• No results found

Functional status and quality of life after treatment of peripheral arterial disease - Curriculum vitae

N/A
N/A
Protected

Academic year: 2021

Share "Functional status and quality of life after treatment of peripheral arterial disease - Curriculum vitae"

Copied!
2
0
0

Bezig met laden.... (Bekijk nu de volledige tekst)

Hele tekst

(1)

UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl)

UvA-DARE (Digital Academic Repository)

Functional status and quality of life after treatment of peripheral arterial disease

Frans, F.A.

Publication date

2013

Link to publication

Citation for published version (APA):

Frans, F. A. (2013). Functional status and quality of life after treatment of peripheral arterial

disease.

General rights

It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons).

Disclaimer/Complaints regulations

If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible.

(2)

171

CURRICULUM VITAE

Franceline Alkine Frans is geboren op 22 december 1980 te Utrecht en groeit op in het Veluwse Voorthuizen. In 1999 behaalt ze haar gymnasium diploma aan het stedelijk gymnasium Johan van Oldenbarnevelt te Amersfoort. Aansluitend start ze in hetzelfde jaar met de studie Geneeskunde aan de Rijks Universiteit Groningen. Tijdens haar eerste studiejaar is ze wedstrijdroeier en maakt hierna deel uit van diverse commissies bij de Groninger Studenten Roeivereniging Aegir met als hoogtepunt de lustrumcommissie “Masters of the Universe” ter ere van het 125 jarig bestaan. Na het doorlopen van het eerste jaar van haar coschappen in het UMCG en omliggende regionale ziekenhuizen vervolgt zij haar coschappen in het Sint Elisabeth Hospitaal te Curaçao. Na haar coschappen zet ze de eerste stappen op wetenschappelijk vlak onder leiding van Dr. A.E. Maduro en Dr. S.O. Keli naar de epidemiologie van brandwonden op Curaçao. Dit resulteert in haar eerste publicatie en tevens verschijnt ze hiermee op de voorpagina van de lokale Curaçaose krant Amigoe. Weer terug in Nederland verricht ze haar keuze coschap en aansluitend wetenschappelijke stage op de afdeling Plastische Reconstructieve en Handchirurgie in het Academisch Medisch Centrum te Amsterdam onder leiding van Prof. Dr. C.M.A.M. van der Horst. Na het behalen van haar arts examen eind augustus 2007, werkt zij als arts-assistent op de afdeling Heelkunde in het Diakonessenhuis te Utrecht onder leiding van Dr. G.J. Clevers. In augustus 2009 begint zij aan haar promotieonderzoek op de afdelingen interventieradiologie en vaatchirurgie in het Academisch Medisch Centrum onder leiding van Prof. Dr. J.A. Reekers en Dr. M.J.W. Koelemay, wat heeft geresulteerd in dit proefschrift. Haar belangrijkste project is het opstarten en coördineren van de SUPER studie, een multicenter gerandomiseerde studie naar de beste behandeling voor patiënten met claudicatio intermittens op basis van een iliacale obstructie (dotteren of gesuperviseerde looptraining). Sinds januari 2013 is zij in opleiding tot chirurg in het Gelre ziekenhuis te Apeldoorn (Dr. P. van Duijvendijk), welke zij zal voortzetten in het Academisch Medisch Centrum te Amsterdam (Prof. Dr. O.R.C. Busch) en het Antoni van Leeuwenhoek ziekenhuis (Prof. Dr. E.J.Th Rutgers). Franceline woont in Amsterdam en in haar vrije tijd verruilt ze graag de stad voor een ritje te paard door het Amsterdamse Bos. CH A PT ER 9 · C U RR IC U LU M V ITA E

Referenties

GERELATEERDE DOCUMENTEN

36 (a) Department of Modern Physics and State Key Laboratory of Particle Detection and Electronics, University of Science and Technology of China, Anhui; (b) School of Physics,

In Sensitivity Heuristic and Dynamic Selection, individual and group behavior of neural networks are regularized to improve the performance of the model.... In Sensitivity Heuristic,

At present, we do not have sufficient data to define a Xenopus L5-5S RNA interaction site and the nature of the interaction, However, the combination o f observations

C-terminus of RelA contains the domain responsible for the ribosome-binding 73 Relaxation of the stringent response by overexpression of ‘RelA 75 Displacement of ribosome-bound

These results suggest that L11 mutants relaxed the stringent response; the overexpressed L11 mutants also inhibited RelA activity during the amino acid

  GGATCCAGTGGCGATGAGTTCTCGTTGGATCATGTAAACGCATTCTGTGAGCTGACGAAGCAGT

Finally I show how in the Eclogues Virgil engages with a third poetic genre, (cosmological) didactic, and how this engagement reflects both an Epicurean interest in the