• No results found

Functional status and quality of life after treatment of peripheral arterial disease - List of publications

N/A
N/A
Protected

Academic year: 2021

Share "Functional status and quality of life after treatment of peripheral arterial disease - List of publications"

Copied!
3
0
0

Bezig met laden.... (Bekijk nu de volledige tekst)

Hele tekst

(1)

UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl)

UvA-DARE (Digital Academic Repository)

Functional status and quality of life after treatment of peripheral arterial disease

Frans, F.A.

Publication date

2013

Link to publication

Citation for published version (APA):

Frans, F. A. (2013). Functional status and quality of life after treatment of peripheral arterial

disease.

General rights

It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons).

Disclaimer/Complaints regulations

If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible.

(2)

160

LIST OF PUBLICATIONS

Frans FA, Nieuwkerk PT, Met R, Bipat S, Legemate DA, Reekers JA, Koelemay MJW. Statistical or clinical improvement? Determining the minimally important difference for the Vascular Quality of Life questionnaire in patients with critical limb ischemia. Accepted for publication in the European Journal of Vascular and Endovascular Surgery.

Frans FA, Met R, Koelemay MJW, Bipat S, Dijkgraaf MGW, Legemate DA, Reekers JA. Changes in functional status after treatment of critical limb ischemia. J Vasc Surg. 2013;58(4):957-965 Frans FA, Zagers MB, Jens S, Bipat S, Reekers JA, Koelemay MJ. The relationship of walking distances estimated by the patient, on the corridor and on a treadmill, and the Walking Impairment Questionnaire in intermittent claudication. J Vasc Surg. 2013 Mar;57(3):720-727 Frans FA, Koelemay MJ. Letter by Frans and Koelemay regarding article, “supervised exercise versus primary stenting for claudication resulting from aortoiliac peripheral artery disease: six-month outcomes from the Claudication: Exercise Versus Endoluminal Revascularization (CLEVER) study”. Circulation. 2012 Aug ;126(7)

Frans FA, Koelemay MJ. Author’s reply: Systematic review of exercise training or

percutaneous transluminal angioplasty for intermittent claudication (Br J Surg 2012 99 16-28). Br J Surg. 2012 Jun;99(6):881

Frans FA, Bipat S, Reekers JA, Legemate DA, Koelemay MJ; SUPER Study Collaborators. SUPERvised exercise therapy or immediate PTA for intermittent claudication in patients with an iliac artery obstruction--a multicentre randomised controlled trial; SUPER study design and rationale. Eur J Vasc Endovasc Surg. 2012 Apr;43(4):466-71.

Frans FA, van Wijngaarden SE, Met R, Koelemay MJ. Validation of the Dutch version of the VascuQol questionnaire and the Amsterdam linear disability score in patients with intermittent claudication. Qual Life Res. 2012 Oct;21(8):1487-93

Frans FA, Bipat S, Reekers JA, Legemate DA, Koelemay MJ. Systematic review of exercise training or percutaneous transluminal angioplasty for intermittent claudication. Br J Surg. 2012 Jan;99(1):16-28.

(3)

161

Frans FA, Koelemay MJ. Regarding “an analysis of relationship between quality of life indices and clinical improvement following intervention in patients with intermittent claudication due to femoropopliteal disease”. J Vasc Surg. 2011 Apr;53(4):1164; author reply

Frans FA, van Zuijlen PP, Griot JP, van der Horst CM. Assessment of scar quality after cleft lip closure. Cleft Palate Craniofac J. 2012 Mar;49(2):171-6.

Frans FA, van de Ven A. Een jonge vrouw met een acute progressie van jarenlang bestaande buikklachten. Ned Tijdschr Heelk juni 2010

Frans FA, Keli SO, Maduro AE. The epidemiology of burns in a medical center in the Caribbean.Burns. 2008 Dec;34(8):1142-8. CH A PT ER 9 · L IS T O F P U BL IC ATIO N S

Referenties

GERELATEERDE DOCUMENTEN

36 (a) Department of Modern Physics and State Key Laboratory of Particle Detection and Electronics, University of Science and Technology of China, Anhui; (b) School of Physics,

In Sensitivity Heuristic and Dynamic Selection, individual and group behavior of neural networks are regularized to improve the performance of the model.... In Sensitivity Heuristic,

At present, we do not have sufficient data to define a Xenopus L5-5S RNA interaction site and the nature of the interaction, However, the combination o f observations

These results suggest that L11 mutants relaxed the stringent response; the overexpressed L11 mutants also inhibited RelA activity during the amino acid

  GGATCCAGTGGCGATGAGTTCTCGTTGGATCATGTAAACGCATTCTGTGAGCTGACGAAGCAGT

In the present study, recombinant TFllIA proteins containing a series of scanning sequence substitution mutations within the N-terminal first three zinc fingers

Finally I show how in the Eclogues Virgil engages with a third poetic genre, (cosmological) didactic, and how this engagement reflects both an Epicurean interest in the