The role of intracellular thyroid hormone metabolism in innate immune cells

(1)

UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl)

van der Spek, A.H.

Publication date

2018

Document Version

Other version

License

Other

Link to publication

Citation for published version (APA):

van der Spek, A. H. (2018). The role of intracellular thyroid hormone metabolism in innate

immune cells.

General rights

It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s)

and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open

content license (like Creative Commons).

Disclaimer/Complaints regulations

If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please

let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material

inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter

to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You

will be contacted as soon as possible.

(2)

516644-L-bw-spek 516644-L-bw-spek 516644-L-bw-spek 516644-L-bw-spek Processed on: 16-5-2018 Processed on: 16-5-2018 Processed on: 16-5-2018

Processed on: 16-5-2018 PDF page: 104PDF page: 104PDF page: 104PDF page: 104

TRIIODOTHYRONINE IS ESSENTIAL FOR

OPTIMAL MACROPHAGE FUNCTION

Anne H. van der Spek, Olga V. Surovtseva, Kin Ki Jim, Adri van Oudenaren,

Matthijs C. Brouwer, Christina M.J.E. Vandenbroucke-Grauls, Pieter J.M. Leenen,

Diederik van de Beek, Arturo Hernandez, Eric Fliers, Anita Boelen

Manuscript accepted for publication

TRIIODOTHYRONINE IS ESSENTIAL FOR

OPTIMAL MACROPHAGE FUNCTION

Anne H. van der Spek, Olga V. Surovtseva, Kin Ki Jim, Adri van Oudenaren,

Matthijs C. Brouwer, Christina M.J.E. Vandenbroucke-Grauls, Pieter J.M. Leenen,

Diederik van de Beek, Arturo Hernandez, Eric Fliers, Anita Boelen

(3)

106

Abstract

Innate ilemmune cells, including macrophages, have recently been identified as novel target cells for thyroid hormone. We hypothesized that optimal intracellular concentrations of the active thyroid hormone triiodothyronine (T3) are essential for pro-inflammatory macrophage function. T3 is generated intracellularly by type 2 deiodinase (D2) and acts via the nuclear thyroid hormone receptor (TR). In zebrafish embryos, D2 knockdown increased mortality during pneumococcal meningitis. Primary murine D2KO macrophages exhibited impaired phagocytosis and partially reduced cytokine response to stimulation with bacterial endotoxin. These effects are presumably due to reduced intracellular T3 availability. Knockdown of the main TR in macrophages, TRα, impaired polarization into pro-inflammatory (M(LPS+IFNγ)) macrophages and amplified polarization into immunomodulatory (M(IL-4)) macrophages.

Intracellular T3 availability and action appear to play a crucial role in macrophage function. Our data suggest that low intracellular T3 action has an anti-inflammatory effect, possibly due to an effect on macrophage polarization mediated via the TRα. This study provides important novel insights into the link between the endocrine and innate immune system.

107

7 Introduction

Thyroid hormones are essential for growth, development and energy metabolism (Brent, 2012). Innate immune cells have recently been identified as novel thyroid hormone (TH) target cells (for review see (van der Spek et al., 2017b)). Macrophages are important innate immune cells that play essential roles in tissue homeostasis and immunity. Macrophage dysfunction has been linked to a large number of pathophysiological conditions including cancer, diabetes, inflammatory bowel disease and atherosclerosis (Wynn et al., 2013). Triiodothyronine (T3), the active form of TH, is important for adequate macrophage function (Kwakkel et al., 2014).

Thyroid hormone is produced by the thyroid gland mainly as the prohormone thyroxine (T4). Once taken up by the cell, T4 needs to be converted into T3, the active hormone, in order to exert its action. To this end, macrophages contain type 2 deiodinase (D2). This enzyme belongs to a family of enzymes, the deiodinases, that activate or inactivate the different molecular forms of intracellular TH. D2 is the TH-activating deiodinase, which converts T4 to T3 (Gereben et al., 2008). T3 then binds the nuclear TH receptor (TR) in order to regulate gene transcription. TR expression is differentially regulated with different cell types expressing different isoforms (Cheng et al., 2010). The predominant isoform in macrophages is TRα (Kwakkel et al., 2014). In addition its classic transcriptional effects, T3 also has non-genomic effects (Davis et al., 2016). Macrophages that lack D2, and thus presumably have lower intracellular T3 levels, exhibit an impaired pro-inflammatory cytokine response to stimulation with bacterial endotoxin (lipopolysaccharide, LPS) and impaired phagocytosis (Kwakkel et al., 2014). Furthermore, murine macrophages derived from mice that lack TRα (TRαKO) and therefore cannot mediate T3-dependent gene transcription also display functional abnormalities, including impaired cholesterol efflux and increased pro-inflammatory cytokines at baseline (Billon et al., 2014, Furuya et al., 2017), but reduced pro-inflammatory cytokine response to LPS (Kwakkel et al., 2014).

Macrophages are phagocytic cells that are capable of a wide range of functions in vivo. In response to stimuli from their microenvironment, macrophages can shift between a pro-inflammatory and an anti-inflammatory phenotype, a process known as polarization, making them key players in the regulation of the local immune response (Sica and Mantovani, 2012). Pro-inflammatory classically activated macrophages, or M1-like macrophages, are important for microbial killing and the recruitment and activation of other immune cells (Wynn et al., 2013). In contrast, anti-inflammatory alternatively activated macrophages, or M2-like macrophages encompass a heterogeneous spectrum of phenotypes that play a role in tissue homeostasis, remodeling and repair (Wynn et al., 2013).

