel syndrome (IBS) is a common gastrointestinal disease, from which 20% of the Western population suffers (Wouters et al., 2016). This stress-related condition is characterized by abdominal pain or discomfort, and sometimes an alteration in bowel habits, while no organic cause is known. Although its specific set of symptoms is very heterogeneous, there is a hypothesized underlying pathophysiological mechanism called visceral hypersensitivity (VH). VH is defined as an increased sensitivity to distension in the gastrointestinal tract and is observed in approximately 50% of all IBS patients (Keszthelyi, Troost & Masclee, 2012). Provoked by promising results in animal studies, clinical research found that VH can be mediated by gut mucosal mast cells and their mediator histamine, as IBS patients showed a positive reaction to the histamine antagonists ketotifen and ebastine (Klooker et al., 2010; Stanisor et al., 2013; Van Den Wijngaard et al., 2009; Wouters et al., 2016).
Mast cell degranulation is indicated as an important immunological response contributing to VH (Stanisor et al., 2013). Mast cells are classically activated via the immunoglobulin E (IgE) activating Fcϵ-receptor (Bulfone-Paus, Nilsson, Draber, Blank, & Levi-Schaffer, 2017; Gilfillan & Tkaczyk, 2006). However, other systems like Toll-like receptors (TLRs) or C-type lectins (CLRs) are described through which pathogens can influence downstream pathways (Pinke, Lima, Cunha, & Lara, 2016). Pathogenic recognition
Abstract
Introduction: Irritable bowel syndrome (IBS) is a common, stress-related disease, with visceral
hypersensitivity (VH) as one of its features. Mast cell degranulation is indicated as an important immunological response contributing to VH, resulting in histamine excretion. Fungal dysbiosis is reported to be associated with VH in IBS patients, and an alternative source of histamine is suggested upon earlier research, as mast cell-inhibitors did not lower the expected concentration of this compound. This study investigated the potential histamine-producing ability of monocytes and macrophages from six healthy donors, measured by histidine decarboxylase (HDC) expression, upon stimulation with fungal-derived compounds.
Materials & methods: Human peripheral monocytes (MCs) and monocyte-derived undifferentiated
macrophages (MΦs) were stimulated in vitro stimulation with lipopolysaccharides (LPS), zymosan, phorbol 12-myristate 13-acetate (PMA), particulate β-glucans (pBG), compound 48/80, and heat-inactivated Candida
albicans. Supernatant inflammatory cytokine levels were measured with ELISA after 24 hours of
stimulation, and their gene expression levels by real-time qPCR after 4 hours of stimulation.
Results: MCs and MΦs were responsive, as in vitro stimulation with LPS and zymosan resulted in significant
increase of inflammatory cytokines. In contrast with earlier research, both MCs and MΦs showed moderate to absent responses on fungal-derived compounds, as inflammatory cytokine and fungal-receptor Dectin-1 expression did not alter significantly. Moreover, HDC mRNA expression remained unaltered in MCs and MΦs upon in vitro stimulation.
Discussion & Conclusion: The present data suggest that monocytes and macrophages do not significantly
contribute to the total amount of histamine upon fungal recognition. As these cells are important in intestinal homeostasis and immune reactions, and this data did not imply a complete rejection of a signal-transmitting role between intestinal fungi and VH in IBS, an alternative communication mechanism is proposed.
3
Figure 1: Mechanisms of fungal-induced activation of mast cells during intestinal epithelial barrier dysfunction, contributing to visceral hypersensitivity (VH). Intestinal fungi and/or fungal antigens can enter the lamina propria from the
lumen and mucus upon stress-induced barrier dysfunction, typical for intestinal bowel syndrome (IBS). Known mechanism of mast cell activation (grey arrows): mast cell degranulation, stress-induced or via recognition of fungi (or fungal antigens) through Dectin-1, leads to histamine excretion. The rate-limiting enzyme HDC is therefore activated, converting histidine to histamine, which then activates the histamine-1 receptor (H1R) downstream. Furthermore, produced histamine was found to amplify mast cell degranulation. Proposed mechanism of macrophage- or monocyte-dependent indirect mast cell activation (black arrows): monocytes and macrophages were shown being unable to produce histamine themselves, but an indirect activation of mast cells upon fungal (antigens) recognition is proposed for future research. This fungal recognition by monocytes or macrophages in the lamina propria can be via Dectin-1 receptors or other, yet unknown mechanisms. Figure was based on Figure 6 in Botschuijver et al. (2017).
4
of fungi and/or fungal antigens is known to be mediated by the CLR surface receptor Dectin-1, which can result in mast cell degranulation (see Figure 1). Dectin-1 is able to recognize particulate β-glucans, carbohydrates that are predominantly found on fungal cell walls (Tone, Stappers, Willment, & Brown, 2019). Furthermore, acute stress in IBS can induce degranulation and exacerbate barrier dysfunction by binding of peripheral corticotrophin releasing factor (CRF) to the CRF-receptor on mast cells (Botschuijver et al., 2017). Activated mast cells release granules with histidine-derived histamine, catalyzed by the rate-limiting enzyme histidine-decarboxylase (HDC), resulting in an immunological response in the host. Histamine was suggested to regulate the process by amplifying the degranulation itself, triggered by soluble factors produced by surrounding cells like macrophages (Carlos et al., 2006). In IBS patients, Wouters et al. (2016) found that VH is mediated by histamine-1 receptor (H1R)-related sensitization of transient reporter potential channel V1 (TRPV1), a nociceptor on peripheral neurons that is known to be involved in the process of pain reception. Hence, getting insight in the intestinal sources of histamine contributes to accurate development of histamine-inhibiting therapies that might help in IBS.