We hypothesized that optimal intracellular T3 concentrations are essential for pro-inflammatory macrophage function. To test this hypothesis we determined the effects of reduced intracellular T3 generation due to D2KO in vivo in a zebrafish embryo model of pneumococcal meningitis. In addition, we assessed the effect of reduced intracellular T3 on ex vivo pro-inflammatory macrophage function using bone marrow-derived macrophages from D2 knock out (KO) mice. Finally, to determine the role of intracellular T3 in macrophage polarization we analyzed the effects of modulation of intracellular

(4)

106

Abstract

Innate ilemmune cells, including macrophages, have recently been identified as novel target cells for thyroid hormone. We hypothesized that optimal intracellular concentrations of the active thyroid hormone triiodothyronine (T3) are essential for pro-inflammatory macrophage function. T3 is generated intracellularly by type 2 deiodinase (D2) and acts via the nuclear thyroid hormone receptor (TR). In zebrafish embryos, D2 knockdown increased mortality during pneumococcal meningitis. Primary murine D2KO macrophages exhibited impaired phagocytosis and partially reduced cytokine response to stimulation with bacterial endotoxin. These effects are presumably due to reduced intracellular T3 availability. Knockdown of the main TR in macrophages, TRα, impaired polarization into pro-inflammatory (M(LPS+IFNγ)) macrophages and amplified polarization into immunomodulatory (M(IL-4)) macrophages.

Intracellular T3 availability and action appear to play a crucial role in macrophage function. Our data suggest that low intracellular T3 action has an anti-inflammatory effect, possibly due to an effect on macrophage polarization mediated via the TRα. This study provides important novel insights into the link between the endocrine and innate immune system.

107

7 Introduction

Thyroid hormones are essential for growth, development and energy metabolism (Brent, 2012). Innate immune cells have recently been identified as novel thyroid hormone (TH) target cells (for review see (van der Spek et al., 2017b)). Macrophages are important innate immune cells that play essential roles in tissue homeostasis and immunity. Macrophage dysfunction has been linked to a large number of pathophysiological conditions including cancer, diabetes, inflammatory bowel disease and atherosclerosis (Wynn et al., 2013). Triiodothyronine (T3), the active form of TH, is important for adequate macrophage function (Kwakkel et al., 2014).

Thyroid hormone is produced by the thyroid gland mainly as the prohormone thyroxine (T4). Once taken up by the cell, T4 needs to be converted into T3, the active hormone, in order to exert its action. To this end, macrophages contain type 2 deiodinase (D2). This enzyme belongs to a family of enzymes, the deiodinases, that activate or inactivate the different molecular forms of intracellular TH. D2 is the TH-activating deiodinase, which converts T4 to T3 (Gereben et al., 2008). T3 then binds the nuclear TH receptor (TR) in order to regulate gene transcription. TR expression is differentially regulated with different cell types expressing different isoforms (Cheng et al., 2010). The predominant isoform in macrophages is TRα (Kwakkel et al., 2014). In addition its classic transcriptional effects, T3 also has non-genomic effects (Davis et al., 2016). Macrophages that lack D2, and thus presumably have lower intracellular T3 levels, exhibit an impaired pro-inflammatory cytokine response to stimulation with bacterial endotoxin (lipopolysaccharide, LPS) and impaired phagocytosis (Kwakkel et al., 2014). Furthermore, murine macrophages derived from mice that lack TRα (TRαKO) and therefore cannot mediate T3-dependent gene transcription also display functional abnormalities, including impaired cholesterol efflux and increased pro-inflammatory cytokines at baseline (Billon et al., 2014, Furuya et al., 2017), but reduced pro-inflammatory cytokine response to LPS (Kwakkel et al., 2014).

Macrophages are phagocytic cells that are capable of a wide range of functions in vivo. In response to stimuli from their microenvironment, macrophages can shift between a pro-inflammatory and an anti-inflammatory phenotype, a process known as polarization, making them key players in the regulation of the local immune response (Sica and Mantovani, 2012). Pro-inflammatory classically activated macrophages, or M1-like macrophages, are important for microbial killing and the recruitment and activation of other immune cells (Wynn et al., 2013). In contrast, anti-inflammatory alternatively activated macrophages, or M2-like macrophages encompass a heterogeneous spectrum of phenotypes that play a role in tissue homeostasis, remodeling and repair (Wynn et al., 2013).

We hypothesized that optimal intracellular T3 concentrations are essential for pro-inflammatory macrophage function. To test this hypothesis we determined the effects of reduced intracellular T3 generation due to D2KO in vivo in a zebrafish embryo model of pneumococcal meningitis. In addition, we assessed the effect of reduced intracellular T3 on ex vivo pro-inflammatory macrophage function using bone marrow-derived macrophages from D2 knock out (KO) mice. Finally, to determine the role of intracellular T3 in macrophage polarization we analyzed the effects of modulation of intracellular

(5)

108

thyroid hormone metabolism on macrophage polarization in a macrophage cell line.

Methods

Animal care & procedures

All animal experiments were conducted in compliance with relevant institutional and (inter)national guidelines and regulations. Experimental protocols were approved by the Maine Medical Center Research Institute Institutional Animal Care and Use Committee or the Erasmus University Medical Center Animal Ethics Committee. All zebrafish protocols adhered to the international guidelines specified by the European Council Directive 86/609/EEC.

Mice

D2KO mice were kindly provided by dr. V.A. Galton (Galton et al., 2007). WT and D2KO mice in a C57BL/6 genetic background were generated from WT and D2KO parents, respectively. Both female and male WT and D2KO mice were used. Adult mice (3-5 months old) were sacrificed using CO2 asphyxiation. Bone marrow was isolated immediately and processed for flow cytometry staining or macrophage culture. Animals were housed at the Maine Medical Center Research Institute animal facility with 12 hour light/12 hour dark cycles and ad libitum access to water and regular chow.

Adult female C57BL/6 mice (Harlan) aged 2-4 months were sacrificed using CO2 asphyxiation. Bone marrow was isolated immediately and processed for macrophage culture. Animals were housed at the Erasmus Medical Center animal facility under specific pathogen-free conditions with 12 hour light/12 hour dark cycles and ad libitum access to water and regular chow.

Zebrafish

Husbandry and embryo care

The transparent adult Tg(mitfaw2/w2; roya9/a9) casper zebrafish were maintained at 26°C in 5 L aerated tanks with a 14/10 h light/dark cycle at the VU University Medical Center, Amsterdam, the Netherlands. Embryos were collected within the first hour of fertilization, before the 1-cell stage of embryonic development. Zebrafish handling and embryo care were performed as described previously (Jim et al., 2016). Zebrafish were maintained according to standard protocols (zfin.org) and experiments were conducted in compliance with institutional and national animal welfare guidelines and regulations.

Morpholino injections

To transiently block the translation of D2, zebrafish embryos were injected in the 1-4 cell stage with antisense oligonucleotide morpholino (MO). A scrambled control morpholino sequence (SCMO) was used as a control (Bagci et al., 2015). All MOs were purchased from Gene Tools. The specificity of the D2MO has been previously demonstrated by rescue using T3 supplementation (Walpita et al., 2009). Methods for microinjection, MO sequences and concentrations have also been previously described (Bagci et al., 2015, Walpita et al., 2009). Briefly, the casper zebrafish embryos were injected with 2 nl

109

7

of 0.4 mM D2MO or SCMO dissolved in sterile 0.5% (w/v) phenol red solution (Sigma-Aldrich)at 1-4 cell stage as described previously (Bagci et al., 2015). MO sequences were derived from Bagci et al. 2015. D2MO: 5’ -TCC ACA CTA AGC AAG CCC ATT TCGC-3’; scrambled control MO: 5’-CCT CTT ACC TCA GTT ACA ATT TATA-3’ (Gene Tools) Embryos were raised at 28⁰C in E3 medium (5.0 mM NaCl, 0.17 mM KCl, 0.33 mM CaCl·2H2O, 0.33 mM MgCl2·6H2O) supplemented with 0.3 mg/L methylene blue. All procedures were performed according to local animal welfare regulations.

Infection of zebrafish embryos

Meningitis was induced in zebrafish embryos as previously described (Jim et al., 2016). Briefly, D2MO and SCMO zebrafish embryos were injected in the hindbrain ventricle at 2 days post fertilization with 500 colony forming units (CFU) of wild-type Streptococcus pneumoniae serotype 2 D39 strain to induce meningitis. S. pneumoniae serotype 2 D39 were grown overnight on Columbia agar plates supplemented with 5% defibrinated sheep blood at 37⁰C in a humidified atmosphere with 5% CO2. Before injection, bacteria were collected from an overnight culture and suspended in Todd Hewitt broth supplemented with 0.5 % yeast extract (Difco, BD Biosciences) and grown to mid log phase at 37⁰C. Bacteria were harvested by centrifugation (6000 rpm, 10 min), washed with sterile PBS, and suspended in sterile 0.5% (w/v) phenol red solution (Sigma-Aldrich) to aid visualization of the injection process. The number of CFU per injection was determined by quantitative plating of the injection volume.

Survival of the embryos was quantified by determining live and dead embryos at fixed time points between 0 and 96 hours post infection (hpi). The experiment was performed in triplicate with a total of 40 embryos in each group.

Macrophage isolation, culture and stimulation

D2KO mice

For D2KO and WT BMDM, bone marrow was flushed from freshly isolated femurs and tibias with cold sterile PBS without calcium and magnesium, centrifuged, and thoroughly resuspended in DMEM/F12 medium (Gibco) containing 10% [v/v] FCS, 10 mM L-glutamine, 100 IU/ml penicillin and 100 µg/ml streptomycin (hereafter indicated as DMEM/F12-10) supplemented with 20% [v/v] L929 conditioned medium (a macrophage colony stimulating factor (M-CSF) producing cell line). The same batch of L929 conditioned medium was used for all experiments. Cells were counted and plated in non-tissue cultured 150 × 15 mm petri dishes at approximately 5 × 106 cells per petri dish in 30 ml medium. Cells were cultured at 37⁰C with 5% CO2. On day 3, an additional 15 ml of medium containing 20% L929 conditioned medium was added to the culture dishes. Cells were harvested by scraping on day 6-7, washed and replated in DMEM/F12-10 medium without L929 conditioned medium in 6 wells plates at 1x106 cells/well for LPS stimulation or in 24 wells plates at 1x105 cells/well for phagocytosis. The average yield from a 150 mm petri dish was 6-7x106 BMDM. BMDM purity was assessed using flow cytometry staining for F4/80 and was always above 95%. Cells were rested for 16-24 hours prior to stimulation.