Although (intestinal) fungi are surprisingly scarce, they are important members of the microbiomes of mucosal surfaces, and are becoming an increasingly interesting subject due to their contribution to health and disease (Limon, Skalski, & Underhill, 2017; Paterson, Oh, & Underhill, 2017). The influence of microbiota and mycobiota on the immune system and the regulation of inflammation in the host have been extensively described recently (Blander, Longman, Iliev, Sonnenberg, & Artis, 2017; Li, Leonardi, & Iliev, 2019; Paterson et al., 2017; Wheeler et al., 2016), but the pathogenic effect of an unbalance in intestinal fungi is gaining attention. Complex cross-kingdom interactions between bacteria and fungi are recurrently emphasized as important contributors to this imbalance, for instance the influence of intestinal fungi on microbiota community structure in the gut (Limon, Kershaw, & Underhill, 2018; Paterson et al., 2017). Interestingly, Botschuijver et al. (2017) reported that intestinal fungal dysbiosis was associated with VH in patients with IBS, a model that was specified in rats by activated mast cell-derived histamine upon Dectin-1 dependent recognition of particulate β-glucans. As stated by Paterson et al. (2017), it is important to get a better understanding of how these fungal-derived antigens allocate from the gut lumen to mesenteric mast cells, to find verification for this proposed mechanism of contribution to IBS. With intestinal epithelial barrier dysfunction being a known contributing mechanism in IBS, the leakage may cause a higher abundance of fungal antigens in the lamina propria. Moreover, it is likely there is another intestinal source of histamine besides mast cells, as Klooker et al. (2010) found that impeding of mast cell degranulation by the mast cell inhibitor ketotifen did not change the amount of histamine in intestinal biopsies as was expected. According to Rahabi et al. (2020), Dectin-1 receptors on macrophages are important regulatory units of the intestinal inflammatory response, although the inflammatory role of histamine is not included in this research. Presence of Dectin-1 is further known to be more typical for monocytes and macrophages than for mast cells (Willment et al., 2005). Hence, the latter two can be candidates for another offspring of VH.
The aim of this study is to get insight in the potential histamine-producing ability of monocytes and macrophages, measured by gene expression of HDC, upon stimulation with fungal-derived compounds. Pathogenic recognition by these cells, followed by an inflammatory reaction, can thereby contribute to pain
5
perception in IBS by activation of (intestinal) mast cells. As the innate function of macrophages is to be responsive to different intruders in the human body, it is suggested that these cells also own a signal-transmitting function upon pathogenic recognition. The dimorphic fungus Candida is indicated as a true intestinal resident, as it is present in the mammalian gut but not in food, and is furthermore consistently associated with the inflamed gut (Li, Leonardi, & Iliev, 2019). Therefore, and for the ample amount of conducted research on this species, Candida albicans is chosen as representative of relevant intestinal fungi. Supernatant inflammatory cytokine levels and inflammatory gene expression levels of human peripheral monocytes and monocyte-derived undifferentiated macrophages were examined after stimulation with fungal-derived, bacterial or chemical compounds. It could be concluded that in vitro stimulation of human monocytes and macrophages with bacterial-related lipopolysaccharides (LPS) induced an inflammatory reaction, although fungal-derived compounds failed to show a similar response. The present data suggest that monocytes and macrophages do not significantly contribute to the total amount of histamine upon fungal recognition, since elevation in HDC expression was absent. As these cells are important in homeostasis and immune reactions, a signal-transmitting role between intestinal fungi and pain perception in IBS will not be excluded based on this data, hence an alternative communication mechanism is proposed.
2. Materials & Methods
2.1 Laboratory journal
All experiments are recorded in the laboratory notebook #758 at the Tytgat Institute for Liver and Intestinal Research, Academic Medical Centre (AMC) in Amsterdam. Details of the used standard operating procedures (SOPs), methods and results can be obtained from there. This report was established from the notebook and from clarifying contact with the executive investigator of all experiments that were performed in the period of 31 July and 19 September 2018, I.A.M. van Thiel.
2.2 Cell culture
Buffy coat was isolated from the plasma of six healthy blood donors (received from Sanquin, Amsterdam, The Netherlands). Donors without any inflammations or wounds are considered ‘healthy’ by Sanquin, and in the case of IBS/IBD patients if they are free of complaints when donating.
To obtain human peripheral blood mononuclear cells (PBMCs) and monocytes (MCs), an adapted isolation protocol by Wildenberg & Prins was used. The MC fraction was obtained by density centrifugation of buffy coat over Ficoll. For PBMC isolation, the volume of the buffy coat was adjusted to 120 ml with sterile phosphate-buffered saline (PBS), followed by pipetting of 13 ml Ficoll (GE Healthcare Life Sciences) under the blood. After centrifugation (15 min at 950 g, no break), culture medium (RPMI + HEPES + 10% FCS+ 1% penicillin + 1% L-glutamine) was filled until 50 ml (spun 5 min at 700 g, acceleration 5, break 5). Obtained PBMCs were resuspended in RPMI culture medium (Gibco) until 12 ml per buffy coat.
MCs were isolated from this cell suspension using hyperosmotic Percoll (1.077 g/ml, VWR) in sterile water and 1.6M NaCl (spun 15 min at 580 g, room temperature). The interface was removed until the last 4 ml lymphocyte-containing fluid in the tube. This removed interface was completed with RPMI medium
6
(spun for 5 min. at 700 g), after which the MCs were resuspended in 10 ml RPMI culture medium. MCs were adjusted to 1 x 106 cells/ml, and cells from all six donors were used in further experiments.
MCs from donors 1-3 were in vitro stimulated into undifferentiated macrophages (MΦs). First, 5 x 105 MCs were incubated in a six-wells plate in 1 ml IMDM culture medium (IMDM + 10% FCS + 1% penicillin- streptomycin + 1% L-glutamine) for 90 minutes (37 °C, 5% CO2). Cells were washed three times with warm sterilized PBS. Maturation was accomplished by culturing the cells in IMDM medium and 20 ng/ml human M-CSF for three days (37 °C, 5% CO2), followed by further maturation for three days in only fresh IMDM medium and washing with warm sterilized PBS.
2.3 Stimulation of monocytes and monocyte-derived macrophages
To get insight in the differences in gene expression upon stimulation with different fungi-related, bacterial, and chemical components, MCs and MΦs were stimulated. Stimulation of MCs and MΦs was performed in one 12-wells plates (Greiner) for each donor sample, with the following compounds: lipopolysaccharides (LPS, 0.1 μg/ml, Bio-Connect, Huissen, The Netherlands), zymosan (5 μg/ml, Sigma-Aldrich), phorbol 12-myristate 13-acetate (PMA, 0.01 μg/ml, Sigma-Aldrich), particulate β-glucans (pBG, 5 μg/ml, kindly provided by the research group of Williams et al., 1991), compound 48/80 (1 x 103 μg/ml, Sigma-Aldrich), and heat-inactivated Candida albicans (1 x 105 cells/ml). Per condition 1 x 106 cells were seeded and after 1-hour adherence, medium was removed and freshly prepared stimulus was added. For MC donors 4-6, accidentally 2 x 106 cells were plated. As pilot data indicated a decrease of HDC expression over time, a limit was set on the incubation time in this experiment. After 4 hours incubation, the supernatant was removed and cells were lysed in 350 μl RLY + 1% β-mercapto-ethanol (BME) to harvest RNA. Samples were stored at -20 °C until further use.
To obtain insight in specific cytokine responses from MCs and MΦs upon stimulation with the described compounds, cells were stimulated in preparation for two enzyme-linked immunosorbent assays (ELISA). Per condition 1 x 105 cells were seeded in a 96-wells plate and after 1-hour adherence, cells were washed three times with warm PBS, and 200 μl stimulus was added. Supernatant was removed after 24 hours and transferred in a low-binding plate. Samples were stored at -20 °C, to use in cytokine ELISA.
2.4 Gene expression determination
To explore alterations in the expression of specific fungi and histamine related genes, quantitative polymerase chain reactions (qPCRs) were performed. Total RNA was isolated from lysed, stimulated MCs and MΦs samples using the Bioline ISOLATE II mini kit (GC biotech B.V., Alphen a/d Rijn, The Netherlands), according to manufacturer’s protocol. Subsequently, cDNA synthesis was performed on a PCR Thermocycler (MJ Research). A DNase step was excluded, since the Bioline RNA isolation kit already contains this. Each reaction used 0.1-2 μg RNA per total volume of 11 μl per sample (RNase free H2O added). The synthesis reaction was performed using dNTPs (ThermoFisher Scientific), Random hexamer primer (Promega, Leiden, The Netherlands), Oligo dT primer (Invitrogen), 100 U Revertaid (Fermentas/ThermoFisher) and 20 U RiboLock (Fermentas / ThermoFisher) were used. cDNA samples were stored at -20 °C.
7
480 (Roche) using a Ta = 60 °C programme, following manufacturer’s protocol. Expression levels were analysed of Dectin-1, histidine decarboxylase (HDC), interleukin (IL)-6, IL-10 and Tumour necrosis factor alpha (TNFα). Samples were diluted 16 times in Milli-Q water (MQ). Primer pair sequences (5 μM) can be found in Table 1. As reference genes, B2M and PPIA were used for MCs, and RPLP0 and 18S for MΦs. For every gene examined, the negative controls consisted of a no-template control (NTC), no-reverse-transcriptase control (RTC) and only MQ.
Table 1: Primer sequences
Gene Forward sequence Reverse sequence
Dectin-1 GACTGAGGTACCATGGCTCTG GGAGATGGGTTTTCTTGGGT
HDC CTGGTTCGTGATTCGGTCCT GGAAGAGACGGCCAGCTTTA
IL-6 AGTGAGGAACAAGCCAGAGC GTCAGGGGTGGTTATTGCAT
IL-10 GCCACCCTGATGTCTCAGTT GTGGAGCAGGTGAAGAATGC
TNFα CCTGCTGCACTTTGGAGTGA GAGGGTTTGCTACAACATGGG
B2M CTCGCGCTACTCTCTCTCTTTCT TGCTCCACTTTTTCAATTCTCT
PPIA ACGGCGAGCCCTTGG TTTCTGCTGTCTTTGGGACCT
RPLP0 TCATCAACGGGTACAAACGA GCCTTGACCTTTTCAGCAAG
18S GATGGGCGGCGGAAAATAG GCGTGGATTCTGCATAATGGT
2.5 Cytokine ELISA
Sandwich ELISA was performed in duplicate on the different stimulated cells in order to obtain insight in cytokine expression upon stimulation. Antibody DuoSets (R&D Diagnostics) were used for human 6, IL-10 and TNFα. Concentration determination and further processing was performed according to manufacturer’s protocol. All samples from the same donor were kept on one plate. Plates were coated with coating antibody overnight in 96-wells medium-binding plates at room temperature. All antibodies and samples were diluted in PBS + 1% Bovine Serum Albumin (BSA). Determined supernatant dilutions can be found in Table 2.