(6)

108

thyroid hormone metabolism on macrophage polarization in a macrophage cell line.

Methods

Animal care & procedures

All animal experiments were conducted in compliance with relevant institutional and (inter)national guidelines and regulations. Experimental protocols were approved by the Maine Medical Center Research Institute Institutional Animal Care and Use Committee or the Erasmus University Medical Center Animal Ethics Committee. All zebrafish protocols adhered to the international guidelines specified by the European Council Directive 86/609/EEC.

Mice

D2KO mice were kindly provided by dr. V.A. Galton (Galton et al., 2007). WT and D2KO mice in a C57BL/6 genetic background were generated from WT and D2KO parents, respectively. Both female and male WT and D2KO mice were used. Adult mice (3-5 months old) were sacrificed using CO2 asphyxiation. Bone marrow was isolated immediately and processed for flow cytometry staining or macrophage culture. Animals were housed at the Maine Medical Center Research Institute animal facility with 12 hour light/12 hour dark cycles and ad libitum access to water and regular chow.

Adult female C57BL/6 mice (Harlan) aged 2-4 months were sacrificed using CO2 asphyxiation. Bone marrow was isolated immediately and processed for macrophage culture. Animals were housed at the Erasmus Medical Center animal facility under specific pathogen-free conditions with 12 hour light/12 hour dark cycles and ad libitum access to water and regular chow.

Zebrafish

Husbandry and embryo care

The transparent adult Tg(mitfaw2/w2; roya9/a9) casper zebrafish were maintained at 26°C in 5 L aerated tanks with a 14/10 h light/dark cycle at the VU University Medical Center, Amsterdam, the Netherlands. Embryos were collected within the first hour of fertilization, before the 1-cell stage of embryonic development. Zebrafish handling and embryo care were performed as described previously (Jim et al., 2016). Zebrafish were maintained according to standard protocols (zfin.org) and experiments were conducted in compliance with institutional and national animal welfare guidelines and regulations.

Morpholino injections

To transiently block the translation of D2, zebrafish embryos were injected in the 1-4 cell stage with antisense oligonucleotide morpholino (MO). A scrambled control morpholino sequence (SCMO) was used as a control (Bagci et al., 2015). All MOs were purchased from Gene Tools. The specificity of the D2MO has been previously demonstrated by rescue using T3 supplementation (Walpita et al., 2009). Methods for microinjection, MO sequences and concentrations have also been previously described (Bagci et al., 2015, Walpita et al., 2009). Briefly, the casper zebrafish embryos were injected with 2 nl

109

7

of 0.4 mM D2MO or SCMO dissolved in sterile 0.5% (w/v) phenol red solution (Sigma-Aldrich)at 1-4 cell stage as described previously (Bagci et al., 2015). MO sequences were derived from Bagci et al. 2015. D2MO: 5’ -TCC ACA CTA AGC AAG CCC ATT TCGC-3’; scrambled control MO: 5’-CCT CTT ACC TCA GTT ACA ATT TATA-3’ (Gene Tools) Embryos were raised at 28⁰C in E3 medium (5.0 mM NaCl, 0.17 mM KCl, 0.33 mM CaCl·2H2O, 0.33 mM MgCl2·6H2O) supplemented with 0.3 mg/L methylene blue. All procedures were performed according to local animal welfare regulations.

Infection of zebrafish embryos

Meningitis was induced in zebrafish embryos as previously described (Jim et al., 2016). Briefly, D2MO and SCMO zebrafish embryos were injected in the hindbrain ventricle at 2 days post fertilization with 500 colony forming units (CFU) of wild-type Streptococcus pneumoniae serotype 2 D39 strain to induce meningitis. S. pneumoniae serotype 2 D39 were grown overnight on Columbia agar plates supplemented with 5% defibrinated sheep blood at 37⁰C in a humidified atmosphere with 5% CO2. Before injection, bacteria were collected from an overnight culture and suspended in Todd Hewitt broth supplemented with 0.5 % yeast extract (Difco, BD Biosciences) and grown to mid log phase at 37⁰C. Bacteria were harvested by centrifugation (6000 rpm, 10 min), washed with sterile PBS, and suspended in sterile 0.5% (w/v) phenol red solution (Sigma-Aldrich) to aid visualization of the injection process. The number of CFU per injection was determined by quantitative plating of the injection volume.

Survival of the embryos was quantified by determining live and dead embryos at fixed time points between 0 and 96 hours post infection (hpi). The experiment was performed in triplicate with a total of 40 embryos in each group.