Table 2: Supernatant dilutions for cytokine ELISA
Antibody Monocytes Macrophages
hIL-6 1:20 1:10
hIL-10 1:3 1:3
hTNFα 1:20 1:10
2.6 Data analysis
For ELISA data, all values below the lower limit of quantification 31.25 pg/ml were marked and changed to 15 pg/ml to obtain reliable values. Furthermore, cells equal to or greater than 2098.438 ng/ml were marked and changed to 2100 ng/ml. As non-parametric tests are issued, these modifications do not influence test outcomes. Data analysis was followed by multiplication of all values by the used dilution factor, which resulted in the supernatant cytokine concentrations. Analysis of qPCR data was performed similarly for MCs
8
and MΦs using the following programmes: LightCycler 480 Software, LC480 Conversion (version 2014.1) and LinReg (version 2015.4). Deviating samples in melting curves were excluded, as well as samples too close to controls (ΔCt < 7 cycles). Undetermined gene expression values were changed to zero. For reference genes as well as genes of interest, both duplicates were excluded if one or both values were equal to zero. To create a reference gene expression, geometric mean was calculated from the two corresponding reference genes. Relative gene expressions of the genes of interest were normalized, by dividing by the control gene expression. In Prism 8.4.2 (GraphPad Software, La Jolla, CA), a Kruskall-Wallis test was performed to check both experiments for statistical significance, for qPCR data specifically on the relative expression of the genes of interest. To correct for multiple comparisons, Dunn’s multiple comparisons test was performed as well. All p-values (p) < 0.05 were considered significant. Figure 1 was created with BioRender.com, graphs in Figure 2 and 3 were created using Prism.
3. Results
An array of fungal-derived, bacterial and chemical compounds was used to obtain insight in the reactions of MCs and MΦs upon in vitro stimulation. As a cell viability assay (WST1, data not shown) demonstrated that all cells died as a result of the mast cell activating 48/80 stimulation, results of this compound were excluded from the analysis. This cell death can be attributed to an excessively high concentration of the compound that apparently was used. Since a high variability in donor samples was found for all experiments, more insight can be obtained from the data normalized against control, which can be found in Appendix II: Supplementary data.
3.1 Stimulated monocytes show limited fungal antigen response
MCs isolated from peripheral blood from six donors were isolated and stimulated with multiple compounds. Gene expression of reference genes and genes of interest were measured using qPCR, followed by calculation of relative gene expression to expression of reference genes. Samples were excluded when measurements of the reference genes were absent for one or both values. mRNA expression and supernatant cytokine concentrations for stimulated MCs can be found in Figure 2.
To assess whether MCs are able to produce histamine, the expression of the enzyme HDC was assessed in monocytes stimulated with various antigens. Upon LPS stimulation, a significant increase was found in mRNA expression (p = 0.053, see Figure 2B, C) and cytokine release of the pro-inflammatory cytokine TNFα (see Figure 2A, p = 0.018). Furthermore, supernatant IL-10 (p = 0.019) and TNFα (p = 0.018) increase was truly significant, as for IL-6 it was nearly significant (p = 0.057). Hence, cells were responsive to antigens. Similar results were obtained for zymosan stimulation (p = 0.020 and p = 0.008, mRNA and cytokine respectively). Normalization against control showed for IL-10 and TNFα more clustering of data than solely the relative expression (see Figure S1B). Nearly significant was the increase of gene expressions for IL-6 (p = 0.075), IL-10 (p = 0.070) and Dectin-1 (p = 0.056) upon LPS stimulation.
However, only limited responses by means of cytokine expression and release were observed for stimulation with fungal components, in contrast with previous data (i.a. Heinsbroek et al., 2006; Mori et al., 2018; Pinke et al., 2016). MCs showed only significantly elevated mRNA levels of Dectin-1 upon C. albicans
9
Figure 2: Supernatant cytokine concentrations (A) and relative gene expression profiles (B, C) of stimulated monocytes (MC). Cells were in vitro stimulated with the following compounds: ctrl = control; LPS = lipopolysaccharides; zym =
zymosans; PMA = phorbol 12-myristate 13-acetate; pBG = particulate β-glucans; CA = Candida albicans. Cytokine levels of interleukin (IL)-6, IL-10 and tumour necrosis factor alpha (TNFα) were determined in supernatant after 24 hours stimulation. Gene expression profiles were defined after 4 hours stimulation for hIL-6, hIL-10, hTNFα, Dectin-1 and histidine decarboxylase (HDC). Expression of reference genes B2M and PPIA were used to generate relative gene expression. Bars are shown as median with range. *: Kruskal-Wallis p<0.05. **: Kruskall-Wallis p<0.01.
10
stimulation (p = 0.039), although it was expected that fungal-derived pBG stimulation would as well show significant increase in this pathogenic recognition receptor. All other increases in gene expression in the genes of interest, after stimulation with non-specific cell stimulus PMA, pBG and the earlier mentioned compounds were not significant compared in MCs. Likewise, stimulation with other compounds than LPS or zymosan showed elevated, but non-significant results for cytokine levels. High variability was found after normalization against control (see Figure S1A,B,C), for example in TNFα levels of LPS- and zymosan-stimulated samples, where significance nevertheless was preserved after normalization (LPS: p = 0.014, zymosan: p = 0.036).
Moreover, expression of HDC remained unaltered upon in vitro stimulation with any of the compounds, variability in donors not taken into account. Taken together, these data show that, although MCs are responsive, there is a limited response against fungal antigens and HDC expression remains unaltered.
3.2 Macrophages show moderate to absent responses upon stimulations
To assess whether macrophages are able to produce histamine, the expression of the enzyme HDC was obtained in MΦs, derived from MCs of donors 1-3, that were stimulated with various antigens. Upon PMA stimulation MΦs showed a significant increase in supernatant TNFα production (p = 0.021), although a moderate increase was found in gene expression of TNFα (see Figure 3A, B). Similarly, for IL-6 this compound showed highly elevated supernatant levels for one of three donors, but for all three donors this was not significant. Stimulation with LPS resulted in visible, but not-significant increases in cytokine mRNA expression and release, but TNFα expression elevated near significantly (p = 0.058). Thus, cells were considered frugally responsive to bacterial-derived or non-specific stimuli, although normalized data showed that variability between donors is high (see Figure S2A, B, C).Expression levels of unstimulated cells were equal to zero for Dectin-1 and HDC, as these were below the lower limit of quantification, which resulted in absence of a reliable vehicle gene expression (see Figure 3C). Although previous research on Dectin-1 suggest this receptor is constitutively expressed on MΦs (Willment et al., 2005), a detectable mRNA expression was not observed in this data. Compared to an absent control, no significant increase was detected in mRNA expression upon any stimulation of this receptor involved in pathogenic recognition. Nevertheless, particulate β-glucans stimulation resulted in nearly significant increase of Dectin-1 (p = 0.071) and a moderate, non-significant increase in HDC mRNA expression. This sparing response was unexpected, as earlier research suggested significant recognition of particulate β-glucans by Dectin-1 (Tone, Stappers, Willment, & Brown, 2019). Furthermore, HDC expression did not alter significantly after stimulation with any of the compounds, whilst a detectable control value was absent. Stimulation with LPS, particulate β-glucans or C. albicans did show a moderate rise in mRNA levels of the rate-limiting enzyme.
The fungal-related compounds did not significantly alter cytokine expression or release, which also applies to stimulation with C. albicans. Cytokine concentrations of IL-10 and TNFα stimulated with these fungal-derived compounds, showed even levels below the lower limit of quantification. Besides a nearly significant increase in IL-6 mRNA expression (p = 0.0645), no significant changes were detected upon zymosan stimulation. Taken together, MΦs showed a limited (inflammatory) response upon stimulation with
11
Figure 3: Supernatant cytokine concentrations (A) and relative gene expression profiles (B, C) of stimulated monocyte-derived undifferentiated macrophages (MΦ). Cells were in vitro stimulated with the following compounds: ctrl = control;
LPS = lipopolysaccharides; zym = zymosans; PMA = phorbol 12-myristate 13-acetate; pBG = particulate β-glucans; CA = Candida albicans. Cytokine levels of interleukin (IL)-6, IL-10 and tumour necrosis factor alpha (TNFα) were determined in supernatant after 24 hours stimulation. Gene expression profiles were defined after 4 hours stimulation for hIL-6, hIL-10,
hTNFα, Dectin-1 and histidine decarboxylase (HDC). Expression of reference genes RPLP0 and 18S were used to generate
12
fungal-related compounds. Besides, no difference in HDC expression was detected in stimulated MΦs with any of the compounds.
4. Conclusion & Discussion
The present study aimed to get insight in the potential role of macrophages as an alternative histamine source upon stimulation with fungal-derived compounds. Greater understanding was provided about the way fungal recognition by peripheral immune cells contributes to the activation of (intestinal) mast cells. From examination of supernatant inflammatory cytokine levels and inflammatory gene expression levels of human peripheral MCs and MΦs, it could be concluded that both cells showed a moderate to absent inflammatory reaction upon fungal stimulation. Furthermore, HDC expression of both cell types remained unaltered, suggesting no increase in intracellular histamine production. Therefore, these results suggest that monocytes or macrophages do not significantly contribute to the total amount of histamine upon fungal recognition in the pathway that was researched here, contributing to VH in IBS. As described earlier, the results of Klooker et al. (2010) gave rise to the search for cells other than mast cells that could produce histamine. Since only monocytes and macrophages were included in this study, further research is necessary to include other cell types to find alternative histamine sources.
Both MCs and MΦs showed elevated cytokine release and gene expression levels after stimulation with bacterial and non-specific stimulating compounds, concluding that these cells were responsive upon pathogenic recognition. An exception needs to be made for the stimulation with β-glucans, included as a positive control of fungal recognition, as earlier research described this as a significant reaction in these cells (Tone et al., 2019) or mast cells (Botschuijver et al., 2017). The bacterial responsiveness should also be an indication for a reaction on fungi, in this study defined as increased mRNA expression of the fungal surface receptor Dectin-1. Interestingly, fungal-derived compounds caused a decrease in MCs and a minimal increase in MΦs of the relative Dectin-1 gene expression. The absence of the control expression for MΦs is a limitation of this study since no accurate increase of this receptor could be interpreted. Nevertheless, this unexpected result, together with the lack of inflammatory response determined by the cytokines or genes of interest, could have been influenced by several factors.
First of all, the morphology of Candida albicans could have been affecting the data, as the fungus could have been present in yeast or hyphal form. The dimorphic nature of C. albicans is well known to influence its pathogenesis: the hyphal form is known to promote invasive disease and to disrupt epithelial cells by excretion of candidalysin (Paterson et al., 2017). Furthermore, the ability to switch to its hyphal form is linked to adaptation to survival in the gastro-intestinal tract (Fiers, Gao, & Iliev, 2019). If the heat-inactivated C. albicans were mostly yeast forms, the pathogenic character was decreased, which could apply to the inflammatory reaction as well. As the immune system discriminates the state of C. albicans by abundance of two different glucan structures (Lowman et al., 2014), it is likely that the observed moderate response to particulate β-glucans is related to the less pathogenic yeast state these were possibly derived from. Besides the morphology, the fungi concentrations may have been too low, as a five hundred- to thousand-times higher concentration was successfully used in earlier pilot data (data not shown).