Macrophage isolation, culture and stimulation

D2KO mice

For D2KO and WT BMDM, bone marrow was flushed from freshly isolated femurs and tibias with cold sterile PBS without calcium and magnesium, centrifuged, and thoroughly resuspended in DMEM/F12 medium (Gibco) containing 10% [v/v] FCS, 10 mM L-glutamine, 100 IU/ml penicillin and 100 µg/ml streptomycin (hereafter indicated as DMEM/F12-10) supplemented with 20% [v/v] L929 conditioned medium (a macrophage colony stimulating factor (M-CSF) producing cell line). The same batch of L929 conditioned medium was used for all experiments. Cells were counted and plated in non-tissue cultured 150 × 15 mm petri dishes at approximately 5 × 106 cells per petri dish in 30 ml medium. Cells were cultured at 37⁰C with 5% CO2. On day 3, an additional 15 ml of medium containing 20% L929 conditioned medium was added to the culture dishes. Cells were harvested by scraping on day 6-7, washed and replated in DMEM/F12-10 medium without L929 conditioned medium in 6 wells plates at 1x106 cells/well for LPS stimulation or in 24 wells plates at 1x105 cells/well for phagocytosis. The average yield from a 150 mm petri dish was 6-7x106 BMDM. BMDM purity was assessed using flow cytometry staining for F4/80 and was always above 95%. Cells were rested for 16-24 hours prior to stimulation.

(7)

110

D2KO and WT BMDM were stimulated with 100 ng/ml bacterial endotoxin or lipopolysaccharide (LPS, E.coli O55 B5) for up to 16 hours. Unstimulated controls samples were incubated in parallel. Samples were incubated in triplicate and experiments were repeated independently 4 times. In total, BMDM from 8 mice per genotype were used.

C57BL/6 mice

For C57BL/6 BMDM, bone marrow was harvested by flushing femurs and tibias with cold sterile RPMI1640 containing 2 mM L-glutamine, 10% FCS, 100 IU/ml penicillin and 100 µg/ml streptomycin (RPMI1640-10). Bone marrow cells were filtered through a 40 µm cell strainer to obtain single cell suspensions. Bone marrow cells were cultured for 7 days in 6-wells plates in RPMI1640-10 medium supplemented with 20% LADMAC-conditioned medium (an M-CSF producing cell line) and recombinant murine M-CSF (10 ng/ml; rmMCSF; Prospec) at a density of 5 x 105 cells/ml. An equal volume of RPMI1640-10 medium with rmM-CSF (10ng/ml) was added after 3 days. After 6 days, the culture medium was replaced by fresh RPMI1640-10 medium containing rmM-CSF (10 ng/ml) and potential stimuli.

C57BL/6 BMDM were stimulated with either LPS (50 ng/ml; E.coli O55 B5) and interferon-gamma (IFN-γ; 50 ng/ml; Biosource) or with Interleukin-4 (IL-4, 10 ng/ml; Biosource) for 24 hours. Unstimulated cells were included as controls. In total, BMDM from 5 mice were used.

RAW264.7 cell line and siRNA knockdown

The murine macrophage cell line RAW264.7 was kindly provided by the Tytgat Institute, Academic Medical Center, Amsterdam, the Netherlands. Mycoplasma contamination status was checked regularly using PCR and was always negative. RAW264.7 cells were cultured in RPMI 1640 with L-glutamine, 10 U/ mL of penicillin and streptomycin, and 10% [v/v] FCS (all Lonza). RNA knockdown of Dio2 (D2) and Thra (TRα) was performed by introducing small interfering RNA (siRNA) using electroporation as described in detail previously (Kwakkel et al., 2014). All siRNAs were purchased from Invitrogen. Dio2 siRNAs were designed using Dharmacon software (Kwakkel et al., 2014). Thra and control siRNAs were pre-designed by Invitrogen. Following electroporation, cells were plated at 5x104 cells/ml and rested for 24 hours before stimulation.

Two different siRNAs were used for Dio2 knockdown and three different siRNAs for Thra knockdown with similar results. Scrambled siRNAs with matching GC content were used as controls: low GC (LOGC) and medium GC (MEGC). siRNA introduction resulted in a 70% knockdown of Dio2 and a 69 % knockdown of Thra determined using qPCR. siRNA sequences are listed in Table 7.1. Primer sequences are listed in Table 7.3.

RAW264.7 cells treated with siRNA were stimulated for 24 hours with either LPS (10 ng/ml; Sigma-Aldrich) and IFN-γ (100 IU/ml; Peprotech) to generate pro-inflammatory M1-like macrophages or IL-4 (20 ng/ml; Peprotech) to generate anti-inflammatory M2-like macrophages (Liu et al., 2013a). Unstimulated cells were included as controls. Samples were incubated in quadruplicate and experiments were repeated independently.