13
Second, the presence of CX3CR1, a fractalkine receptor on mononuclear phagocytes (MNPs), could explain the absence of a significant response. Earlier research found that CX3CR1+ MNPs in the lamina propria show a high amount of Dectin-1 and IL-10, express more antifungal receptors and recognize C. albicans (Leonardi et al., 2018; Li et al., 2019). Furthermore, they represent the majority of intestinal macrophages in healthy intestine (Li et al., 2019). The used MCs and MΦs were not tested on CX3CR1. Therefore, it is possible they were negative, which resulted in a decreased pathogenic recognition and inflammatory response.
Third, respectively twice as much cells and stimuli were used for MC donors 4, 5 and 6. Even though the respective amount of stimulus per cell was equal to the other experiments, the greater total volume could have been influencing the outcomes for these three donors, resulting in differences when compared with donors 1, 2 and 3.
Earlier research emphasized the essential role of resident intestinal macrophages in intestinal homeostasis and described the current understanding of the ontology of these cells: a part of their pool is replenished by blood monocytes, from which they differentiate, and another part maintains as a long-lived population (Ginhoux & Jung, 2014; Viola & Boeckxstaens, 2020). Furthermore, macrophages and monocytes are key actors of the innate immune system and presumed important in inflammatory diseases (Ma, Gao, Gu, & Chen, 2019). Since the data in this study did not imply a complete rejection of a signal-transmitting role between intestinal fungi and VH in IBS for monocytes and macrophages, a possible alternative function of these two cell types is proposed. Figure 1 shows the known mechanisms of fungal recognition via Dectin-1 on mast cells during stress-induced intestinal epithelial barrier dysfunction towards H1R activation. A mechanism of communicating via fungal-derived, monocyte- or macrophage-related indirect mast cell activation is suggested: the direct mechanism of the peripheral cells functioning as an alternative source of histamine is replaced by a mechanism of alternative mast cell activation upon fungal recognition, contributing towards H1R activation. This extension of the mechanism described by Botschuijver et al. (2017) paves the way for future research on the signal-transmitting role of monocytes and/or macrophages towards mast cell degranulation and intestinal histamine production and explains the unaltered histamine concentration upon mast cell inhibitors, as described by Klooker et al. (2010).
Future research is recommended to focus on this proposed and other alternative communication mechanisms that include alternative mast cell activators or H1R stimulators, to get insight in the activation towards intestinal pain. Determination of supernatant histamine could be used as a measurement since this was absent in the present study. In addition, measuring the increase of histamine levels by HDC in time, together with gene expression profiles of HDC upon different stimulations, could be another interesting measurement to expand the results of this experiment. Furthermore, a test on CX3CR1 for the PBMCs that will be used is advised to be included, as cells with a high prevalence will represent intestinal macrophages the best. Finally, further research can include different isoforms of human Dectin-1, as Willment et al. (2005) identified two functional isoforms of this β-glucan receptor (βGR-A and βGR-B). They suggested a peripheral cell-specific control of the isoform expression, thereby contributing to an adequate inflammatory response to β-glucans. Moreover, Heinsbroek et al. (2006) showed isoform dependent differences in
14
recognition and inducement of cellular responses upon zymosan recognition. This implies that an adequate response to the fungal cell wall is related to the isoform; an insight that was not included in the present study. In addition, research on Dectin-1 could take the response of TLRs to pathogens into account, since Dectin-1 is known to synergize with TLR2 and TLR4 for cytokine production in human primary monocytes and macrophages (Ferwerda, Meyer-Wentrup, Kullberg, Netea, & Adema, 2008; Yadav & Schorey, 2006).
All in all, this research shows no significant signs of a fungal-induced, monocyte- or macrophage-derived mechanism of histamine production contributing to VH. However, the options for further in-depth characterization of the specific communication mechanisms towards intestinal pain in IBS are complex, as presented here, but nevertheless considered urgent.
5. Acknowledgements
First, I want to express my gratitude to my supervisor Isabelle van Thiel for letting me use data she obtained in the past, and for guiding me all the way through this bachelor’s project. Even though we did not meet in person due to the Covid-19 lockdown measures, I was very lucky to still have her support and ideas (digitally) close and to learn a lot from transposing her data into this thesis. Furthermore, I would like to thank René van den Wijngaard, for giving me the opportunity in the first place to do my research project with his research group at the Tytgat Institute for Liver and Intestinal Research, as well as for considering the adjustments that were necessary to be made in the project before and during my writing. At last, I express my gratitude to the coordinators of the University of Amsterdam Biomedical Sciences bachelor’s project, for making it possible for bachelor students to finish their programme this year, despite the restrictions that were made on practical work regarding this exceptional situation.
6. References
Blander, J. M., Longman, R. S., Iliev, I. D., Sonnenberg, G. F., & Artis, D. (2017). Regulation of inflammation by microbiota interactions with the host. Nature Immunology, Vol. 18, 851–860. https://doi.org/10.1038/ni.3780
Botschuijver, S., Roeselers, G., Levin, E., Jonkers, D. M., Welting, O., Heinsbroek, S. E. M., … van den Wijngaard, R. M. (2017). Intestinal Fungal Dysbiosis Is Associated With Visceral Hypersensitivity in Patients With Irritable Bowel Syndrome and Rats. Gastroenterology, 153(4), 1026–1039. https://doi.org/10.1053/j.gastro.2017.06.004
Bulfone-Paus, S., Nilsson, G., Draber, P., Blank, U., & Levi-Schaffer, F. (2017). Positive and Negative Signals in Mast Cell Activation. Trends in Immunology, Vol. 38, 657–667. https://doi.org/10.1016/j.it.2017.01.008
Carlos, D., Sá-Nunes, A., de Paula, L., Matias-Peres, C., Jamur, M. C., Oliver, C., … Faccioli, L. H. (2006). Histamine modulates mast cell degranulation through an indirect mechanism in a model IgE-mediated reaction. European
Journal of Immunology, 36(6), 1494–1503. https://doi.org/10.1002/eji.200535464
Ferwerda, G., Meyer-Wentrup, F., Kullberg, B. J., Netea, M. G., & Adema, G. J. (2008). Dectin-1 synergizes with TLR2 and TLR4 for cytokine production in human primary monocytes and macrophages. Cellular Microbiology, 10(10), 2058– 2066. https://doi.org/10.1111/j.1462-5822.2008.01188.x
Fiers, W. D., Gao, I. H., & Iliev, I. D. (2019). Gut mycobiota under scrutiny: fungal symbionts or environmental transients?