111

7

siRNA name siRNA target gene Control

siRNA

Sequence (5`- 3`) Catalog # (Invitrogen)

Dio 2-3 Dio 2 LOGC CCUUCAGCUAUAACCUACAAGAAGU

Dio 2-6 Dio 2 LOGC GAGAAGAAUUUCAGCAAGAGAUGAA

Dio 2-9 Dio 2 LOGC GGACAAUAAUGCCAACGUAGCUUAC

Thra-1 Thra LOGC GACCUAGAGGCCUUCAGCGAGUUUA MSS211754

Thra-2 Thra LOGC GCAUGUCAGGGUAUAUCCCUAGUUA MSS211755

Thra-3 Thra MEGC GGCCAUGGACUUGGUUCUAGAUGAU MSS211756

LOGC Control 12935200

MEGC Control 12935300

Table 7.1; siRNA sequences

Flow cytometric analysis of whole bone marrow

Freshly isolated whole bone marrow was stained using a panel of fluorescently labelled antibodies. All samples were incubated with mouse FC block (BD Biosciences) prior to staining and relevant isotype control antibodies were used to control for background staining. D2KO and WT bone marrow cell populations were quantified by analysis of fluorescence on a MACSQuant flow cytometer (Miltenyi Biotec) and data was analyzed using FlowJo software (v.10). Antibodies are listed in the Table 7.2. Flow cytometry gating was performed as described previously (van der Spek et al., 2017c).

Protein target Fluorescent

CONJUGATE Species raised in; monoclonal or polyclonal Clone Catalog # Manufacturer

Ly-6G PerCP-Cy5.5 Rat IgG2A; monoclonal 1A8 560602 BD Biosciences

Ly-6C PE Rat IgG2c; monoclonal HK1.4 12-5932 eBioscience

CD117 (cKit) APC Rat IgG2b; monoclonal 2B8 17-1171 eBioscience

CD11b APC-Cy7 Rat IgG2b; monoclonal M1/70 557657 BD Biosciences

CD19 PE-Cy7 Rat IgG2A; monoclonal 1D3 25-0193 eBioscience

CD335 PE-Cy7 Rat IgG2A; monoclonal 29A1.4 25-3351 eBioscience

CD3e PE-Cy7 Armenian hamster; monoclonal 145-2C11 25-0031 eBioscience

F4/80 PE Rat IgG2A; monoclonal BM8 12-4801 eBioscience

CD16/CD32 (FC block) Rat IgG2A; monoclonal 93 14-0161 eBioscience

Table 7.2: Flow cytometry antibodies

Phagocytosis assay

Zymosan particles fluorescently labeled with Alexa Fluor 488 (Life Technologies) were opsonized using zymosan bioparticles opsonizing reagent (Life Technologies) at 37⁰C for one hour. Opsonized zymosan was added to BMDM at a multiplicity of infection of 5 and incubated at 37⁰C 5% CO2 for 4 hours after which cells were washed in warm phosphate-buffered saline (PBS) 4 times and harvested in cold PBS with 0.5% BSA by scraping. Samples were run on a MACSQuant flow cytometer (Miltenyi Biotec) and data was analyzed using FlowJo software (v.10). Samples were run in triplicate, the experiment was repeated independently 3 times and a total of 5-6 mice per genotype were used.

(8)

110

D2KO and WT BMDM were stimulated with 100 ng/ml bacterial endotoxin or lipopolysaccharide (LPS, E.coli O55 B5) for up to 16 hours. Unstimulated controls samples were incubated in parallel. Samples were incubated in triplicate and experiments were repeated independently 4 times. In total, BMDM from 8 mice per genotype were used.

C57BL/6 mice

For C57BL/6 BMDM, bone marrow was harvested by flushing femurs and tibias with cold sterile RPMI1640 containing 2 mM L-glutamine, 10% FCS, 100 IU/ml penicillin and 100 µg/ml streptomycin (RPMI1640-10). Bone marrow cells were filtered through a 40 µm cell strainer to obtain single cell suspensions. Bone marrow cells were cultured for 7 days in 6-wells plates in RPMI1640-10 medium supplemented with 20% LADMAC-conditioned medium (an M-CSF producing cell line) and recombinant murine M-CSF (10 ng/ml; rmMCSF; Prospec) at a density of 5 x 105 cells/ml. An equal volume of RPMI1640-10 medium with rmM-CSF (10ng/ml) was added after 3 days. After 6 days, the culture medium was replaced by fresh RPMI1640-10 medium containing rmM-CSF (10 ng/ml) and potential stimuli.

C57BL/6 BMDM were stimulated with either LPS (50 ng/ml; E.coli O55 B5) and interferon-gamma (IFN-γ; 50 ng/ml; Biosource) or with Interleukin-4 (IL-4, 10 ng/ml; Biosource) for 24 hours. Unstimulated cells were included as controls. In total, BMDM from 5 mice were used.

RAW264.7 cell line and siRNA knockdown

The murine macrophage cell line RAW264.7 was kindly provided by the Tytgat Institute, Academic Medical Center, Amsterdam, the Netherlands. Mycoplasma contamination status was checked regularly using PCR and was always negative. RAW264.7 cells were cultured in RPMI 1640 with L-glutamine, 10 U/ mL of penicillin and streptomycin, and 10% [v/v] FCS (all Lonza). RNA knockdown of Dio2 (D2) and Thra (TRα) was performed by introducing small interfering RNA (siRNA) using electroporation as described in detail previously (Kwakkel et al., 2014). All siRNAs were purchased from Invitrogen. Dio2 siRNAs were designed using Dharmacon software (Kwakkel et al., 2014). Thra and control siRNAs were pre-designed by Invitrogen. Following electroporation, cells were plated at 5x104 cells/ml and rested for 24 hours before stimulation.