Current Opinion in Microbiology, Vol. 50, 79–86. https://doi.org/10.1016/j.mib.2019.09.010
Gilfillan, A. M., & Tkaczyk, C. (2006). Integrated signalling pathways for mast-cell activation. Nature Reviews Immunology, Vol. 6, 218–230. https://doi.org/10.1038/nri1782
Ginhoux, F., & Jung, S. (2014). Monocytes and macrophages: Developmental pathways and tissue homeostasis. Nature
Reviews Immunology, Vol. 14, 392–404. https://doi.org/10.1038/nri3671
15
Expression of Functionally Different Dectin-1 Isoforms by Murine Macrophages. The Journal of Immunology, 176(9), 5513–5518. https://doi.org/10.4049/jimmunol.176.9.5513
Keszthelyi, D., Troost, F. J., & Masclee, A. A. (2012). Irritable Bowel Syndrome: Methods, Mechanisms, and
Pathophysiology. Methods to assess visceral hypersensitivity in irritable bowel syndrome. Am J Physiol Gastroin-Test
Liver Physiol, 303, 141–154. https://doi.org/10.1152/ajpgi.00060.2012.-Irritable
Klooker, T. K., Braak, B., Koopman, K. E., Welting, O., Wouters, M. M., Van Der Heide, S., … Boeckxstaens, G. E. (2010). The mast cell stabiliser ketotifen decreases visceral hypersensitivity and improves intestinal symptoms in patients with irritable bowel syndrome. Gut, 59(9), 1213–1221. https://doi.org/10.1136/gut.2010.213108
Leonardi, I., Li, X., Semon, A., Li, D., Doron, I., Putzel, G., … Iliev, I. D. (2018). CX3CR1+, mononuclear phagocytes control immunity to intestinal fungi. Science, 359(6372), 232–236. https://doi.org/10.1126/science.aao1503 Li, X. V., Leonardi, I., & Iliev, I. D. (2019). Gut Mycobiota in Immunity and Inflammatory Disease. Immunity, Vol. 50,
1365–1379. https://doi.org/10.1016/j.immuni.2019.05.023
Limon, J. J., Skalski, J. H., & Underhill, D. M. (2017). Commensal Fungi in Health and Disease. Cell Host and Microbe, Vol. 22, 156–165. https://doi.org/10.1016/j.chom.2017.07.002
Limon, J. J., Kershaw, K. M., & Underhill, D. M. (2018). Mucosal immune responses to fungi and the implications for inflammatory bowel disease. Current Opinion in Gastroenterology, Vol. 34, 398–403.
https://doi.org/10.1097/MOG.0000000000000483
Lowman, D. W., Greene, R. R., Bearden, D. W., Kruppa, M. D., Pottier, M., Monteiro, M. A., … Williams, D. L. (2014). Novel structural features in Candida albicans Hyphal Glucan Provide a basis for differential Innate Immune recognition of Hyphae Versus Yeast. Journal of Biological Chemistry, 289(6), 3432–3443.
https://doi.org/10.1074/jbc.M113.529131
Ma, W. T., Gao, F., Gu, K., & Chen, D. K. (2019). The role of monocytes and macrophages in autoimmune diseases: A comprehensive review. Frontiers in Immunology, Vol. 10, 1140. https://doi.org/10.3389/fimmu.2019.01140 Mori, K., Naganuma, M., Mizuno, S., Suzuki, H., Kitazume, M. T., Shimamura, K., … Kanai, T. (2018). ß-(1,3)-Glucan
derived from Candida albicans induces inflammatory cytokines from macrophages and lamina propria mononuclear cells derived from patients with Crohn’s disease. Intestinal Research, 16(3), 384–392.
https://doi.org/10.5217/ir.2018.16.3.384
Paterson, M. J., Oh, S., & Underhill, D. M. (2017). Host–microbe interactions: commensal fungi in the gut. Current Opinion
in Microbiology, Vol. 40, 131–137. https://doi.org/10.1016/j.mib.2017.11.012
Pinke, K. H., Lima, H. G. de, Cunha, F. Q., & Lara, V. S. (2016). Mast cells phagocyte Candida albicans and produce nitric oxide by mechanisms involving TLR2 and Dectin-1. Immunobiology, 221(2), 220–227.