Two different siRNAs were used for Dio2 knockdown and three different siRNAs for Thra knockdown with similar results. Scrambled siRNAs with matching GC content were used as controls: low GC (LOGC) and medium GC (MEGC). siRNA introduction resulted in a 70% knockdown of Dio2 and a 69 % knockdown of Thra determined using qPCR. siRNA sequences are listed in Table 7.1. Primer sequences are listed in Table 7.3.

RAW264.7 cells treated with siRNA were stimulated for 24 hours with either LPS (10 ng/ml; Sigma-Aldrich) and IFN-γ (100 IU/ml; Peprotech) to generate pro-inflammatory M1-like macrophages or IL-4 (20 ng/ml; Peprotech) to generate anti-inflammatory M2-like macrophages (Liu et al., 2013a). Unstimulated cells were included as controls. Samples were incubated in quadruplicate and experiments were repeated independently.

111

7

siRNA name siRNA target gene Control

siRNA

Sequence (5`- 3`) Catalog # (Invitrogen)

Dio 2-3 Dio 2 LOGC CCUUCAGCUAUAACCUACAAGAAGU

Dio 2-6 Dio 2 LOGC GAGAAGAAUUUCAGCAAGAGAUGAA

Dio 2-9 Dio 2 LOGC GGACAAUAAUGCCAACGUAGCUUAC

Thra-1 Thra LOGC GACCUAGAGGCCUUCAGCGAGUUUA MSS211754

Thra-2 Thra LOGC GCAUGUCAGGGUAUAUCCCUAGUUA MSS211755

Thra-3 Thra MEGC GGCCAUGGACUUGGUUCUAGAUGAU MSS211756

LOGC Control 12935200

MEGC Control 12935300

Table 7.1; siRNA sequences

Flow cytometric analysis of whole bone marrow

Freshly isolated whole bone marrow was stained using a panel of fluorescently labelled antibodies. All samples were incubated with mouse FC block (BD Biosciences) prior to staining and relevant isotype control antibodies were used to control for background staining. D2KO and WT bone marrow cell populations were quantified by analysis of fluorescence on a MACSQuant flow cytometer (Miltenyi Biotec) and data was analyzed using FlowJo software (v.10). Antibodies are listed in the Table 7.2. Flow cytometry gating was performed as described previously (van der Spek et al., 2017c).

Protein target Fluorescent

CONJUGATE Species raised in; monoclonal or polyclonal Clone Catalog # Manufacturer

Ly-6G PerCP-Cy5.5 Rat IgG2A; monoclonal 1A8 560602 BD Biosciences

Ly-6C PE Rat IgG2c; monoclonal HK1.4 12-5932 eBioscience

CD117 (cKit) APC Rat IgG2b; monoclonal 2B8 17-1171 eBioscience

CD11b APC-Cy7 Rat IgG2b; monoclonal M1/70 557657 BD Biosciences

CD19 PE-Cy7 Rat IgG2A; monoclonal 1D3 25-0193 eBioscience

CD335 PE-Cy7 Rat IgG2A; monoclonal 29A1.4 25-3351 eBioscience

CD3e PE-Cy7 Armenian hamster; monoclonal 145-2C11 25-0031 eBioscience

F4/80 PE Rat IgG2A; monoclonal BM8 12-4801 eBioscience

CD16/CD32 (FC block) Rat IgG2A; monoclonal 93 14-0161 eBioscience

Table 7.2: Flow cytometry antibodies

Phagocytosis assay

Zymosan particles fluorescently labeled with Alexa Fluor 488 (Life Technologies) were opsonized using zymosan bioparticles opsonizing reagent (Life Technologies) at 37⁰C for one hour. Opsonized zymosan was added to BMDM at a multiplicity of infection of 5 and incubated at 37⁰C 5% CO2 for 4 hours after which cells were washed in warm phosphate-buffered saline (PBS) 4 times and harvested in cold PBS with 0.5% BSA by scraping. Samples were run on a MACSQuant flow cytometer (Miltenyi Biotec) and data was analyzed using FlowJo software (v.10). Samples were run in triplicate, the experiment was repeated independently 3 times and a total of 5-6 mice per genotype were used.

(9)

112

RNA isolation and qPCR

RNA from D2KO and corresponding WT BMDMs and RAW264.7 cells was isolated using the High Pure RNA isolation kit (Roche). RNA from polarized C57BL/6 BMDMs was isolated using Qiazol (Qiagen) according to manufacturer’s instructions.

cDNA was synthesized with equal RNA input using AMV Reverse Transcriptase enzyme with oligo d(T) primers (Roche). A cDNA synthesis reaction without reverse transcriptase was included as a control for genomic DNA contamination. Quantitative PCR was carried out using the Lightcycler 480 (Roche) and SensiFAST SYBR No-ROX (Bioline) and analyzed using LinReg software. The mean of the efficiency was calculated for each assay, and samples that deviated more than 0.05 of the efficiency mean value were excluded from the analysis (0-5%). Primer sequences are listed in Table 7.3 and include previously published and newly designed primers (Bouaboula et al., 1992, van Zeijl et al., 2011, Kwakkel et al., 2014, Kwakkel et al., 2008, Bloise et al., 2016, Bakker, 2001, Boelen et al., 2004, de Vries et al., 2015, Sweet et al., 2001). mRNA expression values were normalized using the geometric mean of three reference genes in accordance with the MIQE guidelines (Bustin et al., 2009), and corrected for plate average. Relative expression values are shown.

Gene Protein Forward strand

(5’- 3’) Reverse strand (5’- 3’) Source

Csf2 GM-CSF TGAACCTCCTGGATGACATG GTGTTTCACAGTCCGTTTCC Bouaboula et al. 1992;

Il1b IL-1β TTGACGGACCCCAAAAGATG AGAAGGTGCTCATGTCCTCA Bouaboula et al. 1992;

Tnf TNFα TCTCATCAGTTCTATGGCCC GGGAGTAGACAAGGTACAAC Bouaboula et al. 1992;

Il6 IL-6 GTTCTCTGGGAAATCGTGGA TGTACTCCAGGTAGCTATGG Bouaboula et al. 1992;

Il10 IL-10 ATGCAGGACTTTAAGGGT-_TACTTG TAGACACCTTGGTCTTGGAGCTTA Bouaboula et al. 1992;

Nos2 iNOS ACATCGACCCGTCCACAGTAT CAGAGGGGTAGGCTTGTCTC Harvard primer bank _{(no. 146134510c2)}

Arg1 Arg 1 CAGCACTGAGGAAAGCTGGT CAGACCGTGGGTTCTTCACA Newly designed

Dio1 Deiodinase 1 GAGCAGCCAGCTCTACGCGG TGGGGAGCCTTCCTGCTGGT van Zeijl et al. 2011;

Dio2 Deiodinase 2 GCTTCCTCCTAGATGCCTACAA CCGAGGCATAATTGTTACCTG Kwakkel et al. 2008;

Dio3 Deiodinase 3 CCAACTCTAGCAGTTCCGCA GCCTCCCTGGTACATGATGG Newly designed

Slc16a2 MCT8 GTGCTCTTGGTGTGCATTGG GGGACACCCGCAAAGTAGAA Bloise et al. 2016;

Slc16a10 MCT10 TGATTCCCCTGTGCAGCGCC CCACGTCGTAGGTGCCCAGC Kwakkel et al. 2014;

Thra1 TRα1 CATCTTTGAACTGGGCAAGT CTGAGGCTTTAGACTTCCTGATC Bakker 2001;

Thra2 TRα2 CATCTTTGAACTGGGCAAGT GACCCTGAACAACATGCATT Bakker 2001;

Thrb1 TRβ1 CACCTGGATCCTGACGATGT ACAGGTGATGCAGCGATAGT Boelen et al. 2004;

Hprt HPRT GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCAA Sweet et al. 2001;

Ppib Cyclophillin B GAGACTTCACCAGGGG CTGTCTGTCTTGGTGCTCTCC de Vries et al. 2015;

Eef1a1 EF1α1 AGTCGCCTTGGACGTTCTT ATTTGTAGATCAGGTGGCCG Kwakkel et al. 2014;

Rplp0 RPL0 GGCCCTGCACTCTCGCTTTC TGCCAGGACGCGCTTGT Bloise et al. 2016;

Table 7.3: Primer sequences for qPCR

113

7

Cytokine measurements

Cytokines were measured in supernatant of stimulated D2KO and WT BMDM using the BD Biosciences Cytometric Bead Array Mouse Inflammation kit according to manufacturer’s instructions. Samples were run in triplicate on a FACS Calibur flow cytometer (BD Biosciences). Data was analyzed using FlowJo software (version 10).

Statistical analysis

Statistical significance was tested using one-way or two-way ANOVA followed by post hoc test (Tukey or Sidak) or by Student’s two-tailed t test. Zebrafish survival date were analyzed using the log rank (Mantel-Cox) test. P-values <0.05 were considered statistically significant. All tests were performed using Graphpad Prism 7.

Results

A lack of D2 impairs survival of zebrafish embryos during pneumococcal meningitis To determine the role of D2 in pro-inflammatory macrophage function in vivo we used a combination of two established models in zebrafish embryos. Successful modulation of intracellular T3 levels by inhibition of deiodinase enzymes using morpholino technology has been previously described by Walpita et al (Walpita et al., 2009). We established a D2 knockdown in zebrafish embryos using this technique. We combined this with a recently developed model for bacterial meningitis in zebrafish embryos (Jim et al., 2016), to determine the effects of changes in intracellular TH availability on macrophage function during bacterial infection in vivo. Zebrafish embryos pre-treated with D2 morpholinos or scrambled control morpholinos were injected with live Streptococcus pneumoniae directly into the hindbrain ventricle, resulting in bacterial meningitis. Knockdown of D2 resulted in a significant increase in mortality in zebrafish embryos exposed to pneumococcal meningitis compared to controls (Figure 7.1).

0 24 48 72 96 0 50 100 Percen ts urvi va l

Hours post infection

SCMO D2MO

p<0.001 Figure 7.1: D2 knockdown impairs zebrafish

survival during bacterial meningitis.

Kaplan-Meier survival curve of zebrafish embryos pretreated with D2 morpholino (D2MO) or scrambled control morpholino (SCMO) during bacterial meningitis induced by injection of 500 CFU of S. pneumoniae into the hindbrain ventricle. Data represent 40 embryos per group. P-value for log rank (Mantel-Cox) test is indicated.

(10)