https://doi.org/10.1016/j.imbio.2015.09.004
Rahabi, M., Jacquemin, G., Prat, M., Meunier, E., AlaEddine, M., Bertrand, B., … Coste, A. (2020). Divergent Roles for Macrophage C-type Lectin Receptors, Dectin-1 and Mannose Receptors, in the Intestinal Inflammatory Response. Cell
Reports, 30(13), 4386-4398.e5. https://doi.org/10.1016/j.celrep.2020.03.018
Stanisor, O. I., van Diest, S. A., Yu, Z., Welting, O., Bekkali, N., Shi, J., … van den Wijngaard, R. M. (2013). Stress-Induced Visceral Hypersensitivity in Maternally Separated Rats Can Be Reversed by Peripherally Restricted Histamine-1-Receptor Antagonists. PLoS ONE, 8(6), 1-8. https://doi.org/10.1371/journal.pone.0066884
Tone, K., Stappers, M. H. T., Willment, J. A., & Brown, G. D. (2019). C-type lectin receptors of the Dectin-1 cluster: Physiological roles and involvement in disease. European Journal of Immunology, Vol. 49, 2127–2133. https://doi.org/10.1002/eji.201847536
Van Den Wijngaard, R. M., Klooker, T. K., Welting, O., Stanisor, O. I., Wouters, M. M., Van Der Coelen, D., …
Boeckxstaens, G. E. (2009). Essential role for TRPV1 in stress-induced (mast cell-dependent) colonic hypersensitivity in maternally separated rats. Neurogastroenterology and Motility, 21(10), 1107-e94. https://doi.org/10.1111/j.1365-2982.2009.01339.x
Viola, M. F., & Boeckxstaens, G. (2020). Intestinal resident macrophages: Multitaskers of the gut. Neurogastroenterology
and Motility, 1–12. https://doi.org/10.1111/nmo.13843
Wheeler, M. L., Limon, J. J., Bar, A. S., Leal, C. A., Gargus, M., Tang, J., … Iliev, I. D. (2016). Immunological Consequences of Intestinal Fungal Dysbiosis. Cell Host and Microbe, 19(6), 865–873.
https://doi.org/10.1016/j.chom.2016.05.003
Williams, D. L., McNamee, R. B., Jones, E. L., Pretus, H. A., Ensley, H. E., Browder, I. W., & Di Luzio, N. R. (1991). A method for the solubilization of a (1→3)-β-d-glucan isolated from Saccharomyces cerevisiae. Carbohydrate Research,
16
Willment, J. A., Marshall, A. S., Reid, D. M., Williams, D. L., Wong, S. Y. C., Gordon, S., & Brown, G. D. (2005). The human β-glucan receptor is widely expressed and functionally equivalent to murine Dectin-1 on primary cells.
European Journal of Immunology, 35(5), 1539–1547. https://doi.org/10.1002/eji.200425725
Wouters, M. M., Balemans, D., Van Wanrooy, S., Dooley, J., Cibert-Goton, V., Alpizar, Y. A., … Boeckxstaens, G. E. (2016). Histamine Receptor H1-Mediated Sensitization of TRPV1 Mediates Visceral Hypersensitivity and Symptoms in Patients with Irritable Bowel Syndrome. Gastroenterology, 150(4), 875-887.
https://doi.org/10.1053/j.gastro.2015.12.034
Yadav, M., & Schorey, J. S. (2006). The β-glucan receptor dectin-1 functions together with TLR2 to mediate macrophage activation by mycobacteria. Blood, 108(9), 3168–3175. https://doi.org/10.1182/blood-2006-05-024406
17
Appendices
I. Abbreviations
BME = β-mercapto-ethanol BSA = bovine serum albuminCA = heat-inactivated Candida albicans CLR = C-type lectin receptor
CRF = corticotrophin releasing factor
ELISA = enzyme-bound immunosorbent analysis H1R = histamine-1 receptor
HDC = histidine carboxylase IBS = irritable bowel syndrome IL = interleukin
LPS = lipopolysaccharides
MCs = monocytes, obtained from healthy human PBMCs MNPs = mononuclear phagocytes
MΦs = monocyte-derived undifferentiated macrophages pBG = particulate β-glucans
PBMCs = peripheral blood mononuclear cells PBS = phosphate-buffered saline
PMA = phorbol 12-myristate 13-acetate qPCR = quantitative polymerase chain reaction SOPs = standard operating procedure
TLR = Toll-like receptor TNF = tumour necrosis factor
TRPV1 = transient reporter potential channel V1 VH = visceral hypersensitivity
18
Figure S1:Data normalized against control of supernatant cytokine concentrations (A) and relative gene expression profiles (B, C) of monocytes (MC). Cells were in vitro stimulated with the following compounds: ctrl = control; LPS =
lipopolysaccharides; zym = zymosans; PMA = phorbol 12-myristate 13-acetate; pBG = particulate β-glucans; CA = Candida albicans. Cytokine levels of interleukin (IL)-6, IL-10 and tumour necrosis factor alpha (TNFα) were determined in
supernatant after 24 hours stimulation. Gene expression profiles were defined after 4 hours stimulation for hIL-6, hIL-10,
hTNFα, Dectin-1 and histidine decarboxylase (HDC). Expression of reference genes B2M and PPIA were used to generate
relative gene expression. If control value was equal to zero, normalization was excluded for that stimulus. Bars are shown as median with range. *: Kruskal-Wallis p<0.05.
19
Figure S2:Data normalized against control of supernatant cytokine concentrations (A) and relative gene expression profiles (B, C) of stimulated monocyte-derived undifferentiated macrophages (MΦ). Cells were in vitro stimulated with the following compounds: ctrl =
control; LPS = lipopolysaccharides; zym = zymosans; PMA = phorbol 12-myristate 13-acetate; pBG = particulate β-glucans; CA = Candida albicans. Cytokine levels of interleukin (IL)-6, IL-10 and tumour necrosis factor alpha (TNFα) were determined in supernatant after 24 hours stimulation. Gene expression profiles were defined after 4 hours stimulation for hIL-6, hIL-10, hTNFα, Dectin-1 and histidine decarboxylase (HDC). When control value was equal to zero, normalization was excluded for that stimulus. Expression of reference genes
